Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Jun 15.
Published in final edited form as: Free Radic Biol Med. 2010 Mar 17;48(12):1618–1625. doi: 10.1016/j.freeradbiomed.2010.03.007

Oxidative Stress Modulates PPARγ in Vascular Endothelial Cells

Carmelo Blanquicett 1, Bum-Yong Kang 1, Jeffrey D Ritzenthaler 1, Dean P Jones 1, C Michael Hart 1,*
PMCID: PMC2868091  NIHMSID: NIHMS188562  PMID: 20302927

Abstract

The peroxisome proliferator-activated receptor gamma (PPARγ) plays an important role in vascular regulation. However, the impact of oxidative stress on PPARγ expression and activity has not been clearly defined. Human umbilical vein endothelial cells (HUVECs) were exposed to graded concentrations of H2O2 for 0.5–72 h, or bovine aortic endothelial cells (BAECs) were exposed to alterations in extracellular thiol/disulfide redox potential (Eh) of the cysteine (Cys)/cystine (CySS) couple. Within 2 h, H2O2 reduced HUVEC PPARγ mRNA and activity and reduced the expression of two PPARγ-regulated genes without altering PPARγ protein levels. After 4 h H2O2 exposure, mRNA levels remained reduced while PPARγ activity returned to control levels. PPARγ mRNA levels remained depressed for up to 72 h after exposure to H2O2, without any change in PPARγ activity. Catalase prevented H2O2-induced reductions in PPARγ mRNA and activity. H2O2 1) reduced luciferase expression in HUVECs transiently transfected with a human PPARγ promoter reporter, 2) failed to alter PPARγ mRNA half-life, and 3) transiently increased expression and activity of c-Fos and phospho-c-Jun. Treatment with the AP-1 inhibitor, curcumin, prevented H2O2-mediated reductions in PPARγ expression. In addition, media having an oxidized Eh reduced BAEC PPARγ mRNA and activity. These findings demonstrate that oxidative stress, potentially through activation of inhibitory redox-regulated transcription factors, attenuates PPARγ expression and activity in vascular endothelial cells through suppression of PPARγ transcription.

Keywords: PPARγ, endothelial cell, oxidative stress

INTRODUCTION

The ligand-activated peroxisome proliferator-activated receptor gamma (PPARγ) is a member of the nuclear hormone receptor superfamily of transcription factors that regulates genes involved in lipid and glucose metabolism. Clinically, synthetic thiazolidinediones that activate PPARγ are employed to improve lipid and glucose metabolism in type 2 diabetes [1]. PPARγ activation is also mediated by structurally diverse natural lipophilic ligands including fatty acids and their derivatives. Ligand-induced activation of PPARγ promotes heterodimerization with the retinoid X receptor and binding to PPARγ response elements in selected target genes, resulting in transcriptional regulation. PPARγ is expressed in smooth muscle [2] and endothelial cells [3] of the vascular wall and exerts pleiotropic effects on metabolism and inflammation in vascular biology [1]. Limited evidence suggests that factors promoting vascular dysfunction may reduce PPARγ expression or activity. For example, infusion of insulin and glucose caused endothelial dysfunction, increased reactive oxygen species (ROS) production, and reduced PPARγ protein levels in rat aorta [4]. These derangements were attenuated in animals treated with the thiazolidinedione PPARγ ligand, pioglitazone. Thiazolidinedione treatment also attenuated tumor necrosis factor-alpha (TNF-α) and interlukin-1 alpha (IL-1α)-stimulated reductions in PPARγ mRNA in mature rat adipocytes [5]. These findings suggest that certain pathological stimuli may reduce PPARγ expression.

ROS and oxidative stress play critical roles in the pathogenesis of cardiovascular disease and can modulate vascular function through a variety of mechanisms [6]. For example, hydrogen peroxide (H2O2), a reactive species that permeates lipid membranes, is capable of causing damage to multiple cellular components including lipids, proteins and DNA at high concentrations [7, 8]. H2O2, produced endogenously by inflammatory or vascular cells, can induce oxidative stress, which may contribute to vascular disease and endothelial cell dysfunction [9]. In addition to directly damaging vascular wall cells, lower ROS concentrations stimulate alterations in signaling and gene expression that modulate vascular function [10]. Recent studies have suggested mechanistic links between PPARγ and oxidative stress. For example, PPARγ activation regulated oxidative stress in colon tumor cells [11], osteoblasts [12], macrophages [13], renal tubular epithelial cells [14], cardiomyocytes [15], and vascular endothelial cells [16]. Stimulation of PPARγ in vitro and in vivo reduced the activity and expression of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase [16–18]. In addition to reducing ROS generation, PPARγ ligands also increased vascular endothelial nitric oxide (NO) production by enhancing the activity of endothelial nitric oxide synthase (eNOS) [19–21]. Collectively, these reports indicate that activation of PPARγ in vascular wall cells has the potential to reduce oxidative stress, enhance NO bioavailability, and decrease endothelial dysfunction. These reports also suggest the therapeutic potential for targeting PPARγ in cardiovascular disease [21].

While mounting evidence has emphasized that PPARγ can regulate oxidative stress [11–13], emerging evidence suggests that oxidative stress modulates PPARγ. For example, H2O2- induced oxidative stress significantly reduced PPARγ activity in renal tubular epithelial cells [14] and osteoblasts [12] and inhibited PPARβ expression in HUVECs [22]. However, the direct effects of oxidative stress on PPARγ expression and activity in endothelial cells have not been examined. Because oxidative stress contributes to vascular pathology in patients with hypertension, diabetes, and atherosclerosis [23], and because PPARγ ligands have been shown to favorably modulate inflammatory mediators and vascular function, we hypothesized that oxidative stress would reduce vascular PPARγ expression and activity thereby contributing to inflammation and redox imbalance in the vascular wall. To explore this hypothesis, the current study investigated the impact of treatment with H2O2 on endothelial PPARγ expression and activity in vitro. Furthermore, because intracellular signaling pathways respond not only to ROS but to alterations in the extracellular Eh of the cysteine (Cys)/cystine (CySS) thiol couple [24, 25], the current study examined if physiologically relevant alterations in the thiol/disulfide redox state could modulate endothelial PPARγ expression and activity. Our findings provide novel evidence for direct effects of oxidative stress on PPARγ expression and activity in vascular endothelial cells.

MATERIALS and METHODS

Cell Culture

Monolayers of human umbilical vein or bovine aortic endothelial cells (HUVECs or BAECs, respectively) from Clonetics (Invitrogen, Carlsbad, CA) were grown and maintained in endothelial growth medium (EGM, Lonza, Conshohocken, PA) containing 10% heat-inactivated fetal bovine serum (FBS), 10 ng/mL human epidermal growth factor, 1.0 μg/mL hydrocortisone, 12 μg/mL bovine brain extract, 50 μg/mL gentamicin, and 50 ng/mL amphotericin-B in a 5% CO2 environment at 37°C as previously reported [16, 26]. Forty-eight hours after seeding, the culture medium was changed to 2% FBS EGM medium in HUVECs and 0.5% FBS DMEM medium in BAECs. In all experiments, confluent HUVEC monolayers (passage 2–6), plated on 0.2% gelatin-coated 100 mm plastic tissue culture dishes, were treated with vehicle (Phosphate Buffered Saline, PBS) or with graded concentrations of H2O2 (1–1000 μM) in 2% FBS EGM medium for 0.5–72 h. For exposures longer than 8 h, H2O2 containing media were refreshed every 8 h. In separate experiments, BAECs were treated with media that was manipulated to generate clinically relevant alterations in the Cys:CySS redox potential as we have previously reported [26]. BAECs rather than HUVECs were employed in these studies to precisely replicate the carefully characterized system in which alterations in Eh caused changes in endothelial gene expression and function. In brief, the media was changed to cyst(e)ine-free Dulbecco’s Modified Eagle Medium with 0.5% serum. To generate the desired Eh, varied concentrations of Cys and CySS were added to cyst(e)ine-free media to give a constant total amount of Cys equivalents (200 μmol/L) as described previously [24]. Eh for Cys/CySS was calculated with the Nernst equation: Eh = E0 + RT/2F ln([CySS]/[Cys]2), where E0 = −250 mV at pH 7.4 as previously described [26, 27].

Cytoxicity Assays

Toxilight™ Cytotoxicity assays (Invitrogen, Carlsbad, CA) were employed to select H2O2 exposure conditions that were not associated with HUVEC cytotoxicity. In brief, the Toxilight assay monitors adenylate kinase (AK) release from cells as an indicator of cell viability. Media samples above HUVEC monolayers were aspirated periodically as indicated during H2O2 treatment. Following addition of AK substrate (provided by the manufacturer), the samples were incubated for 5 minutes and analyzed on a luminometer (Victor 3, 1420 Multilabel Counter, Perkin Elmer, Waltham, MA) for a period of 1 s.

PPARγ Activity Assay

Nuclear extracts of selected samples were prepared in complete lysis buffer using a nuclear extraction kit (Active Motif®, Carlsbad, CA). PPARγ activity was then quantified using the TransAM™ PPARγ activity kit (Active Motif®). Briefly, this kit employs an ELISA-type format with an immobilized oligonucleotide containing PPARγ response elements. A primary antibody recognizes an accessible epitope on PPARγ protein upon DNA binding. A secondary HRP-conjugated antibody is added, and colorimetric readouts are obtained using spectrophotometry to estimate relative changes in PPARγ nuclear binding following designated interventions.

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Total RNA isolation and purification was accomplished using TRIZOL® Reagent (Invitrogen, Carlsbad, CA) and RNeasy Mini-Kit (Invitrogen) according to the manufacturer’s instructions. Total RNA (1 μg) was reverse transcribed using random nanomer primers (BD Biosciences, San Jose, CA) and Superscript II Reverse Transcriptase (Invitrogen). qRT-PCR was performed on a Light Cycler 1.5 PCR Detection System (Roche Diagnostics Corporation, Indianapolis, IN) and I-cycler IQ detection system (Bio-Rad, Hercules, CA). Quantification and melting curves were analyzed with Light Cycler software (Roche Diagnostics). Human PPARγ (common mRNA region, see Table 1), PPARγ 1, PPARγ 2, PPARγ 3, and PPARγ 4 transcript variants (promoter specific region) [28], plasminogen activator inhibitor type-1 (PAI-1), and phosphatase and tensin homolog (PTEN) mRNA levels were normalized to 18S rRNA reference gene and expressed as percent control values as we have previously reported [18]. The primer sequences for qRT-PCR are shown in Table 1. The comparative threshold cycles (Ct) values were normalized for 18S reference gene and compared with a calibrator using the 2−ΔΔCt method [29].

Table 1.

Primer information for quantitative real-time PCR (qRT-PCR).

Gene Symbol mRNA product length(bp) Annealing temperature(3) Primer sequences (5′-3′) GenBank Accession #
PPARγ Common region* 60 F: TGACAGGAAAGACAACAGACAAAT
R: GGGTGATGTGTTTGAACTTGATT
PPARγ1 162–263 (102 bp) 60 F: GTGGCCGCAGATTTGAAAGAAG NM_138712
R: TGTCAACCATGGTCATTTCG
PPARγ2 70–204 (135 bp) 60 F: CAAACCCCTATTCCATGCTGTT NM_015869
R: AATGGCATCTCTGTGTCAACC
PPARγ3 156–243 (88 bp) 60 F: AGAAGCCTGCATTTCTGCAT NM_138711
R: TGGCCTTGTTGTATATTTGTGGTT
PPARγ4 162–182 (80 bp) 60 F: GTGGCCGCAGAAATGACCATG NM_005037
R: GAGAGATCCACGGAGCTGAT
PAI-1 53–113 (61 bp) 60 F: AAGGCACCTCTGAGAACTTCA M16006
R: CCCAGGACTAGGCAGGTG
PTEN 1497–1591 (96 bp) 60 F: GGGGAAGTAAGGACCAGAGAC NM_000314
R: TCCAGATGATTCTTTAACAGGTAGC
18S rRNA 1491-1669179 (179 bp) 60 F: GTCTGTGATGCCCTTAGATG NR_003286
R: AGCTTATGACCCGCACTTAC
*

PPARγ1 (957–1052 bp), PPARγ2 (885–980 bp), PPARγ3 (984–1079 bp), and PPARγ4 (883–978).

PPARγ Promoter Activity Assay

HUVECs in 24-well plates were transfected with a construct containing the pGL3 luciferase reporter vector (Promega, Madison, WI) containing a full-length, 3 kb human PPARγ 1p3000 promoter cDNA (GenBank Accession #: NM_138712) as described (pGL3-PPARγ 1, 1 μg/well, provided by Dr. Johan Auwerx, Institut Pasteur) [30] and with the control vector phRL-thymidine kinase driving renilla luciferase expression (0.5 μg/well; used as an internal reporter to normalize for variations in transfection efficiency, Promega). HUVECs were transfected with these reporters using JetPEI-HUVECs (Polyplus-transfection Inc, New York, NY) for 24 h according to conditions recommended by the manufacturer. After 2 h incubation with or without H2O2, cells were lysed and assayed for PPARγ and thymidine kinase promoter luciferase activities by luminescence.

PPARγ mRNA Half-life Determination

PPARγ mRNA half-life determinations were performed in HUVECs as previously described [31]. Briefly, 1 × 106 cells were split into dishes and incubated for 24 h to allow the cells to adhere and reach 75% confluence. The cells were then incubated in EGM without FBS overnight. Each monolayer was then treated with H2O2 (100 μM) or sterile PBS (control) for 30 min followed by actinomycin-D (10 μg/mL). Cells were collected at intervals following actinomycin-D addition, and total RNA was isolated for measurement of PPARγ mRNA levels using qRT-PCR. The RNA half-life was extrapolated from the PPARγ mRNA decay curve as the time point following actinomycin D treatment at which there was 50% of the initial RNA level remaining.

Western blot analysis

After treatment with PBS or H2O2, HUVEC monolayers were washed with cold Hank’s Balanced Salt Solution (HBSS), then solubilized for 10 minutes with cell lysis buffer at 4°C [20 mM Tris pH 7.4, 2.5 mM EDTA, 100 mM NaCl, 10 mM NaF, 1 mM Na3VO4, 1% Triton X-100, 0.1% SDS, 1% Na deoxycholate, 1 tablet/10 ml EDTA-free Complete protease inhibitor cocktail (Roche, Indianapolis, IN), 1 mM β-glycerolphosphate, 2.5 mM Na pyrophosphate]. HUVEC lysates were collected by scraping into microfuge tubes, sonicated on ice (ten 2-second bursts at 2 W), and spun at 16,000 ×g for 10 minutes. The supernatants were transferred to new tubes, and protein concentrations were determined using the bicinchoninic acid protein assay (Pierce, Rockford, IL). Equal amounts of protein were added to sodium dodecyl sulfate (SDS) sample buffer solution, and proteins (10 μg) were loaded into 4–12% bis-tris-PAGE precast mini gels (Invitrogen). After SDS-PAGE, proteins were transferred to polyvinylidene difluoride membranes that were then treated with primary antibody (1:1,000 dilution) in TBST (10 mM Tris-HCl, 150 mM NaCl, 0.1% Tween, pH 7.4) containing 5% powdered non-fat dry milk. Primary antibodies included c-Fos rabbit polyclonal antibody (Cat # ab7963, 41 kDa, AbCAM Inc., Cambridge, MA), PPARγ rabbit polyclonal antibody (54.6 and 57.6 kDa, custom made by Bethyl Laboratories, Montgomery, TX), c-Jun and phospho-c-Jun antibodies (Cat #9165, 43 kDa, and #9164, 48 kDa, respectively, Cell Signaling Technologies, Danvers, MA), CDK4 antibody (Cat #SC-260, 34 kDa, Santa Cruz Biotechnology, Santa Cruz, CA). Proteins were visualized using a peroxidase-coupled anti-goat or rabbit IgG in the presence of LumiGlo reagent. Bands were identified by chemiluminescence, quantified by laser densitometry (Biorad chemidoc XRS/HG densitometer, Hercules, CA), and normalized to CDK4 levels within the same lane. All Western blot gradient (4–12%) gels and 4X NuPAGE Lithium Dodecyl Sulfate Sample Buffer (40 % glycerol, 423 mM Tris HCL, 8 % LDS, 2.1 mM EDTA, 0.075 % Serva Blue G250, 0.025 % Phenol Red) which was diluted to a 1X solution with 50 mM DTT were purchased from Invitrogen. Supersignal chemiluminescence substrate, which detects horseradish peroxidase on immunoblots, was acquired from Pierce (Rockford, IL).

Statistical analysis

For all experiments, statistical analysis was performed by Student’s t-test or one-way ANOVA followed by post-hoc analysis with either Dunnet’s Multiple Comparison Test or Student-Newman-Keuls test in order to detect differences between and among experimental groups using the software GraphPad Prism, version 4.0 (La Jolla, CA). The level of statistical significance was set at an alpha value of ≤ 0.05.

RESULTS

H2O2-induced cytotoxicity

We employed H2O2 treatment as a model system to examine the impact of oxidative stress on endothelial PPARγ mRNA expression and activity. To select H2O2 concentrations that did not cause HUVEC cytotoxicity following prolonged exposure, the release of intracellular adenylate kinase was measured using the Toxilight Assay™. As shown in Figure 1, compared to treatment with media alone, treatment with H2O2 concentrations of 500 and 1000 μM for 72 h caused significant cytotoxicity indicated by approximately 1.5 fold increases in adenylate kinase release. Exposing HUVECs to H2O2 concentrations from 1–100 μM added to culture media did not cause cytotoxicity.

Figure 1. The effect of H2O2 exposure on HUVEC cytotoxicity.

Figure 1

HUVECs were treated with graded H2O2 concentrations in EGM containing 2% serum and antimicrobials for 72 h. Cell injury was examined by measuring the release of intracellular adenylate kinase into culture media. Each bar represents the mean ± SEM adenylate kinase luminescence in relative light units from 3–4 separate experiments. *P < 0.01 vs. control (0 μM H2O2).

H2O2 inhibits PPARγ mRNA expression but not PPARγ protein expression and activity

To examine the effect of oxidative stress on PPARγ expression, HUVECs were exposed to non-cytotoxic concentrations of H2O2, and PPARγ mRNA levels were measured. Primers recognizing all PPARγ isoforms as well as those specific for PPARγ 1–4 were employed in preliminary studies (Table 1). PPARγ 2 was undetectable in HUVECs whereas PPARγ 1, 3, and 4 were all detectable and similarly reduced by treatment with H2O2 (data not shown). As a result, all subsequent qRT-PCR analyses employed “common” primers detecting all PPARγ isoforms. As shown in Figure 2A, following treatment with H2O2 for 72 h, PPARγ mRNA levels were slightly diminished by 5 and 25 μM H2O2 and significantly reduced by 50 and 100 μM H2O2. To determine if H2O2-induced reductions in endothelial PPARγ mRNA were associated with comparable alterations in PPARγ activity, nuclear extracts were prepared and subjected to PPARγ activity assays. As shown in Figure 2B, only the cytotoxic, 1000 μM H2O2 concentration (positive control) significantly reduced PPARγ activity, whereas treatment with non-cytotoxic H2O2 concentrations for 72 h had no significant effect on PPARγ activity.

Figure 2. Prolonged exposures to non-cytotoxic H2O2 concentrations decrease PPARγ mRNA expression without altering PPARγ activity.

Figure 2

HUVECs were treated with graded concentrations of H2O2 three times a day for 72 h. In A, PPARγ and 18S mRNA levels were determined by qRT-PCR. Each bar represents the mean PPARγ mRNA level ± SEM from 4 experiments calculated relative to 18S and expressed as fold change vs. control (0 μM H2O2). *P < 0.05 vs. control. In B, PPARγ activity assays were performed on nuclear extracts. Each bar represents the mean PPARγ activity as arbitrary spectrophotometric optical density readings ± SEM. *P < 0.01 vs. control (0 μM H2O2).

To further explore the temporal onset of H2O2-mediated reductions in PPARγ mRNA levels, HUVECs were examined following exposure to 100 μM H2O2 for 0–8 h. After 1 h, H2O2 produced rapid and significant reductions in PPARγ mRNA levels (Figure 3A), while PPARγ protein levels remained stable for as long as 8 h following the addition of H2O2 (Figure 3B). Compared with untreated HUVECs, H2O2 significantly decreased HUVEC PPARγ activity levels 0.5 and 2 h following the onset of oxidative stress, whereas near complete recovery of PPARγ activity was observed 4 h following the onset of H2O2 exposure (Figure 3C). To explore the biological function of PPARγ in H2O2-treated endothelial cells, PAI-1 and PTEN mRNA levels were examined as representative PPARγ-target genes in endothelial cells [3, 18, 32]. Treating HUVECs with H2O2 for 2 h significantly decreased PAI-1 and PTEN mRNA levels in a time-dependent manner (Figure 3D and 3E, respectively).

Figure 3. Acute H2O2 exposure reduces PPARγ mRNA, activity, and biological function.

Figure 3

HUVECs were treated with 100 μM H2O2 (0.5–8 h) and collected for analysis. In A, each bar represents the mean ± SEM PPARγ mRNA levels relative to 18S expressed as fold change vs. control values for HUVECs at the same time point from 3 experiments. *P < 0.05 vs control (0 μM H2O2). In B, PPARγ protein levels were determined by western blotting in control and H2O2- treated HUVECs. Each bar represents the mean PPARγ protein level relative to CDK4 in each sample ± SEM expressed as fold change vs. control from cells not treated with H2O2, n=10. In C, each bar represents the mean PPARγ activity ± SEM as a percentage of control cells not treated with H2O2, n=10, *P < 0.05 vs. controls. In D and E, quantitative real-time PCR was performed for PAI-1 (D), PTEN (E), and 18S. Each bar represents mean ± SEM PAI-1 or PTEN mRNA levels relative to 18S expressed as fold change from control. n=3, *P < 0.05 vs. control.

Catalase prevents H2O2-induced reductions in PPARγ mRNA and activity

To confirm that H2O2 was the proximal stimulus for alterations in PPARγ mRNA levels and activity, studies were performed following the addition of catalase, which degrades H2O2. Catalase prevented reductions in PPARγ mRNA levels (Figure 4A) and activity (Figure 4B) caused by treatment with 100 μM H2O2 for 30 minutes. To examine the potential role of H2O2- induced generation of oxidized fatty acids from serum lipids in alterations in PPARγ expression and activity, 2% serum in culture medium was preincubated with 100 μM H2O2 for 2 h at 37 °C, then preincubated with 200 U/mL catalase for an additional 2 h at 37°C in a test tube. HUVECs were then treated with H2O2 and catalase preconditioned media for 2 h at 37°C. As shown in Figure 4C, H2O2 and catalase preconditioned media did not alter HUVEC PPARγ mRNA expression, suggesting that H2O2 itself and not products of H2O2–induced serum oxidation mediated changes in endothelial PPARγ expression in this system.

Figure 4. Catalase prevented H2O2-mediated decreases in HUVEC PPARγ mRNA levels and activity.

Figure 4

HUVECs were treated with 100 μM H2O2 for 30 min. Selected HUVECs were preincubated with 200 U/mL catalase for 30 min prior to H2O2 exposure as indicated. In A, HUVEC PPARγ mRNA levels determined by qRT-PCR are shown. Each bar represents the mean mRNA level ± SEM from 8 separate experiments expressed as fold change vs. control. *P < 0.05 vs. control. In B, PPARγ activity was determined following treatment with or without H2O2 ± catalase treatment. Each bar represents the mean PPARγ activity level ± SEM from 8 experiments expressed as % control. *P < 0.05 vs. control. In C, HUVECs were treated for 2 h with culture medium preincubated with 100 μM H2O2 for 2 h followed by preincubation with 200 U/mL catalase for 2 h at 37°C. Each bar represents the mean PPARγ mRNA levels relative to 18S ± SEM from 3 experiments expressed as % control. *P < 0.05 vs. control.

H2O2 inhibits PPARγ promoter activity

To further examine the mechanisms by which H2O2 reduced HUVEC PPARγ mRNA levels, PPARγ promoter activity was measured in HUVECs transiently transfected with a luciferase reporter construct controlled by the full-length 3 kb PPARγ promoter cDNA. In pilot experiments, HUVECs in 24-well plates were treated with pGL3 luciferase reporter vectors for 24 h at 37°C in 5% CO2/95 % air. Transfection efficiency was measured as the activity of the phRL-thymidine kinase driven Renilla reporter in HUVECs. Transfection efficiency in HUVECs mediated by pGL3 luciferase reporter vector was determined to be 40% (data not shown). H2O2- treated HUVECs demonstrated significant decreases in PPARγ transcription, with approximately 3-fold lower levels of luciferase activity relative to controls, indicating that H2O2 inhibits the activity of the PPARγ promoter in endothelial cells (Figure 5A). Furthermore, H2O2 did not alter PPARγ mRNA half-life (Figure 5B).

Figure 5. Mechanisms of H2O2-induced reductions in HUVEC PPARγ mRNA levels.

Figure 5

In A, luciferase activity was measured in HUVEC transfected with a PPARγ promoter reporter construct following treatment with 100 μM H2O2 for 2 h. Each bar represents the mean luciferase activity relative to renilla luciferase ± SEM. *P < 0.05 vs. control (0 h). In B, PPARγ mRNA half-life determination in HUVECs following H2O2 exposure was performed. HUVECs were exposed to 100 μM H2O2 for 30 minutes, and cells were harvested at designated time points following actinomycin-D treatment. PPARγ mRNA levels were determined by qRT-PCR. Each point represents the mean PPARγ mRNA levels in HUVEC ±SEM.

Oxidation of extracellular Cys/CySS redox state reduced PPARγ activity in BAECs

Although micromolar H2O2 concentrations may be generated in microenvironments between adherent leukocytes and vascular endothelial cells, we sought to examine the effects of additional oxidative stimuli to which vascular endothelial cells may be exposed. The redox state of thiol/disulfide couples in plasma has been previously reported to be altered under pathophysiological conditions [33] and to modulate endothelial cell function [26]. Therefore, to determine whether alterations in extracellular redox modulate PPARγ expression and activity, BAECs were exposed to well characterized concentrations of Cys and CySS in culture media as previously reported [26]. As illustrated in Figure 6A, compared to physiological Eh (−80 mV), treating BAECs with oxidized Cys/CySS redox potential (0 mV) for 2 h reduced PPARγ activity levels. Interestingly, more oxidized (0 mV) conditions tended to reduce PPARγ mRNA levels, although this trend did not reach statistical significance (Figure 6B).

Figure 6. Impact of extracellular Cys/CySS redox state on PPARγ mRNA and activity.

Figure 6

Confluent BAECs plated in 100 mm dishes were exposed to oxidized or normal Cys/CySS Eh (0 and −80 mV, respectively) for 2 h and examined for PPARγ mRNA and activity levels. In A, each bar represents the mean ± SEM PPARγ activity in BAECs exposed to defined extracellular Cys/CySS redox states for 2 h, n=5, *P < 0.05 vs normal (−80 mV) Eh. In B, each bar represents the mean fold changes in PPARγ mRNA levels relative to normal Eh (−80 mV) ± SEM.

H2O2-mediated activation of AP-1 contributes to reductions in HUVEC PPARγ expression

The PPARγ promoter contains multiple activator protein 1 (AP-1) sites upstream of the transcriptional start site, and AP-1 was previously reported to reduce PPARγ expression [34]. AP1 transcription factors consist of homodimers of Jun family members or heterodimers of Jun and Fos. Increased expression of c-Fos or phosphorylation of c-Jun (p-c-Jun) has been shown to contribute to activation of AP-1 [35]. Accordingly, to further explore the mechanisms involved in the regulation of PPARγ by oxidative stress, we examined the effects of H2O2 on the expression and activation of c-Fos, c-Jun, and p-c-Jun. As shown in Figure 7, H2O2 stimulated transient increases in c-Jun expression that did not achieve statistical significance (Figure 7B), as well as significant increases in c-Fos expression (Figure 7C) and c-Jun phosphorylation (Figure 7D) that peaked 1–2 h following the onset of H2O2 exposure. To elucidate whether AP-1 mediates alterations in PPARγ expression caused by H2O2, HUVECs were preincubated with curcumin which inhibits H2O2-induced AP-1 activation [36]. Curcumin significantly attenuated H2O2-mediated reductions in HUVEC PPARγ expression (Figure 7E).

Figure 7. H2O2 increased phospho-c-Jun protein expression levels.

Figure 7

HUVECs were treated with control (0 h) or 100 μM H2O2 for 0.5–8 h as indicated. Cell lysates were prepared at each time point and subjected to Western blotting for c-Fos, c-Jun, phospho-c-Jun, and CDK4. In A, representative immunoblots for c-Fos, c-Jun, phospho-c-Jun, and CDK4 are presented. In B–D, bar graphs represent the mean ± SEM levels of c-Fos, c-Jun and phospho-c-Jun, relative to CDK4 and expressed as fold change from control cells from 6 experiments. *P < 0.05 vs. control. In E, HUVECs were preincubated with 10 μM curcumin for 1 h. HUVECs were then stimulated with or without 100 μM H2O2 for 2 h. PPARγ mRNA levels were determined by qRT-PCR. Each bar represents the mean PPARγ mRNA levels relative to 18S ± SEM from 2 experiments expressed as % control. *P < 0.05 vs. control. +P < 0.05 vs. H2O2.

DISCUSSION

Oxidative stress plays an important role in the pathophysiology of a variety of diseases [36–38]. Mounting evidence demonstrates that PPARγ regulates oxidative stress and inflammation [7, 8]. However, the ability of oxidative stress to regulate PPARγ is less well defined. Several reports suggested that oxidative stress reduced PPARγ expression. For example, PPARγ protein levels were reduced by treatment with 500 μM H2O2 in rat adipocytes [5]. TNF-α, which augments oxidative stress in non-insulin-dependent diabetes mellitus, suppressed PPARγ expression in rat adipocytes [39]. Chronic glucose feeding in rats also stimulated vascular oxidative stress and decreased aortic and cardiac PPARγ protein levels [4]. Taken together, these reports provide indirect evidence that oxidative stress may reduce PPARγ in the vascular wall.

To further examine the impact of oxidative stress on PPARγ, the current study examined the direct effects of non-cytotoxic H2O2 concentrations on endothelial cell PPARγ expression and activity. Additionally, PPARγ expression and activity were examined in BAECs after manipulating the extracellular thiol/disulfide Eh of the Cys/CySS couple, which has been suggested to release intracellular H2O2 [26, 40]. Our results show that prolonged H2O2 exposure reduced HUVEC PPARγ mRNA levels but failed to alter HUVEC PPARγ activity, whereas acute H2O2 treatment reduced PPARγ mRNA levels, activity, and the expression of two PPARγ-regulated genes, PAI-1 and PTEN [3, 18, 32]. Alterations in PPARγ expression were mediated by H2O2 as they were inhibited by catalase and not reproduced by oxidized media components. Although the effects of H2O2 occurred in the absence of H2O2-induced endothelial cell cytotoxicity, the relevance of these H2O2 concentrations to those generated in the vascular wall in vivo during physiological or pathological conditions is more difficult to ascertain. H2O2 concentrations in the micromolar range have been reported in vivo in pathological conditions [41, 42]. Furthermore, cultured endothelial cells rapidly metabolize exogenously added H2O2 in vitro indicating that the average concentration of H2O2 to which endothelial cells were subjected in the current study was significantly lower than that initially added to the culture media.

The current results provide direct evidence that H2O2 modulates PPARγ expression in endothelial cells and further clarify the mechanisms by which oxidative stress reduced PPARγ expression. These findings extend previous reports by coupling the simultaneous examination of PPARγ mRNA levels with assays of PPARγ protein, activity, and PPARγ-regulated gene expression. Our results demonstrate that H2O2-induced oxidative stress reduced PPARγ mRNA levels and activity as well as the expression of PAI-1 and PTEN, two PPARγ-regulated genes in endothelial cells. Although the mechanisms accounting for sustained PPARγ protein levels despite reduced PPARγ mRNA expression remain speculative, our results demonstrate that H2O2 reduced not only PPARγ mRNA levels, but also PPARγ activity and the the expression of PPARγ-regulated genes. These results emphasize that future investigations should employ caution in drawing conclusions about the function of PPARγ based on analysis of PPARγ protein levels alone.

The mechanisms by which oxidative stress reduced PPARγ mRNA are likely complex, as oxidative stress modulates the activities of numerous signaling pathways and transcription factors [43–45]. For example, H2O2 activates AP1 [46, 47], a redox-regulated transcription factor previously reported to reduce PPARγ expression [34]. The PPARγ promoter contains multiple AP1 sites upstream of the transcriptional start site [34]. Our results demonstrate increased c-Fos expression and c-Jun phosphorylation following the onset of H2O2 exposure. In addition, we found no evidence that H2O2 altered PPARγ mRNA half-life. These findings are consistent with the postulate that H2O2 activates AP1 to suppress transcriptional activity of the PPARγ promoter thereby lowering PPARγ mRNA levels. This postulate was further supported by evidence that curcumin, an inhibitor of AP1, prevented H2O2-induced reductions in PPARγ mRNA levels. Similar transient reductions in PPARγ activity with more sustained reductions in PPARγ mRNA levels were observed after exposing endothelial cells to an oxidative extracellular Cys/CySS redox state (0 mV). These conditions have been previously reported to stimulate H2O2 production, activate nuclear factor-κB, and increase monocyte adhesion to endothelial cells [26]. Taken together, the current results suggest that oxidative stress activates redox-regulated transcription factors in endothelial cells that transcriptionally suppress PPARγ.

The current study provides novel evidence supporting a role of oxidative signaling in the regulation of PPARγ expression and function in vascular endothelial cells. It is likely that the cumulative effects of oxidative stress on PPARγ signaling in vascular endothelial cells are regulated not only by PPARγ expression but also by oxidative alterations in the generation of endogenous PPARγ ligands. The nature and potency of these endogenous ligands in a cell or tissue may be influenced by the type and duration of the oxidative stimulus as well as by the endogenous antioxidant capacity of the cell or tissue. Furthermore, the recognition that nitrated lipids serve as potent PPARγ ligands [48] suggests that alterations in endothelial NO generation may also modulate the spectrum and activity of endogenous PPARγ ligands. These mechanisms may provide new insights into the growing body of evidence that PPARγ stimulation promotes vascular protection [21]. Oxidative stress in the vascular wall that promotes reduced NO bioavailability and proinflammatory derangements might be attenuated by activation of PPARγ which can simultaneously stimulate endothelial NO production and reduce oxidative stress [16, 19, 20]. The current study provides new evidence that oxidative signals directly regulate the transcription of PPARγ. These in vitro findings can inform future investigations that explore the role of PPARγ in vascular biology in vivo that will be required to better define the role of PPARγ in vascular inflammation, nitroso-redox balance, and vascular function.

Acknowledgments

The authors would like to recognize the excellent technical support provided by Mr. Tobi Yerokum and Dr. Daniel Grove. This work was supported by funding from the Research Service of the Veterans Affairs Medical Center (CMH) and from NIH grant DK 074518.

LIST of ABBREVIATIONS

AK

adenylate kinase

AP1

activator protein 1

BAECs

bovine aortic endothelial cell(s)

Cys

cysteine

CySS

cystine

EGM

endothelial growth medium

Eh

redox potential

eNOS

endothelial nitric oxide synthase

FBS

fetal bovine serum

GLUT4

glucose transporter type 4

H2O2

hydrogen peroxide

HBSS

Hank’s Balanced Salt Solution

HUVECs

human umbilical vein endothelial cell(s)

IL-1α

interlukin-1 alpha

NADPH

nicotinamide adenine dinucleotide phosphate

NO

nitric oxide

oxFA

oxidized fatty acid

PAI-1

plasminogen activator inhibitor type-1

PPARγ

peroxisome proliferator-activated receptor gamma

PTEN

phosphatase and tensin homolog

qRT-PCR

quantitative real time polymerase chain reaction

ROS

reactive oxygen species

SDS

sodium dodecyl sulfate

TNF-α

tumor necrosis factor-alpha

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Gervois P, Fruchart JC, Staels B. Drug Insight: mechanisms of action and therapeutic applications for agonists of peroxisome proliferator-activated receptors. Nat Clin Pract Endocrinol Metab. 2007;3:145–156. doi: 10.1038/ncpendmet0397. [DOI] [PubMed] [Google Scholar]
  • 2.Marx N, Schonbeck U, Lazar MA, Libby P, Plutzky J. Peroxisome proliferator-activated receptor gamma activators inhibit gene expression and migration in human vascular smooth muscle cells. Circ Res. 1998;83:1097–1103. doi: 10.1161/01.res.83.11.1097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Marx N, Bourcier T, Sukhova GK, Libby P, Plutzky J. PPARgamma activation in human endothelial cells increases plasminogen activator inhibitor type-1 expression: PPARgamma as a potential mediator in vascular disease. Arterioscler Thromb Vasc Biol. 1999;19 :546–551. doi: 10.1161/01.atv.19.3.546. [DOI] [PubMed] [Google Scholar]
  • 4.El Midaoui A, Wu L, Wang R, de Champlain J. Modulation of cardiac and aortic peroxisome proliferator-activated receptor-gamma expression by oxidative stress in chronically glucose-fed rats. Am J Hypertens. 2006;19:407–412. doi: 10.1016/j.amjhyper.2005.11.006. [DOI] [PubMed] [Google Scholar]
  • 5.Tanaka T, Itoh H, Doi K, Fukunaga Y, Hosoda K, Shintani M, Yamashita J, Chun TH, Inoue M, Masatsugu K, Sawada N, Saito T, Inoue G, Nishimura H, Yoshimasa Y, Nakao K. Down regulation of peroxisome proliferator-activated receptor gamma expression by inflammatory cytokines and its reversal by thiazolidinediones. Diabetologia. 1999;42:702–710. doi: 10.1007/s001250051218. [DOI] [PubMed] [Google Scholar]
  • 6.San Martin A, Du P, Dikalova A, Lassegue B, Aleman M, Gongora MC, Brown K, Joseph G, Harrison DG, Taylor WR, Jo H, Griendling KK. Reactive oxygen species-selective regulation of aortic inflammatory gene expression in type 2 diabetes. Am J Physiol Heart Circ Physiol. 2007;292:H2073–H2082. doi: 10.1152/ajpheart.00943.2006. [DOI] [PubMed] [Google Scholar]
  • 7.Allan IM, Vaughan AT, Milner AE, Lunec J, Bacon PA. Structural damage to lymphocyte nuclei by H2O2 or gamma irradiation is dependent on the mechanism of OH. Radical production. Br J Cancer. 1988;58:34–37. doi: 10.1038/bjc.1988.156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Eny KM, El-Sohemy A, Cornelis MC, Sung YK, Bae SC. Catalase and PPARgamma2 genotype and risk of systemic lupus erythematosus in Koreans. Lupus. 2005;14:351–355. doi: 10.1191/0961203305lu2091oa. [DOI] [PubMed] [Google Scholar]
  • 9.Coyle CH, Kader KN. Mechanisms of H2O2-induced oxidative stress in endothelial cells exposed to physiologic shear stress. ASAIO J. 2007;53:17–22. doi: 10.1097/01.mat.0000247157.84350.e8. [DOI] [PubMed] [Google Scholar]
  • 10.Wolf G. Free radical production and angiotensin. Curr Hypertens Rep. 2000;2:167–173. doi: 10.1007/s11906-000-0078-z. [DOI] [PubMed] [Google Scholar]
  • 11.Bull AW, Steffensen KR, Leers J, Rafter JJ. Activation of PPAR gamma in colon tumor cell lines by oxidized metabolites of linoleic acid, endogenous ligands for PPAR gamma. Carcinogenesis. 2003;24:1717–1722. doi: 10.1093/carcin/bgg131. [DOI] [PubMed] [Google Scholar]
  • 12.Almeida M, Ambrogini E, Han L, Manolagas SC, Jilka RL. Increased lipid oxidation causes oxidative stress, increased peroxisome proliferator-activated receptor-gamma expression, and diminished pro-osteogenic Wnt signaling in the skeleton. J Biol Chem. 2009;284:27438–27448. doi: 10.1074/jbc.M109.023572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ricote M, Huang J, Fajas L, Li A, Welch J, Najib J, Witztum JL, Auwerx J, Palinski W, Glass CK. Expression of the peroxisome proliferator-activated receptor gamma (PPARgamma) in human atherosclerosis and regulation in macrophages by colony stimulating factors and oxidized low density lipoprotein. Proc Natl Acad Sci USA. 1998;95 :7614–7619. doi: 10.1073/pnas.95.13.7614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sommer M, Wolf G. Rosiglitazone increases PPARgamma in renal tubular epithelial cells and protects against damage by hydrogen peroxide. Am J Nephrol. 2007;27:425–434. doi: 10.1159/000105125. [DOI] [PubMed] [Google Scholar]
  • 15.Ren Y, Sun C, Sun Y, Tan H, Wu Y, Cui B, Wu Z. PPAR gamma protects cardiomyocytes against oxidative stress and apoptosis via Bcl-2 upregulation. Vascul Pharmacol. 2009;51:169–174. doi: 10.1016/j.vph.2009.06.004. [DOI] [PubMed] [Google Scholar]
  • 16.Hwang J, Kleinhenz DJ, Lassegue B, Griendling KK, Dikalov S, Hart CM. Peroxisome proliferator-activated receptor-gamma ligands regulate endothelial membrane superoxide production. Am J Physiol Cell Physiol. 2005;288:C899–905. doi: 10.1152/ajpcell.00474.2004. [DOI] [PubMed] [Google Scholar]
  • 17.Hwang J, Kleinhenz DJ, Rupnow HL, Campbell AG, Thule PM, Sutliff RL, Hart CM. The PPAR gamma ligand, rosiglitazone, reduces vascular oxidative stress and NADPH oxidase expression in diabetic mice. Vascul Pharmacol. 2007;46:456–462. doi: 10.1016/j.vph.2007.01.007. [DOI] [PubMed] [Google Scholar]
  • 18.Nisbet RE, Bland JM, Kleinhenz DJ, Mitchell PO, Walp ER, Sutliff RL, Hart CM. Rosiglitazone attenuates chronic hypoxia-induced pulmonary hypertension in a mouse model. Am J Respir Cell Mol Biol. 2010;42:1–9. doi: 10.1165/rcmb.2008-0132OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Calnek DS, Mazzella L, Roser S, Roman J, Hart CM. Peroxisome proliferator activated receptor gamma ligands increase release of nitric oxide from endothelial cells. Arterioscler Thromb Vasc Biol. 2003;23:52–57. doi: 10.1161/01.atv.0000044461.01844.c9. [DOI] [PubMed] [Google Scholar]
  • 20.Polikandriotis JA, Mazzella LJ, Rupnow HL, Hart CM. Peroxisome proliferator-activated receptor gamma ligands stimulate endothelial nitric oxide production through distinct peroxisome proliferator-activated receptor gamma-dependent mechanisms. Arterioscler Thromb Vasc Biol. 2005;25:1810–1816. doi: 10.1161/01.ATV.0000177805.65864.d4. [DOI] [PubMed] [Google Scholar]
  • 21.Duan SZ, Usher MG, Mortensen RM. Peroxisome proliferator-activated receptor gamma-mediated effects in the vasculature. Circ Res. 2008;102:283–294. doi: 10.1161/CIRCRESAHA.107.164384. [DOI] [PubMed] [Google Scholar]
  • 22.Jiang B, Liang P, Zhang B, Song J, Huang X, Xiao X. Role of PPAR-beta in hydrogen peroxide-induced apoptosis in human umbilical vein endothelial cells. Atherosclerosis. 2009;204:353–358. doi: 10.1016/j.atherosclerosis.2008.09.009. [DOI] [PubMed] [Google Scholar]
  • 23.Martens FM, Visseren FL, Lemay J, de Koning EJ, Rabelink TJ. Metabolic and additional vascular effects of thiazolidinediones. Drugs. 2002;62:1463–1480. doi: 10.2165/00003495-200262100-00004. [DOI] [PubMed] [Google Scholar]
  • 24.Jonas CR, Ziegler TR, Gu LH, Jones DP. Extracellular thiol/disulfide redox state affects proliferation rate in a human colon carcinoma (Caco2) cell line. Free Radic Biol Med. 2002;33:1499–1506. doi: 10.1016/s0891-5849(02)01081-x. [DOI] [PubMed] [Google Scholar]
  • 25.Jones DP, Go YM, Anderson CL, Ziegler TR, Kinkade JM, Jr, Kirlin WG. Cysteine/cystine couple is a newly recognized node in the circuitry for biologic redox signaling and control. FASEB J. 2004;18:1246–1248. doi: 10.1096/fj.03-0971fje. [DOI] [PubMed] [Google Scholar]
  • 26.Go YM, Jones DP. Intracellular proatherogenic events and cell adhesion modulated by extracellular thiol/disulfide redox state. Circulation. 2005;111:2973–2980. doi: 10.1161/CIRCULATIONAHA.104.515155. [DOI] [PubMed] [Google Scholar]
  • 27.Hwang C, Sinskey AJ, Lodish HF. Oxidized redox state of glutathione in the endoplasmic reticulum. Science. 1992;257:1496–1502. doi: 10.1126/science.1523409. [DOI] [PubMed] [Google Scholar]
  • 28.Bruedigam C, Koedam M, Chiba H, Eijken M, van Leeuwen JP. Evidence for multiple peroxisome proliferator-activated receptor gamma transcripts in bone: Fine-tuning by hormonal regulation and mRNA stability. FEBS Lett. 2008;582:1618–1624. doi: 10.1016/j.febslet.2008.04.012. [DOI] [PubMed] [Google Scholar]
  • 29.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 30.Fajas L, Auboeuf D, Raspé E, Schoonjans K, Lefebvre AM, Saladin R, Najib J, Laville M, Fruchart JC, Deeb S, Vidal-Puig A, Flier J, Briggs MR, Staels B, Vidal H, Auwerx J. The organization, promoter analysis, and expression of the human PPARgamma gene. J Biol Chem. 1997;272:18779–18789. doi: 10.1074/jbc.272.30.18779. [DOI] [PubMed] [Google Scholar]
  • 31.Nabors LB, Suswam E, Huang Y, Yang X, Johnson MJ, King PH. Tumor necrosis factor alpha induces angiogenic factor up-regulation in malignant glioma cells: A role for RNA stabilization and HuR. Cancer Res. 2003;63:4181–4187. [PubMed] [Google Scholar]
  • 32.Nilsson L, Takemura T, Eriksson P, Hamsten A. Effects of fibrate compounds on expression of plasminogen activator inhibitor-1 by cultured endothelial cells. Arterioscler Thromb Vasc Biol. 1999;19:1577–1581. doi: 10.1161/01.atv.19.6.1577. [DOI] [PubMed] [Google Scholar]
  • 33.Kinscherf R, Cafaltzis K, Roder F, Hildebrandt W, Edler L, Deigner HP, Breitkreutz R, Feussner G, Kreuzer J, Werle E, Michel G, Metz J, Droge W. Cholesterol levels linked to abnormal plasma thiol concentrations and thiol/disulfide redox status in hyperlipidemic subjects. Free Radic Biol Med. 2003;35:1286–1292. doi: 10.1016/j.freeradbiomed.2003.07.001. [DOI] [PubMed] [Google Scholar]
  • 34.Fu M, Zhang J, Lin Y, Zhu X, Zhao L, Ahmad M, Ehrengruber MU, Chen YE. Early stimulation and late inhibition of peroxisome proliferator-activated receptor gamma (PPAR gamma) gene expression by transforming growth factor beta in human aortic smooth muscle cells: role of early growth-response factor-1 (Egr-1), activator protein 1 (AP1) and Smads. Biochem J. 2003;370:1019–1025. doi: 10.1042/BJ20021503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Coronella-Wood J, Terrand J, Sun H, Chen QM. c-Fos phosphorylation induced by H2O2 prevents proteasomal degradation of c-Fos in cardiomyocytes. J Biol Chem. 2004;279:33567–33574. doi: 10.1074/jbc.M404013200. [DOI] [PubMed] [Google Scholar]
  • 36.Papaharalambus CA, Griendling KK. Basic mechanisms of oxidative stress and reactive oxygen species in cardiovascular injury. Trends Cardiovasc Med. 2007;17:48–54. doi: 10.1016/j.tcm.2006.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Kinnula VL, Vuorinen K, Ilumets H, Rytila P, Myllarniemi M. Thiol proteins, redox modulation and parenchymal lung disease. Curr Med Chem. 2007;14:213–222. doi: 10.2174/092986707779313345. [DOI] [PubMed] [Google Scholar]
  • 38.Zhu X, Su B, Wang X, Smith MA, Perry G. Causes of oxidative stress in Alzheimer disease. Cell Mol Life Sci. 2007;64:2202–2210. doi: 10.1007/s00018-007-7218-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Itoh H, Doi K, Tanaka T, Fukunaga Y, Hosoda K, Inoue G, Nishimura H, Yoshimasa Y, Yamori Y, Nakao K. Hypertension and insulin resistance: role of peroxisome proliferator-activated receptor gamma. Clin Exp Pharmacol Physiol. 1999;26:558–560. doi: 10.1046/j.1440-1681.1999.03082.x. [DOI] [PubMed] [Google Scholar]
  • 40.Go YM, Gipp JJ, Mulcahy RT, Jones DP. H2O2-dependent activation of GCLC- ARE4 reporter occurs by mitogen-activated protein kinase pathways without oxidation of cellular glutathione or thioredoxin-1. J Biol Chem. 2004;279:5837–5845. doi: 10.1074/jbc.M307547200. [DOI] [PubMed] [Google Scholar]
  • 41.Yusa T, Beckman JS, Crapo JD, Freeman BA. Hyperoxia increases H2O2 production by brain in vivo. J Appl Physiol. 1987;63:353–358. doi: 10.1152/jappl.1987.63.1.353. [DOI] [PubMed] [Google Scholar]
  • 42.Kietzmann D, Kahl R, Muller M, Burchardi H, Kettler D. Hydrogen peroxide in expired breath condensate of patients with acute respiratory failure and with ARDS. Intensive Care Med. 1993;19:78–81. doi: 10.1007/BF01708366. [DOI] [PubMed] [Google Scholar]
  • 43.Chou WC, Chen HY, Yu SL, Cheng L, Yang PC, Dang CV. Arsenic suppresses gene expression in promyelocytic leukemia cells partly through Sp1 oxidation. Blood. 2005;106:304–310. doi: 10.1182/blood-2005-01-0241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kamata H, Hirata H. Redox regulation of cellular signalling. Cell Signal. 1999;11:1–14. doi: 10.1016/s0898-6568(98)00037-0. [DOI] [PubMed] [Google Scholar]
  • 45.Wang Z, Castresana MR, Newman WH. Reactive oxygen and NF-kappaB in VEGF-induced migration of human vascular smooth muscle cells. Biochem Biophys Res Commun. 2001;285:669–674. doi: 10.1006/bbrc.2001.5232. [DOI] [PubMed] [Google Scholar]
  • 46.Roebuck KA, Carpenter LR, Lakshminarayanan V, Page SM, Moy JN, Thomas LL. Stimulus-specific regulation of chemokine expression involves differential activation of the redox-responsive transcription factors AP-1 and NF-kappaB. J Leukoc Biol. 1999;65:291–298. doi: 10.1002/jlb.65.3.291. [DOI] [PubMed] [Google Scholar]
  • 47.Jaramillo M, Olivier M. Hydrogen peroxide induces murine macrophage chemokine gene transcription via extracellular signal-regulated kinase- and cyclic adenosine 5′-monophosphate (cAMP)-dependent pathways: involvement of NF-kappa B, activator protein 1, and cAMP response element binding protein. J Immunol. 2002;169:7026–7038. doi: 10.4049/jimmunol.169.12.7026. [DOI] [PubMed] [Google Scholar]
  • 48.Schopfer FJ, Lin Y, Baker PR, Cui T, Garcia-Barrio M, Zhang J, Chen K, Chen YE, Freeman BA. Nitrolinoleic acid: an endogenous peroxisome proliferator-activated receptor gamma ligand. Proc Natl Acad Sci USA. 2005;102:2340–2345. doi: 10.1073/pnas.0408384102. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES