Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Jul 1.
Published in final edited form as: Int J Parasitol. 2010 Mar 12;40(8):979–988. doi: 10.1016/j.ijpara.2010.02.010

A putative kinase related protein (PKRP) from Plasmodium berghei mediates infection in the midgut and salivary glands of the mosquito

Lisa A Purcell a,b, Ricardo Leitao b, Takeshi Ono b,c, Stephanie K Yanow d, Gabriele Pradel e, Terry W Spithill a,f, Ana Rodriguez b,*
PMCID: PMC2875340  NIHMSID: NIHMS189210  PMID: 20227415

Abstract

The completion of the Plasmodium (malaria) life cycle in the mosquito requires the parasite to traverse first the midgut and later the salivary gland epithelium. We have identified a putative kinase related protein (PKRP) that is predicted to be an atypical protein kinase, which is conserved across many species of Plasmodium. The pkrp gene encodes a RNA of about 5,300 nucleotides that is expressed as a 90 kDa protein in sporozoites. Targeted disruption of the pkrp gene in Plasmodium berghei, a rodent model of malaria, compromises the ability of parasites to infect different tissues within the mosquito host. Early infection of mosquito midgut is reduced by 58-71%, midgut oocyst production is reduced by 50-90% and those sporozoites that are produced are defective in their ability to invade mosquito salivary glands. Midgut sporozoites are not morphologically different from wild type parasites by electron microscopy. Some sporozoites that emerged from oocysts were attached to the salivary glands but most were found circulating in the mosquito hemocoel. Our findings indicate that a signaling pathway involving PbPKRP regulates the level of Plasmodium infection in the mosquito midgut and salivary glands.

Keywords: Malaria, Plasmodium berghei, Transmission, Ookinete, Oocyst, Sporozoites, Invasion, Epithelium, Midgut, Salivary gland, PKRP, Kinase

1. Introduction

The transmission of malaria parasites from the bites of Anopheles mosquitoes is responsible for the millions of clinical cases and deaths from malaria each year (Mayor, 2008). The complex life cycle of the parasite requires an intricate network of signaling events to enable the parasite to invade multiple cell types in both the invertebrate and mammalian hosts (Ward et al., 2004; Doerig et al., 2005). Two invasive life cycle stages that occur exclusively in the mosquito, the ookinete and the sporozoite, require invasion into the mosquito midgut and salivary gland epithelium, respectively. Ookinetes cross the midgut epithelium within 24 h of a blood meal and produce oocysts. Sporozoites are released from the oocysts into the hemocoel about 18 days later and invade the salivary glands by passing through the epithelium, completing the development of the parasite in the mosquito.

The mechanism used by the parasite to invade mosquito epithelial tissues is unknown but is thought to involve a signaling pathway. The parasite needs to transverse two epithelia in the mosquito, first the midgut and later the salivary gland, to complete the infection cycle. A peptide (SM1) that binds specifically to these two epithlia and inhibits the attachment of the parasite has been identified (Ghosh et al., 2001). Transgenic mosquitoes that over-expressed this peptide in the midgut epithelium were less susceptible to Plasmodium berghei infection, and contained fewer sporozoites in the salivary glands (Ito et al., 2002). These interactions between parasite proteins and receptors on the mosquito epithelium may initiate a downstream signaling cascade to facilitate parasite invasion.

Protein kinases, such as calmodulin-dependent protein kinases (CaMKs), are involved in many cellular processes, including invasion of cells (Bonhomme et al., 1999; Griffith, 2004). In Plasmodium, the CaMK family includes calcium-dependent protein kinases (CDPKs), as well as a distinct group that does not contain EF-hand motifs (important for calcium-binding) (Ward et al., 2004). One calcium-dependent protein kinase, CDPK3, is required for ookinete motility in P. berghei, which in turn is required for efficient mosquito midgut invasion (Ishino et al., 2006; Siden-Kiamos et al., 2006). CDPK4 is essential for the sexual reproduction and mosquito transmission of P. berghei, as it is involved in the regulation of cell cycle progression in the male gametocyte (Billker et al., 2004). Another member of this family, CDPK6, is involved in signaling, mediating the activation of sporozoites for invasion (Coppi et al., 2007). Other parasites, including Toxoplasma gondii and Cryptosporidium parvum, also utilize CDPK-like proteins in invasive stages (Bonhomme et al., 1999; Nagamune and Sibley, 2006). This suggests that the CaMK family may play an important role in cell invasion in many parasite species.

Here, using a P. berghei knock-out mutant of a putative kinase-related protein (PKRP), we show that PKRP is involved in mediating infection in the midgut and salivary glands of the mosquito. Ookinetes deficient in this protein do not efficiently infect the midgut epithelium, resulting in a reduction in the number of midgut sporozoites. Most sporozoites that are released from oocysts fail to invade salivary gland epithelium and are predominantly found circulating in mosquito hemocoel. We suggest that the P. berghei PKRP (PbPKRP) may be involved in a signaling pathway that mediates the parasite’s ability to invade mosquito tissues.

2. Materials and methods

2.1. Multiple sequence alignment

The orthologs of the various Plasmodium pkrp genes were predicted using OrthoMCL (Li et al., 2003). Multiple sequence alignments of the first 500 amino acids of Plasmodium falciparum PKRP (PfPKRP), PbPKRP, Plasmodium chabaudi PKRP (PcPKRP) and Plasmodium yoelii PKRP (PyPKRP) were performed using Clustal W (Thompson et al., 1994) on the San Diego Supercomputer Center Biology Workbench server (http://workbench.sdsc.edu) and a consensus sequence was determined. To construct the predicted catalytic domain alignment of PfPKRP and PbPKRP, an amino acid BLAST search of both domains was conducted to first retrieve those kinases that showed homology. The human testis-specific serine/threonine kinase (hTSSK) was selected as the most similar protein using OrthoMCL and a multiple sequence alignment was constructed using Clustal W.

2.2. Parasite maintenance and transmission to mosquitoes

All procedures for animal experiments were approved by the New York University School of Medicine Institutional Care and Use Committee. Plasmodium berghei ANKA wild-type (wt; clone C1) and transgenic lines were maintained in Swiss-Webster mice (approximately 4 weeks old; National Institutes of Health). Anopheles stephensi mosquitoes were maintained at 70% humidity and 22°C and infected with parasites essentially as previously described (Vanderberg, 1980). Groups of five to eight mice were infected with wt or transgenic lines by i.v. infection and monitored for parasitemia and gametocytemia. Three to five mice from each group with matched parasitemia (differences smaller than 1% between all animals) and gametocytemia (differences smaller than 0.01% between all animals) were chosen to feed mosquitoes. The ranges of parasitemia and gametocytemia between the different experiments were 2-5% and 0.02- 0.05%, respectively.

Infected midguts and/or salivary glands were dissected on ice (Purcell et al., 2008). Hemocoel was dissected using volume displacement (perfusion) essentially as previously described (Hillyer et al., 2007). Whole, dissected salivary glands were treated with trypsin to remove any sporozoites that did not invade the salivary gland as previously described (Sultan et al., 1997). The number of sporozoites for a given experiment was determined using an appropriate dilution of sporozoites in DMEM and counting on a hemocytometer. Ookinete-infected midguts were dissected by removing the midguts from mosquitoes fed 24 h earlier on infected blood. The blood meal was removed and the midgut was washed extensively with PBS.

2.3. Deletion of the pkrp gene and genotype analysis

A targeting vector for Pbpkrp was constructed in plasmid pL0001 (plasmid b3; b3D.DTˆH.ˆD), in which polylinker sites flank a T. gondii dhfr/ts expression cassette transferring resistance to pyrimethamine. A 457 bp fragment of the 5’ untranslated region (UTR) sequence was PCR amplified from P. berghei genomic (g)DNA using the primers G1FKp (5’-agaaggtaacccacatcataataatagcaaactgcac – 3’; restriction site underlined) and G1RH3 (ttagaagcttttccagacgggttaatatcaaaa – 3’). The fragment was inserted into the KpnI and HindIII restriction sites upstream of the dhfr/ts cassette of pL0001. A 800 bp fragment of the 3’ UTR sequence was PCR amplified from the same gDNA using the primers G2FBam (ttatggatcctgaaaatagataaaaattcaatcatgg – 3’; restriction site underlined) and G2RXb (aaaatctagatttttcacct – 3’). The fragment was inserted into the BamHI and XbaI restriction sites downstream of the dhfr/ts cassette of the vector. The replacement construct was excised as a KpnI/SacII fragment and used for the electroporation of cultured P. berghei ANKA wt (clone C1) schizonts essentially as previously described (Janse et al., 2006). Plasmodium berghei ANKA was previously cloned to generate a homogenous wt parasite population. This cloned wt was used to perform two independent transfections where Pbpkrp- clone 1 was generated independently of clone 2. Two independent rounds of limiting dilution cloning of drug-resistant parasites were completed, and genotyping of Clone 1 (L10) and Clone 2 (O1) was carried out. Diagnostic PCR was used to amplify a 250 bp fragment of the pkrp gene using the primers ORF F (5’ – ccttttgctatgcatggtgat – 3’) and ORF R (5’ – cattaaaatggagggcttgc – 3’). To confirm 5’ integration, a 837 bp fragment of the 5’ region was amplified using two primers: the forward primer (Pb837; 5’- caacaaaccaattgcatggac – 3’) amplified a region upstream of the flanking sequence used to integrate the plasmid along with a reverse primer (Pb103; 5’ – taattatatgttattttatttccac – 3’) located 3’ of the flanking sequence, but 5’ to the dhfr/ts sequence. To confirm 3’ integration, a 1,549 bp fragment of the 3’ region was amplified using two primers: the forward primer (Pb106a; 5’ – tgatgcacatgcatgtaaatagc – 3’) amplified a region located 3’ of the dhfr/ts sequence along with a reverse primer (Pb1549; 5’ – cattgtatgccgtttggttc – 3’) that amplified the region downstream of the flanking sequence used to integrate the plasmid. A negative control of P. berghei gDNA alone was also analysed with each PCR reaction. Southern blot analysis was carried out as per the manufacturer’s instructions (Roche). A labeled probe was PCR-amplified using the ORF F/ORF R primer set described above. Northern blot analysis on a standard formaldehyde gel was completed using the DIG kit (Roche) by analyzing 5 μg of total RNA extracted from sporozoites of wt or the transfected clones. A sample of the same labeled probe from the Southern blot was used to label the northern blot.

2.4. Antibody production and western blot analysis

A synthetic peptide (N - LFENEKNGLIYPVLNDPGQAIYF - C; Biosynthesis Inc., Lewisville, TX, USA) derived from the predicted catalytic region of PbPKRP (residues 301 to 324) was used for immunization of rabbits (Cocalico Biologicals Inc., Reamstown, PA, USA; see Fig. 1A). For western blotting, 7.5 × 104 sporozoites were dissected from each clone and separated on 8% SDS-PAGE gel and on 4-20% Novex Tris-Glycine gradient gels (Invitrogen). Rabbit antisera (from naïve and immunized rabbits) were used at a 1:300 dilution for western blotting using the ECL western blotting kit (Amersham).

Fig. 1.

Fig. 1

Open in a new tab

Alignments of calmodulin-dependent protein kinase (CaMK) and putative kinase related protein (PKRP) sequences. (A) The first 500 amino acids of the CaMK-related proteins found in four Plasmodium spp. are aligned. Amino acids found in two of the four aligned sequences are shaded to show identity. The vertical bars at residues 161 and 441 indicate the N- and C-terminal boundaries of the catalytic domain, respectively. The sequence of the peptide used for immunization is indicated by the horizontal bar. Residues that are largely conserved in Ser/Thr protein kinases are indicated above the Plasmodium falciparum (Pf)PKRP sequence. The residues indicated at the top are: a glycine (G), which constitutes part of the glycine triad, the lysine (K), which anchors and orients ATP, a glutamate (E) that forms a salt bridge, the eukaryotic protein kinase signature motif (RDxxxxN), the Mg2+-binding motif (DxG), the glutamate (E) and aspartate that provide structural stability, and a conserved arginine (R). (B) The catalytic domains of PfPKRP and Plasmodium berghei (Pb)PKRP were aligned with human TSSK1 as an example of a related CaMK protein kinase. Pc, Plasmodium chabaudi ; Py, Plasmodium yoelii ; h, human.

2.5. Extraction of gDNA from mosquito midguts and salivary glands

Midguts (ookinete or oocyst stage) and salivary glands (n = 10) from each clone were dissected from mosquitoes as described above and placed in 500 μl oocyst lysis buffer (100 mM NaCl, 25 mM EDTA (pH 8.0), 10 mM Tris-HCl (pH 8.8), 0.5% Sarkosyl and 1 mg/ml proteinase K). The mixture was incubated overnight in a 56°C water bath. Genomic DNA was then isolated using a phenol/chloroform extraction and ethanol precipitation. The pellet was dissolved in 100 μl of 10 mM Tris, 1mM ethylenediaminetetraacetic acid buffer.

2.6. Quantitative PCR

Genomic DNA isolated from each clone was diluted equally to the indicated concentrations before running the assay. Quantitative PCR reactions were performed in triplicate as previously described (Yanow et al., 2006). For midgut amplifications, DNA was diluted 1:4 and for salivary gland reactions, the DNA was diluted 1:14. For each 25 μl reaction, 5 μl of the diluted gDNA were added. The following oligonucleotides were used: P. berghei 18S rRNA gene: 5’-ggcaacaacaggtctgtg-3’ and 5’-gtacaaagggcagggacg-3’; P. berghei ama-1 gene: 5’ – accggtgatcagtcagtgagaagt-3’ and 5’- gctacaatatcttggaccc-3’; Pbpkrp: 5’ – ccttttgctatgcatggtgat – 3’ and 5’ – cattaaaatggagggcttgc – 3’. The percentage of amplification efficiency (AE) was calculated using the formula % AE = 2ΔCt * 100, where Ct is the cycle threshold, as previously described (Sikorsky et al., 2004; Yanow et al., 2008), except the % AE was calculated using the wt as unmodified and pkrp- clone as modified templates.

2.7. Electron microscopy

Infected mosquito midguts were dissected at day 10 p.f. and fixed in 1% glutaraldehyde and 4% paraformaldehyde in PBS for 5 days. Specimens were post-fixed in 1% osmium tetroxide and 1.5% K3Fe(CN)6 in PBS for 2 h at room temperature (RT), followed by incubation in 0.5% uranyl acetate for 1 h. Midguts were dehydrated in increasing concentrations of ethanol and then incubated for 1 h in propylene oxide, followed by another incubation for 1 h in a 1:1 mixture of propylene oxide and Epon (Electron Microscopy Sciences, Hatfield, PA, USA). Specimens were subsequently embedded in Epon at 60°C for 2 days. Post-staining of sections was done with 1% uranyl acetate for 30 min. Photographs were taken with a Zeiss EM10 transmission electron microscope and scanned images were processed using Adobe Photoshop CS software.

2.8. Statistical analyses

All statistical analyses were completed using Prism (v. 4.0a). Where the Area Under the Curve (AUC) was calculated, the average AUC was calculated for each cycle, using software default parameters, and then the average of all AUCs was calculated. Where differences in AUC and quantitative PCR were assessed, normality was tested using the Kolmogorov-Smirnov Goodness-of-Fit Test. Data with a P value > 0.10 were considered normal. The differences were then tested using an ANOVA with a Tukey’s Multiple Comparison post-hoc test, except for the assessment of oocysts in Fig. 4B, where a two-way ANOVA was used with a Bonferroni post-hoc test. Assays showing significant differences (P<0.05) were noted.

Fig. 4.

Fig. 4

Open in a new tab

Evaluation of midgut invasion and oocyst formation by ookinetes lacking the gene for putative kinase related protein (pkrp-). Anopheles stephensi mosquitoes were fed directly on groups of five (A) or three (B) mice infected with wild-type (wt) or pkrp- (both clones 1 and 2) parasites with matched parasitemias and gametocytemias on day 0. (A) At 24 h after feeding, midguts were dissected from 10 mosquitoes from each group. The blood meal was removed and the midgut was washed extensively. Genomic DNA was extracted from the pooled midguts from each group. Malaria infection was determined using quantitative PCR and primers directed towards Plasmodium berghei (pb) pb18s rRNA (white bars), pbama-1 (grey bars) and Pbpkrp (black bars). The experiment was performed twice using independent parasite cycles and each sample was run in triplicate for each quantitative PCR (qPCR) cycle. The average of the results of two qPCRs with the standard error (SE) is shown. * The amplification efficiency was significantly reduced (P < 0.0001, ANOVA, n = 10) in both clones of pkrp- ookinetes compared with wt ookinetes. (B) At different days after feeding, the total number of oocysts in each midgut was counted in 20 mosquitoes from each group. The number of oocysts was significantly decreased (P < 0.0001, two-way ANOVA) in midguts fed on clone 1 and clone 2 compared with wt.

3. Results

3.1. Bioinformatic analysis of the PKRP

We bioinformatically analysed a conserved, hypothetical Plasmodium protein, and annotated it as a PKRP based on its signature motifs as described below. PfPKRP (Pfpkrp; PFC0485w) is located on chromosome 3. Expression data from this gene shows intermediate level expression in sporozoites, low-level expression throughout the asexual stages and highest levels in gametocytes (PlasmoDB, release 5.3 and Le Roch et al., 2003). The first 500 amino acids containing the N terminus and predicted kinase domain of the various Plasmodium PKRP proteins show high homology between species: PbPKRP (PB001650.02.0) is 93% identical to the counterpart in PyPKRP (PY02490), while PfPKRP is 57% and 60% identical to PbPKRP and PyPKRP, respectively (Fig. 1A). All of these Plasmodium genes contain two exons, with the predicted protein kinase region in the first exon. The predicted size of the proteins vary with PfPKRP, PbPKRP, PyPKRP and PcPKRP (Pcpkrp; PCAS_041030) comprising proteins of 2,515, 2,708, 2,699 and 2,456 amino acids, respectively. The PbPKRP sequence is not complete in the current available version of PlasmoDB, however the complete predicted sequence was provided from the working copy of the assembly of P. berghei ANKA by the Pathogen Genomics group at the Wellcome Trust Sanger Institute, Cambridgeshire UK (Supplementary Fig. S1).

Various searches were carried out to identify a human orthologue of the Plasmodium PKRP. None of the full-length PKRP sequences were clear orthologs of other Ser/Thr protein kinases, but kinases sharing sequence identity with the predicted catalytic domain of PKRP were predicted. Several residues that are largely conserved in Ser/Thr protein kinases were identified in the PKRP sequences. One of these kinases, the human testis-specific serine kinase (hTSSK; Hao et al., 2004) has been described as a CaMK-related protein kinase that is classified as atypical, as it contains only a single glycine in the glycine loop motif. TSSK1 shares limited identity with PKRP. The catalytic domains of hTSSK (261 amino acids) shares 26% identity with PfPKRP and 25% identity with PbPKRP (281 amino acids) (Fig. 1B). The catalytic domains of PfPKRP and PbPKRP share 75% identity.

3.2. Generation of parasites lacking PKRP

To characterize the function of PKRP, we performed targeted gene deletion in P. berghei (Waters et al., 1997), a parasite species that can infect mice and be transmitted to mosquitoes, which is an established model for malaria transmission. To disrupt the Pbpkrp gene, the 503 amino acids predicted to compose the full-length protein were replaced with a pyrimethamine-resistance allele of the dhfr/ts M2/M3 gene from T. gondii (Fig. 2A). Following drug selection, the targeting construct was shown to have integrated into the genome of the parasite. This was confirmed in two clones, designated clone 1 (Fig. 2B and C) and clone 2 (Fig. 2C), isolated independently from the transfected population, using PCR and Southern blot analysis.

Fig. 2.

Fig. 2

Open in a new tab

Targeted disruption of the putative kinase related protein gene in Plasmodium berghei (Pbpkrp). (A) Schematic representation of the Pbpkrp locus and the gene-targeting construct used for gene replacement by double homologous recombination, together with the resulting disrupted locus. (B) Diagnostic PCR verifying the disruption of the Pbpkrp locus. Representative PCR is shown using primers to the wild-type (wt; clone C1) open reading frame (labeled “wt” in A), a PCR of the mixed wt and transfected parasites which contain genomic DNA (gDNA) that show products from the wt and 5’ and 3’ integrated primers (labeled “5’int” and “3’int” in A). Finally, gDNA from a representative disrupted clone (clone 1) shows only the 5 and 3’ integrated products. A negative control (-ctrl; gDNA alone) was also included. (C) Southern blot analysis of BglII-digested DNA, showing the intact pkrp locus in the wt population and a shifted, smaller band associated with the disrupted loci of both clone 1 and 2.

The predicted sequence of Pbpkrp is 8,127 bp after splicing. Northern blot analysis of mixed blood stage RNA isolated from wt parasites and both Pbpkrp - clones revealed a broad area of hybridization with a major RNA band at approximately 5,300 bp in wt RNA that was absent from the knock-out clones (Fig. 3A and B). Protein was extracted from the sporozoite stages of wt and Pbpkrp - clones and analysed by western blotting. An antibody directed against a PbPKRP peptide from the predicted active site kinase domain detected a single, strong band in the wt parasites but not in the Pbpkrp - clones (Fig. 3B). The band corresponds to a protein of approximately 90 kDa, which is smaller than the protein predicted for PbPKRP (315.2 kDa). Gradient gels, specific for the detection of high molecular weight proteins, were also used but no additional bands were observed at any molecular weight (data not shown).

Fig. 3.

Fig. 3

Open in a new tab

Northern and western blot analyses of putative kinase related protein (PKRP) expression in wild-type (wt) and pkrp− sporozoites. (A) Total RNA was extracted from wt and pkrp- sporozoites and 5 μg of RNA from each clone were used for northern blot analyses: the blots were probed with a labeled product of the primer set ORF F/ORF R labeled in Fig. 2A. (B) Ethidium bromide-stained agarose gel showing equal loading of total RNA. (C) Western blot analyses were completed on protein extracts from 7.5 × 104 wt and pkrp- sporozoites. The blots were probed with the anti-peptide rabbit polyclonal serum raised against a conserved kinase domain of PKRP (see Fig. 1A).

3.3. Reduced infection of mosquito midguts by Pbpkrp - parasites

We next characterized the role of PbPKRP in both the blood stage and mosquito stages of infection. Asexual growth in mice was unaffected in both Pbpkrp - clones and they gave rise to the same numbers of gametocytes as wt parasites (Supplementary Fig. S2A). Male gametes differentiated in vitro in both the wt and Pbpkrp − clones (Supplementary Fig. S2B). Mosquito infection, however, differed between the wt and Pbpkrp − parasites. We used a quantitative PCR assay to assess ookinete infection in the mosquito midgut. Twenty-four hours after feeding on mice infected with Pbpkrp - clones and wt parasites, the midguts of mosquitoes were assessed for parasite infection using specific primers for Pb18S rRNA and Pbama-1, together with primers to Pbpkrp as a negative control. The amplification efficiency (Sikorsky et al., 2004; Yanow et al., 2006, 2008) of clones 1 and 2 was significantly reduced 64% and 71%, respectively, at the Pb18S rRNA locus and 58% and 65%, respectively, at the ama-1 locus. There was no amplification of pkrp, as expected (Fig. 4A). This suggests that fewer Pbpkrp- ookinetes were present in mosquito midguts 24 h after infection. However, since asexual parasites in the blood meal exceed the numbers of ookinetes that associate with the midgut, it is possible that even after repeated washing, a carry-over from lysed parasites could distort the result of the PCR analysis. To confirm the reduction of midgut infection, we also analyzed oocyst formation in the midgut at different times after feeding. We found a significant decrease in oocyst numbers in mosquitoes infected with Pbpkrp − clones compared with the wt (Fig. 4B).

A quantitative PCR assay was also used to determine the oocyst production in the mosquito midguts. Similar to the results at the ookinete stage, the amplification efficiency of DNA extracted from mosquito midguts on day 18 p.f. showed approximately an 80-90% reduction in parasite gDNA compared with wt parasites, suggesting fewer oocysts were established (Fig. 5A). Midgut infections were also assessed by sporozoite counts every second day from days 10 to 24 p.f.. Overall, the number of sporozoites in the midguts of the Pbpkrp - clone 1 and clone 2 was reduced 44% and 51%, respectively, throughout the course of infection (Fig. 5B), although this decrease was not significant due to the inherent variation in infection levels between experiments. Transmission electron microscopy images of wt and mutant oocysts within infected midguts did not reveal any morphological differences in the parasites (Fig. 5C). These results suggest that the reduction in midgut sporozoites may arise from a defect in ookinete and oocyst production and indicates a role for PbPKRP prior to sporoblast formation in the endothelium of the mosquito.

Fig. 5.

Fig. 5

Fig. 5

Open in a new tab

Evaluation of sporozoite production and morphology in midguts of mosquitoes infected with clones lacking the gene for putative kinase related protein (pkrp-). (A) Anopheles stephensi mosquitoes were fed directly on mice infected with wild-type (wt) or pkrp- (both clones 1 and 2) parasites on day 0. On day 10 post-feeding (p.f.), mosquito midguts were dissected from 10 mosquitoes from each group and assayed using the quantitative PCR technique as shown in Fig. 4. There was a significant reduction (*) in amplification efficiency in pkrp- DNA for the pb18s rRNA (white bars) and pbama-1 (grey bars) genes in mosquito midguts (P < 0.0001, ANOVA, n = 10). There was no amplification of the Pbpkrp gene (black bars). The infection was repeated twice using independent parasite cycles and each sample was run in triplicate for each qPCR cycle. The average of the results of two qPCRs from each independent cycle with the standard error (SE) is shown. (B) Every second day from day 10 to day 24 p.f., midguts were dissected from 10 mosquitoes from each group. The number of sporozoites per mosquito was determined and the total number of sporozoites (expressed as area under the curve, AUC) calculated for the duration of the infection. A reduction in the number of sporozoites in the midguts of mosquitoes fed on pkrp- parasites persisted throughout the mosquito infection. Shown is the mean AUC with the SE for the number of sporozoites per mosquito in four independent experiments using individual batches of mosquitoes, with 80 mosquitoes dissected in each of the independent experiments. (C) Representative transmission electron micrograph of oocyst sporozoites of a mosquito fed on mice infected with wt parasites. Electron micrographs of representative oocyst sporozoites of mosquitoes fed on mice infected with clones 1 and 2 of Pbpkrp- parasites. N = nucleus; M = microneme; R = rhoptry. Scale bar represents 2 μm.

3.4. Pbpkrp- sporozoites show a reduced capacity to invade mosquito salivary glands

The number of salivary gland sporozoites in wt and Pbpkrp - clones was assessed at the same time as midgut infections. A significant reduction in the number of salivary gland sporozoites was observed for both clones (75.7% for clone 1 and 76.2% for clone 2; Fig. 6A). This was further confirmed by quantitative PCR on DNA from salivary glands collected at day 18 p.f. As observed by sporozoite counts, there was a 75% reduction in amplification efficiency for both the Pb18S rRNA locus and the ama-1 locus using salivary gland DNA from Pbpkrp - parasites. (Fig. 6B). Together, these results suggest that PbPKRP may be involved in multiple stages of parasite development in the mosquito. Interestingly, although there were fewer Pbpkrp - sporozoites inside the mosquito salivary glands, these sporozoites were not deficient in their subsequent infectivity. When equal numbers of Pbpkrp - salivary gland sporozoites were assessed for their gliding motility (see Supplementary Fig. S3A), hepatocyte invasion (see Supplementary Fig. S3B) and formation of exoerythrocytic forms in vitro (see Supplementary Fig. S3C), there was no difference compared with wt parasites. Finally, when equal numbers of salivary gland sporozoites were injected into mice i.v., the kinetics of asexual growth was similar to wt kinetics (data not shown).

Fig. 6.

Fig. 6

Open in a new tab

Evaluation of sporozoite numbers in the salivary glands of mosquitoes infected with clones without the gene for putative kinase related protein (pkrp-). (A) Anopheles stephensi mosquitoes were fed directly on mice infected with wild-type (wt) or pkrp- (both clones 1 and 2) parasites on day 0. Every second day from day 10 to day 24 post-feeding (p.f.), salivary glands were dissected from 10 mosquitoes from each group. The number of sporozoites per mosquito was determined and the total number of sporozoites (expressed as area under the curve, AUC) calculated for the duration of the infection. A significant reduction (*) of pkrp- salivary gland sporozoites was observed throughout the infection (P < 0.0001, ANOVA, n = 400). Shown is the mean AUC with the standard error (SE) for the number of sporozoites per mosquito in four independent experiments using individual batches of mosquitoes, with 80 mosquitoes dissected in each of the independent experiments. (B) On day 18 p.f., mosquito salivary glands were dissected from 10 mosquitoes from each group. Genomic DNA was extracted from the pooled midguts from each group. Malaria infection was determined using quantitative PCR and primers directed towards pb18s rRNA (white bars), pbama-1 (grey bars) and Pbpkrp (black bars). There was a significant reduction (*) in amplification efficiency in salivary glands from mosquitoes infected with pkrp- parasites (P < 0.0001, ANOVA, n = 10). Results are the average with the SE of two independent experiments with 10 mosquitoes per group per clone.

Given the greater reduction of sporozoite numbers associated with the salivary glands compared with the midgut, it is possible that Pbpkrp - sporozoites have a reduced capacity to invade the salivary gland. The experiments shown in Fig. 6 detect both sporozoites attached to the outside of the gland as well as sporozoites within the gland. To test for the capacity of sporozoites to invade the salivary gland, whole glands were treated with trypsin to release sporozoites that had adhered to the outside of the glands. Sporozoites that were attached were located in the supernatant of treated, whole salivary glands, and the numbers were quantified. The number of sporozoites attached to the salivary glands in Pbpkrp - sporozoites was 57.0% and 86.6% reduced for clones 1 and 2, respectively, over the infection cycle compared with wt parasites (Fig. 7A). This reduction in attachment to the salivary gland does not account for the low numbers of sporozoites in salivary glands found in mosquitoes infected with Pbpkrp - sporozoites because it represents only about 3-8% of the total wt sporozoite numbers (Fig. 6A); however, it might indicate that the Pbpkrp - sporozoites have a reduced capacity to recognize the salivary gland for attachment.

Fig. 7.

Fig. 7

Open in a new tab

Evaluation of sporozoite numbers attached to the salivary glands and circulating in hemocoel of mosquitoes infected with putative kinase related protein (pkrp-) deficient parasites. Anopheles stephensi mosquitoes were fed directly on mice infected with wild-type (wt) or pkrp- (both clones 1 and 2) parasites on day 0. On day 10 to day 24 post-feeding (p.f.), hemocoel was collected from 10 mosquitoes from each group. On the same days, whole salivary glands were dissected from the same number of mosquitoes and treated with trypsin to detach sporozoites on the outside of the glands. (A) The number of sporozoites attached to salivary glands per mosquito was determined and the area under the curve (AUC) calculated for the duration of the infection. Fewer sporozoites were attached to mosquito salivary glands in parasites lacking the pkrp- locus. A significant reduction (*) of pkrp- sporozoites attached to salivary glands was observed throughout the course of infection (P = 0.0081, ANOVA, n = 400). The error bar corresponds to the standard error (SE) of three independent experiments. (B) The number of hemocoel sporozoites per mosquito was equivalent in both the wild-type and pkrp- parasites. Shown is the average AUC and the SE of the sporozoite numbers calculated for the duration of the experiment from three independent experiments.

An alternative hypothesis is that the Pbpkrp - sporozoites fail to migrate from the midgut epithelium to the salivary gland. Sporozoites emerging from the oocyst would be released into the circulation in the mosquito hemocoel, which sporozoites use to transit to the salivary glands. The number of Pbpkrp - sporozoites circulating in mosquito hemocoel was not significantly different from wt parasites (Fig. 7B), indicating that sporozoites did migrate out of the midgut into the hemocoel. Given the fact that the number of midgut sporozoites is reduced, one would also expect that the number of hemocoel sporozoites would be similarly reduced, but the numbers are very similar, indicating that many Pbpkrp - sporozoites are trapped and accumulate over time within the hemocoel. We propose that PbPKRP affects the numbers of ookinetes and oocysts, which in turn affects the number of sporozoites in the mosquito midgut. Those sporozoites that do successfully develop are able to migrate to the mosquito hemocoel but are less able to infect mosquito salivary glands than wt parasites, resulting in fewer salivary gland sporozoites.

4. Discussion

CaM is a ubiquitous, calcium-binding protein that can bind and regulate a multitude of different protein targets, thereby affecting many different cellular functions (Silva-Neto et al., 2002). CaMKs are primarily regulated by a change in Ca2+ concentrations. In this study, we show that a CaMK-related protein (PbPKRP) has an important function in mediating the level of P. berghei infection in A. stephensi mosquitoes. The analysis of the pkrp - deletion mutants shows that this protein is not essential for asexual and sexual intraerythrocytic development. However, PbPKRP seems to be involved in mediating the infection of ookinetes in the midgut epithelium of the mosquito, thereby affecting the number of oocysts formed and resulting in decreased sporozoite production. In addition, sporozoites that are released into the mosquito hemocoel have a reduced ability to invade the salivary glands. The results suggest that PbPKRP influences the potential transmissibility of malaria by each mosquito to another mammalian host.

Assigning clear orthology of PbPKRP to a human protein kinase is difficult, given the phylogenetic distances between the species. Based on bioinformatic analysis, PbPKRP is most closely related to the human enzyme TSSK1. Human TSSK1 is almost exclusively expressed in the testes, and a role for this enzyme in the fusion of the sperm and oocyte, together with the breakdown of the nuclear envelope, has been proposed (Hao et al., 2004). Interestingly, this is consistent with our data suggesting that PbPKRP plays a role in cell invasion. As is true with TSSK1, PbPKRP shows sequence similarity with the CaMK family, although it contains no EF-hand motifs, and has a conserved catalytic aspartate. The protein is predicted to be an atypical kinase with a single glycine in the glycine loop motif. Although numerous attempts were made to clone and express an active form of PbPKRP in Escherichia coli, none were successful (data not shown). Expression of Plasmodium proteins has proven to be challenging, with estimates that only 6.3% of attempts at heterologous expression are successful (Mehlin et al., 2006).

The native PbPKRP was identified as a protein of about 90 kDa. It is likely that PbPKRP is processed at the protein level. Post-translational and/or post-transcriptional processing is well-characterized in protein kinases, sometimes occurring in a tissue-specific manner (Kosaka et al., 1988; Bruggemann et al., 2000). This processing could play a role in suppressing kinase activity until the ookinete is formed and is ready to invade the mosquito endothelium. Alternatively, the gene prediction may not be accurate and the PbPKRP transcript which gets translated may be smaller than predicted. Further work is needed to resolve this question, such as generating antibodies to the predicted C terminal region of PbPKRP to determine whether a larger precursor form of PbPKRP is expressed.

The mechanisms underlying the invasion of the ookinete into the mosquito midgut, exit of the sporozoites from the midgut and sporozoite entry into the salivary glands are not well characterized. Given the quantitative reduction in Pbpkrp - parasites at the salivary gland stages, PbPKRP appears to be involved in the invasion of this tissue. There is also a clear reduction in midgut stages, however we have not determined whether PKRP is necessary for midgut invasion or early oocyst development. Some evidence indicates that parasite interactions with salivary glands and with midgut are specific (Ghosh et al., 2001; Han and Barillas-Mury, 2002), but little is known about the parasite molecules that interact with these tissues. A small peptide, called SM1, has been shown to bind to the luminal side of the midgut epithelium and the distal lobes of the salivary glands and interfere with parasite infection in mosquitoes. SM1 presumably blocks a specific interaction between a receptor on the parasite and a binding site on the midgut epithelium and the distal lobes of the salivary glands. Interestingly, this peptide does not bind to the midgut surface in the hemocoel (Ghosh et al., 2001; Ito et al., 2002). Development of transgenic mosquitoes that express inhibitory molecules or with disrupted ligands has been proposed as a method to control malaria transmission by replacing wt mosquitoes with transgenic mosquitoes that are refractory to infection (James, 2003). The identification of PKRP as a regulator of parasite development in the mosquito is a further step toward characterizing protein interactions that could lead to the development of compounds with transmission-blocking potential.

Supplementary Material

01. Supplementary Fig. S1.

Predicted sequence of Plasmodium berghei putative kinase related protein (PKRP).

02. Supplementary Fig. S2.

Asexual and sexual development in wild-type and knockout parasites. (A) The percent parasitemia (a) and percent gametocytemia (b) were quantified on various days of infection in wild-type (black bars) and knockout clone 1 of the Plasmodium berghei putative kinase related protein (Pbpkrp -) (grey bars) parasites. A total of 500 and 2,500 cells were counted for each mouse for the determination of parasitemia and gametocytemia, respectively. Results are the average of three infected mice. (B) Male gametes (white arrowheads) can be seen differentiating in both the wild-type (a) and clone 1 of the Pbpkrp - (b) parasites.

03. Supplementary Fig. S3.

Evaluation of the infectivity of putative kinase related protein-deficient (pkrp-) sporozoites. Anopheles stephensi mosquitoes were fed directly on mice infected with wild-type (wt) or pkrp- (both clones 1 and 2) parasites. At 18 days post-feeding (p.f.), salivary glands were dissected from mosquitoes from each group. (A) Percent motility was evaluated using the methods outlined in Coppi et al. (2006). Briefly, sporozoites were incubated at 37°C for 1 h and the number of sporozoites that demonstrated gliding motility was determined. The percent motility was not significantly reduced in pkrp- compared with wt sporozoites (P = 0.2046, ANOVA). (B) Percent invasion of hepatocytes was evaluated using the methods outlined in Renia et al. (1988), by incubating sporozoites with HEPA 1-6 cells for 1 h and determining the number of sporozoites that had invaded the hepatocyte cells. The percent invasion was not significantly reduced in pkrp- compared with wt sporozoites (P = 0.6913, ANOVA). (C) The number of exoerythrocytic forms (EEFs) formed in vitro using mouse hepatocyte (HEPA 1-6) cells was evaluated after incubation for 48 h using methods as described in Mota and Rodriguez (2000). The number of EEFs was not significantly reduced in pkrp- compared with wt sporozoites (P = 0.7065, ANOVA). Each of these assays was completed three times, shown is a representative experiment for each.

Acknowledgments

We thank J. Noonon, S. Gonzalez, and A. Coppi for assistance with mosquito experiments. We thank Dr. A. Waters who kindly provided the P. berghei ANKA strain and Andrew Berry for helpful information about Pbpkrp sequence and annotation. L.P. was supported by a Canada Graduate Scholarship from the Natural Sciences and Engineering Research Council of Canada. S.Y. was supported by a Canadian Institutes for Health Research and Tomlinson fellowship, McGill University. This work was also supported by Le fonds québécois de la recherche sur la nature et les technologies (FQRNT) Centre for Host-Parasite Interactions; and the Canada Research Chair program. T. S. holds a Canada Research Chair in Immunoparasitology. A. R. is supported by NIH grant RO1 AI 053698. G.P. was supported by the EU 7th framework programme.

Footnotes

Note: Supplementary data associated with this article.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Billker O, Dechamps S, Tewari R, Wenig G, Franke-Fayard B, Brinkmann V. Calcium and a calcium-dependent protein kinase regulate gamete formation and mosquito transmission in a malaria parasite. Cell. 2004;117:503–514. doi: 10.1016/s0092-8674(04)00449-0. [DOI] [PubMed] [Google Scholar]
  2. Bonhomme A, Bouchot A, Pezzella N, Gomez J, Le Moal H, Pinon JM. Signaling during the invasion of host cells by Toxoplasma gondii. FEMS Microbiol Rev. 1999;23:551–561. doi: 10.1111/j.1574-6976.1999.tb00413.x. [DOI] [PubMed] [Google Scholar]
  3. Bruggemann I, Schulz S, Wiborny D, Hollt V. Colocalization of the mu-opioid receptor and calcium/calmodulin-dependent kinase II in distinct pain-processing brain regions. Brain Res. 2000;85:239–250. doi: 10.1016/s0169-328x(00)00265-5. [DOI] [PubMed] [Google Scholar]
  4. Coppi A, Cabinian M, Mirelman D, Sinnis P. Antimalarial activity of allicin, a biologically active compound from garlic cloves. Antimicrob Agents Chemother. 2006;50:1731–1737. doi: 10.1128/AAC.50.5.1731-1737.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Coppi A, Tewari R, Bishop JR, Bennett BL, Lawrence R, Esko JD, Billker O, Sinnis P. Heparan sulfate proteoglycans provide a signal to Plasmodium sporozoites to stop migrating and productively invade host cells. Cell Host Microbe. 2007;2:316–327. doi: 10.1016/j.chom.2007.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Doerig C, Billker O, Pratt D, Endicott J. Protein kinases as targets for antimalarial intervention: Kinomics, structure-based design, transmission-blockade, and targeting host cell enzymes. Biochim Biophys Acta. 2005;1754:132–150. doi: 10.1016/j.bbapap.2005.08.027. [DOI] [PubMed] [Google Scholar]
  7. Ghosh AK, Ribolla PE, Jacobs-Lorena M. Targeting Plasmodium ligands on mosquito salivary glands and midgut with a phage display peptide library. Proc Natl Acad Sci U S A. 2001;98:13278–13281. doi: 10.1073/pnas.241491198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Griffith LC. Calcium/calmodulin-dependent protein kinase II: an unforgettable kinase. J Neurosci. 2004;24:8391–8393. doi: 10.1523/JNEUROSCI.2888-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Han YS, Barillas-Mury C. Implications of Time Bomb model of ookinete invasion of midgut cells. Insect Biochem Mol Biol. 2002;32:1311–1316. doi: 10.1016/s0965-1748(02)00093-0. [DOI] [PubMed] [Google Scholar]
  10. Hao Z, Jha KN, Kim YH, Vemuganti S, Westbrook VA, Chertihin O, Markgraf K, Flickinger CJ, Coppola M, Herr JC, Visconti PE. Expression analysis of the human testis-specific serine/threonine kinase (TSSK) homologues. A TSSK member is present in the equatorial segment of human sperm. Mol Hum Reprod. 2004;10:433–444. doi: 10.1093/molehr/gah052. [DOI] [PubMed] [Google Scholar]
  11. Hillyer JF, Barreau C, Vernick KD. Efficiency of salivary gland invasion by malaria sporozoites is controlled by rapid sporozoite destruction in the mosquito haemocoel. Int J Parasitol. 2007;37:673–681. doi: 10.1016/j.ijpara.2006.12.00. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ishino T, Orito Y, Chinzei Y, Yuda M. A calcium-dependent protein kinase regulates Plasmodium ookinete access to the midgut epithelial cell. Mol Microbiol. 2006;59:1175–1184. doi: 10.1111/j.1365-2958.2005.05014.x. [DOI] [PubMed] [Google Scholar]
  13. Ito J, Ghosh A, Moreira LA, Wimmer EA, Jacobs-Lorena M. Transgenic anopheline mosquitoes impaired in transmission of a malaria parasite. Nature. 2002;417:452–455. doi: 10.1038/417452a. [DOI] [PubMed] [Google Scholar]
  14. James AA. Blocking malaria parasite invasion of mosquito salivary glands. J Exp Biol. 2003;206:3817–3821. doi: 10.1242/jeb.00616. [DOI] [PubMed] [Google Scholar]
  15. Janse CJ, Ramesar J, Waters AP. High-efficiency transfection and drug selection of genetically transformed blood stages of the rodent malaria parasite Plasmodium berghei. Nat Protoc. 2006;1:346–356. doi: 10.1038/nprot.2006.53. [DOI] [PubMed] [Google Scholar]
  16. Kosaka Y, Ogita K, Ase K, Nomura H, Kikkawa U, Nishizuka Y. The heterogeneity of protein kinase C in various rat tissues. Biochemical and biophysical research communications. 1988;151:973–981. doi: 10.1016/s0006-291x(88)80461-3. [DOI] [PubMed] [Google Scholar]
  17. Le Roch KG, Zhou Y, Blair PL, Grainger M, Moch JK, Haynes JD, De La Vega P, Holder AA, Batalov S, Carucci DJ, Winzeler EA. Discovery of gene function by expression profiling of the malaria parasite life cycle. Science. 2003;301:1503–1508. doi: 10.1126/science.1087025. [DOI] [PubMed] [Google Scholar]
  18. Li L, Stoeckert CJ, Jr, Roos DS. OrthoMCL: identification of ortholog groups for eukaryotic genomes. Genome Res. 2003;13:2178–2189. doi: 10.1101/gr.1224503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Mayor S. WHO report shows progress in efforts to reduce malaria incidence. BMJ. 2008;337:a1678. doi: 10.1136/bmj.a1678. [DOI] [PubMed] [Google Scholar]
  20. Mehlin C, Boni E, Buckner FS, Engel L, Feist T, Gelb MH, Haji L, Kim D, Liu C, Mueller N, Myler PJ, Reddy JT, Sampson JN, Subramanian E, Van Voorhis WC, Worthey E, Zucker F, Hol WG. Heterologous expression of proteins from Plasmodium falciparum: results from 1000 genes. Mol Biochem Parasitol. 2006;148:144–160. doi: 10.1016/j.molbiopara.2006.03.011. [DOI] [PubMed] [Google Scholar]
  21. Mota MM, Rodriguez A. Plasmodium yoelii: efficient in vitro invasion and complete development of sporozoites in mouse hepatic cell lines. Exp Parasitol. 2000;96:257–259. doi: 10.1006/expr.2000.4570. [DOI] [PubMed] [Google Scholar]
  22. Nagamune K, Sibley LD. Comparative genomic and phylogenetic analyses of calcium ATPases and calcium-regulated proteins in the apicomplexa. Mol Biol Evol. 2006;23:1613–1627. doi: 10.1093/molbev/msl026. [DOI] [PubMed] [Google Scholar]
  23. Purcell LA, Yanow SK, Lee M, Spithill TW, Rodriguez A. Chemical attenuation of Plasmodium berghei sporozoites induces sterile immunity in mice. Infect Immun. 2008;76:1193–1199. doi: 10.1128/IAI.01399-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Renia L, Miltgen F, Charoenvit Y, Ponnudurai T, Verhave JP, Collins WE, Mazier D. Malaria sporozoite penetration. A new approach by double staining. J Immunol Methods. 1988;112:201–205. doi: 10.1016/0022-1759(88)90358-4. [DOI] [PubMed] [Google Scholar]
  25. Siden-Kiamos I, Ecker A, Nyback S, Louis C, Sinden RE, Billker O. Plasmodium berghei calcium-dependent protein kinase 3 is required for ookinete gliding motility and mosquito midgut invasion. Mol Microbiol. 2006;60:1355–1363. doi: 10.1111/j.1365-2958.2006.05189.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Sikorsky JA, Primerano DA, Fenger TW, Denvir J. Effect of DNA damage on PCR amplification efficiency with the relative threshold cycle method. Biochem Biophys Res Commun. 2004;323:823–830. doi: 10.1016/j.bbrc.2004.08.168. [DOI] [PubMed] [Google Scholar]
  27. Silva-Neto MA, Atella GC, Shahabuddin M. Inhibition of Ca2+/calmodulin-dependent protein kinase blocks morphological differentiation of Plasmodium gallinaceum zygotes to ookinetes. J Biol Chem. 2002;277:14085–14091. doi: 10.1074/jbc.M107903200. [DOI] [PubMed] [Google Scholar]
  28. Sultan AA, Thathy V, Frevert U, Robson KJ, Crisanti A, Nussenzweig V, Nussenzweig RS, Menard R. TRAP is necessary for gliding motility and infectivity of Plasmodium sporozoites. Cell. 1997;90:511–522. doi: 10.1016/s0092-8674(00)80511-5. [DOI] [PubMed] [Google Scholar]
  29. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Vanderberg J. The transmission by mosquitoes of Plasmodia in the laboratory. In: Krier J, editor. Malaria: pathology, vector studies and culture. Academic Press; New York: 1980. pp. 154–218. [Google Scholar]
  31. Ward P, Equinet L, Packer J, Doerig C. Protein kinases of the human malaria parasite Plasmodium falciparum: the kinome of a divergent eukaryote. BMC Genomics. 2004;5:79. doi: 10.1186/1471-2164-5-79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Waters AP, Thomas AW, van Dijk MR, Janse CJ. Transfection of malaria parasites. Methods. 1997;13:134–147. doi: 10.1006/meth.1997.0506. [DOI] [PubMed] [Google Scholar]
  33. Yanow SK, Purcell LA, Spithill TW. The A/T-specific DNA alkylating agent adozelesin inhibits Plasmodium falciparum growth in vitro and protects mice against Plasmodium chabaudi adami infection. Mol Biochem Parasitol. 2006;148:52–59. doi: 10.1016/j.molbiopara.2006.02.019. [DOI] [PubMed] [Google Scholar]
  34. Yanow SK, Purcell LA, Pradel G, Sato A, Rodriguez A, Lee M, Spithill TW. Potent antimalarial and transmission-blocking activities of centanamycin, a novel DNA-binding agent. J Infect Dis. 2008;197:527–534. doi: 10.1086/526788. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01. Supplementary Fig. S1.

Predicted sequence of Plasmodium berghei putative kinase related protein (PKRP).

NIHMS189210-supplement-01.pdf (255KB, pdf)
02. Supplementary Fig. S2.

Asexual and sexual development in wild-type and knockout parasites. (A) The percent parasitemia (a) and percent gametocytemia (b) were quantified on various days of infection in wild-type (black bars) and knockout clone 1 of the Plasmodium berghei putative kinase related protein (Pbpkrp -) (grey bars) parasites. A total of 500 and 2,500 cells were counted for each mouse for the determination of parasitemia and gametocytemia, respectively. Results are the average of three infected mice. (B) Male gametes (white arrowheads) can be seen differentiating in both the wild-type (a) and clone 1 of the Pbpkrp - (b) parasites.

NIHMS189210-supplement-02.jpg (1.7MB, jpg)
03. Supplementary Fig. S3.

Evaluation of the infectivity of putative kinase related protein-deficient (pkrp-) sporozoites. Anopheles stephensi mosquitoes were fed directly on mice infected with wild-type (wt) or pkrp- (both clones 1 and 2) parasites. At 18 days post-feeding (p.f.), salivary glands were dissected from mosquitoes from each group. (A) Percent motility was evaluated using the methods outlined in Coppi et al. (2006). Briefly, sporozoites were incubated at 37°C for 1 h and the number of sporozoites that demonstrated gliding motility was determined. The percent motility was not significantly reduced in pkrp- compared with wt sporozoites (P = 0.2046, ANOVA). (B) Percent invasion of hepatocytes was evaluated using the methods outlined in Renia et al. (1988), by incubating sporozoites with HEPA 1-6 cells for 1 h and determining the number of sporozoites that had invaded the hepatocyte cells. The percent invasion was not significantly reduced in pkrp- compared with wt sporozoites (P = 0.6913, ANOVA). (C) The number of exoerythrocytic forms (EEFs) formed in vitro using mouse hepatocyte (HEPA 1-6) cells was evaluated after incubation for 48 h using methods as described in Mota and Rodriguez (2000). The number of EEFs was not significantly reduced in pkrp- compared with wt sporozoites (P = 0.7065, ANOVA). Each of these assays was completed three times, shown is a representative experiment for each.

NIHMS189210-supplement-03.tif (619.8KB, tif)

RESOURCES