Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2010 Mar 15;54(6):2687–2691. doi: 10.1128/AAC.01359-09

Carbapenem-Resistant KPC-2-Producing Escherichia coli in a Tel Aviv Medical Center, 2005 to 2008▿

Moran G Goren 1, Shiri Navon-Venezia 1, Inna Chmelnitsky 1, Yehuda Carmeli 1,*
PMCID: PMC2876404  PMID: 20231393

Abstract

All of the carbapenem-resistant Escherichia coli (CREC) isolates identified in our hospital from 2005 to 2008 (n = 10) were studied. CREC isolates were multidrug resistant, all carried blaKPC-2, and six of them were also extended-spectrum beta-lactamase producers. Pulsed-field gel electrophoresis indicated six genetic clones; within the same clone, similar transferable blaKPC-2-containing plasmids were found whereas plasmids differed between clones. Tn4401 elements were identified in all of these plasmids.


Carbapenem resistance in Escherichia coli is usually attributed to the acquisition of β-lactamases such as AmpC (14, 23, 24, 27, 31), metallo β-lactamases (4, 17, 25, 33), or KPC-type carbapenemases (2, 3, 26, 32). In 2005, KPC-2-mediated carbapenem-resistant E. coli (CREC) clinical strains were first identified in our hospital (21).

The increasing prevalence of carbapenem-resistant Enterobacteriaceae in Israel (30), along with concerns regarding the emergence of highly epidemic clones, led to the study of carbapenem resistance in E. coli in our hospital. We determined CREC prevalence, elucidated the molecular mechanisms contributing to carbapenem resistance, and explored the molecular epidemiology and plasmids associated with this resistance.

All of the CREC isolates identified in our hospital from February 2005 to October 2008 were included in this study. Strains were identified as resistant to at least one carbapenem using the Vitek-2 and agar dilution (MIC of imipenem or meropenem, >4 μg/ml; MIC of ertapenem, >2 μg/ml). Antibiotic susceptibilities were determined by Vitek-2 (bioMérieux Inc., Marcy l'Etoile, France), and MICs of carbapenems were determined by agar dilution according to the Clinical and Laboratory Standards Institute (CLSI) protocols (8). MICs of tigecycline and colistin and MICs of imipenem, meropenem, and ertapenem lower than 0.5 μg/ml were determined by Etest (AB Biodisk, Solna, Sweden). The criteria used for the interpretation of carbapenem MICs were based on the CLSI 2010 guidelines (9). The interpretive criterion used for tigecycline was based on FDA breakpoint values for Enterobacteriaceae that define a MIC of ≤2 as susceptible.

β-Lactamases were analyzed by analytical isoelectric focusing (IEF) (16) on crude enzyme preparations from sonicated cell cultures as described elsewhere (21). The following β-lactamases were used as controls: TEM-1, pI = 5.4; TEM-26, pI = 5.6; K1, pI = 6.5; SHV-1, pI = 7.6; P99, pI = 7.8; ACT-1, pI = 9.

The genetic relatedness between isolates was determined using pulsed-field gel electrophoresis (PFGE) as previously described (7). DNA macrorestriction patterns were compared according to the Dice similarity index (1.5% tolerance interval) (9a) using GelCompar II version 2.5 (Applied Maths, Kortrijk, Belgium). A PFGE clone was defined as a group of strains showing >85% banding pattern similarity (19).

Multilocus sequence typing (MLST) was performed on two representative E. coli clones according to the protocol at the E. coli MLST website (http://www.pasteur.fr/recherche/genopole/PF8/mlst/EColi.html).

Epidemiological links and potential contact between patients were analyzed using data on room location, consulting physicians, and other procedures performed during their hospitalization.

PCR molecular screening of β-lactamase genes and Tn4401 elements (18) was performed using the primers listed in Table 1. PCR products were sized on an agarose gel and sequenced using an ABI PRISM 3100 genetic analyzer (PE Biosystems). Nucleotide and deduced protein sequences were identified using the BLAST algorithm (www.ncbi.nlm.nih.gov/).

TABLE 1.

Primers used in this study

Screened gene and primer type Sequencea Reference
blaKPC
    Forward ATGTCACTGTATCGCCGTCT 5
    Reverse TTTTCAGAGCCTTACTGCCC
blaSHV group
    Forward TTTATCGGCCYTCACTCAAGG 5
    Reverse GCTGCGGGCCGGATAACG
blaTEM group
    Forward KACAATAACCCTGRTAAATGC 5
    Reverse AGTATATATGAGTAAACTTGG
blaCTX-M-2 group
    Forward ATGATGACTCAGAGCATTCG 5
    Reverse TTATTGCATCAGAAACCGTG
blaCTX-M-3 group
    Forward GTTGTTGTTATTTCGTATCTTCC 5
    Reverse CGATAAACAAAAACGGAATG
blaCTX-M-9 group
    Forward GTGACAAAGAGAGTGCAACGG 5
    Reverse ATGATTCTCGCCGCTGAAGCC
blaCTX-M-25 group
    Forward CACACGAATTGAATGTTCAG 5
    Reverse TCACTCCACATGGTGAGT
blaCMY-1 group
    Forward CAACAACGACAATCCATCCTGTG This paper
    Reverse CAACCGGCCAACTGCGCCAGGA
blaCMY-2 group
    Forward ATGAAAAAATCGTTATGCTGCGCTCTG This paper
    Reverse ATTGCAGCTTTTCAAGAATGCGCC
blaOXA-9
    Forward GCGGACTCGCGCGGCTTTAT This paper
    Reverse GCGAGATCACCAAGGTAGTCGGC
blaOXA-40
    Forward GCAAATAMAGAATATGTSCC 10
    Reverse CTCMACCCARCCRGTCAACC
blaOXA-58
    Forward CGATCAGAATGTTCAAGCGC 28
    Reverse ACGATTCTCCCCTCTGCGC
ISKpn6
    Forward GAAGATGCCAAGGTCAATGC 19
    Reverse GGCACGGCAAATGACTA
ISKpn7
    Forward GCAGGATGATTTCGTGGTCT 13
    Reverse AGGAAGTCGGTGAAGCTGAA
tnpA
    Forward CACCTACACCACGACGAACC 19
    Reverse GCGACCGGTCAGTTCCTTCT
tnpR
    Forward ACTGTGACGCATCCAATGAG 13
    Reverse ACCGAGGGAGAATGGCTACT
a

K is G or T, M is A or C, R is A or G, S is G or C, and Y is C or T.

Plasmids were purified as described previously (12) and transformed into E. coli DH10B by electroporation (Electroporator 2510; Eppendorf, Hamburg, Germany). Transformants were selected on LB agar plates containing 100 μg/ml ampicillin, and selected colonies were screened by PCR for the presence of blaKPC. Plasmid size estimation was performed by digestion of plasmid DNA prepared as described previously (7, 22), followed by S1 nuclease (190 U; Promega, Madison, WI) (1) and PFGE. Electrophoresis was carried out as described previously (7), using the Lambda ladder marker (New England Biolabs, Boston, MA).

Comparison of KPC-encoding plasmids was performed using restriction length polymorphism (RFLP) following digestion with the BglII, EcoRV, SmaI, and KpnI endonucleases (New England Biolabs, Boston, MA). Southern analysis was performed as described previously (21), using a radioactively labeled blaKPC-2 probe (892 bp) obtained with blaKPC primers (5).

Ten CREC isolates were studied. They originated from various isolation sites of 10 patients with no apparent epidemiological connection. The overall prevalence of carbapenem resistance in E. coli during this study period was 0.063% (10 cases out of 15,918 E. coli isolates). All 10 isolates were multidrug resistant (Table 2). The MIC50s and MIC90s of imipenem and meropenem were 4 and 8 μg/ml, those of ertapenem were 16 and 32 μg/ml, and those of doripenem were 1 and 4 μg/ml, respectively. All of the isolates were susceptible to tigecycline (MIC50 and MIC90 of 0.19 and 0.75 μg/ml) and to colistin (MIC50 and MIC90 of 0.125 and 0.19 μg/ml) (Table 2).

TABLE 2.

Antibiotic susceptibility testing results of clinical CREC strains isolated at the Tel Aviv Sourasky Medical Center from 2005 to 2008 and their transformants

E. coli isolate Date of isolation Isolation site PFGE cluster β-Lactamase gene(s) MIC (μg/ml)a
CRO CAZ FEP ATM TZP AMK GEN CIP LVX IPMb MEMb ETPb DPb TGCc CSTc
157 2/2005 Urine III KPC-2 CTX-M-15 TEM >64 >64 >64 >64 >128 8 <1 >4 >8 8 4 8 2 0.38 0.125
157Td KPC-2 >64 16 2 >64 >128 <2 <1 <0.25 <0.25 2 1 4 1 0.19 0.047
329 9/2005 Blood II KPC-2 CTX-M-2 TEM >64 >64 16 >64 >128 32 >16 >4 >8 8 8 32 4 0.19 0.19
329T KPC-2 16 16 2 >64 >128 <2 <1 <0.25 <0.25 2 1 4 1 0.125 0.047
339 9/2005 Peritoneal fluid V KPC-2 TEM >64 4 2 >64 64 4 >16 >4 >8 2 2 16 1 0.19 0.125
339T KPC-2 8 16 2 >64 64 <2 <1 <0.25 <0.25 2 1 4 0.5 0.19 0.047
360 10/2005 Urine I KPC-2 CTX-M-15 OXA-9 TEM >64 >64 >64 >64 >128 32 2 >4 >8 4 4 8 1 0.75 0.19
360T KPC-2 OXA-9 8 16 2 >64 64 >64 2 <0.25 <0.25 1 1 1 <0.5 0.125 0.094
386 10/2005 Wound I KPC-2 CTX-M-15 OXA-9 TEM >64 >64 16 >64 >128 >64 4 >4 >8 1 1 8 1 0.75 0.125
386T KPC-2 OXA-9 8 16 2 >64 64 >64 4 <0.25 <0.25 1 0.25 1 <0.5 0.19 0.047
540 6/2006 Synovial fluid IV KPC-2 TEM >64 4 2 >64 64 16 >16 >4 >8 4 4 16 1 0.19 0.125
543 5/2006 Synovial fluid IV KPC-2 CTX-M-15 TEM >64 16 16 >64 >128 >64 >16 >4 >8 8 4 16 2 0.19 0.125
543T KPC-2 16 16 2 >64 >128 16 <1 <0.25 <0.25 2 0.5 2 <0.5 0.125 0.047
544 5/2006 Abscess IV KPC-2 TEM 32 16 2 >64 >128 8 >16 >4 >8 4 4 16 1 0.38 0.19
547 5/2006 Blood IV KPC-2 TEM >64 4 2 >64 64 16 >16 >4 >8 4 4 8 <0.5 0.125 0.19
547T KPC-2 8 16 2 >64 64 16 <1 <0.25 <0.25 1 0.5 0.25 <0.5 0.125 0.047
1679 10/2007 Peritoneal fluid VI KPC-2 SHV-12 TEM 32 >64 8 >64 >128 <2 >16 >4 >8 8 16 32 8 0.125 0.38
1679T KPC-2 TEM 8 >64 4 >64 64 16 <1 <0.25 <0.25 1 0.5 1 0.5 0.38 0.047
DH10B recipient <0.25 <0.25 0.125 <1 <1 <1 <1 <0.25 <0.25 0.25 0.25 0.023 <0.5 0.125 0.047
a

CRO, ceftriaxone; CAZ, ceftazidime; FEP, cefepime; ATM, aztreonam; TZP, piperacillin-tazobactam; AMK, amikacin; GEN, gentamicin; CIP, ciprofloxacin; LVX, levofloxacin; IPM, imipenem; MEM, meropenem; ETP, ertapenem; DP, doripenem; TGC, tigecycline; CST, colistin. Unless otherwise noted, MICs were determined by Vitek-2.

b

MIC determined by agar dilution; carbapenem MICs lower than 0.5 (except for DP) were determined by Etest.

c

MIC determined by Etest.

d

T, transformant.

PFGE of the 10 CREC isolates revealed six distinct genetic clones (Fig. 1): four clones from 2005 (21), a new clone consisting of four isolates in 2006, and a different clone in 2007. Isolates belonging to the 2006 clone, although genetically identical, originated from four patients hospitalized in different wards during a 1-month period with no apparent epidemiological relatedness. MLST of CREC isolate 386 from 2005 identified this strain as being of sequence type 471 (ST471) reported before in France (11). CREC isolate 547, which belonged to the 2006 clone (Fig. 1), possessed a novel sequence type, ST39.

FIG. 1.

FIG. 1.

PFGE of clinical CREC isolates. Shown are DNA restriction patterns and a dendrogram showing the level of similarity between SpeI-restricted patterns of CREC isolates. Isolates with asterisks were described previously (21). The scale indicates the degree of genetic relatedness between the strains. Isolates were placed into six different clusters based on GelCompar Dice algorithm coefficients, which range from 0 to 100%, as illustrated by the scale to the left of each dendrogram. The year of isolation of each isolate is shown at the right.

IEF demonstrated the production of more than one β-lactamase by each isolate (data not shown). A β-lactamase with an apparent pI of 6.7 was observed in 9 out of 10 isolates, consistent with the pI of KPC-type carbapenemases. PCR screening for β-lactamase genes, followed by sequencing, revealed the presence of blaKPC-2 in all of the strains. Six of the 10 isolates were also extended-spectrum beta-lactamase (ESBL) producers (Table 2).The strains carrying CTX-M enzymes showed higher MICs of ceftazidime and cefepime than the non-ESBL producers (Table 2).

Transformation experiments were performed with eight CREC isolates (Table 2). Plasmid DNA derived from an E. coli 1679 transformant showed a plasmid size different from that of the donor, suggesting rearrangements of plasmid DNA within this strain; therefore, it was excluded from further analysis. Plasmid DNA analysis of transformants indicated that each has acquired a single plasmid (Fig. 2). PCR screening results of plasmid DNA confirmed the presence of blaKPC in all of them, while not all β-lactamases were transferred (Table 2). Acquisition of the blaKPC-2-containing plasmids usually elevated the MICs of cephalosporins, aztreonam, aminoglycosides, and carbapenems, yet none of the transformants presented the same level of carbapenem resistance as the respective donor strain (Table 2).

FIG. 2.

FIG. 2.

PFGE after S1 restriction of donor clinical strains and transformants (A) and Southern blotting using a blaKPC-2 probe (B). Plasmid profiles of six CREC isolates representing genetic clusters I to V and their transformants as determined by S1 nuclease treatment, followed by PFGE (A) and Southern blot analysis using blaKPC-2 probe (B). Lane M, Lambda Ladder PFG Marker (New England Biolabs, Boston, MA); lanes 1 to 12, E. coli clinical isolates (D) and their respective transformants (T).

CREC isolates possessed two or three plasmids which differed in size (Fig. 2A, lanes D). Isolates from the same year and belonging to the same clone carried highly similar-sized plasmids. Southern blot analysis of plasmid DNA from clinical isolates and their transformants showed that each clinical isolate carried a single plasmid encoding blaKPC-2 and that these plasmids varied in size, ranging from ∼45 kb (Fig. 2A, lanes 4 and 6) to ∼100 kb (carried by E. coli strain 157 isolated in 2005) (lane 2). The plasmid DNA RFLP patterns of seven transformants, obtained by using several endonucleases, revealed different restriction patterns but a shared common region, especially between strains isolated in the same year. Southern analysis of the resulting fragments with a labeled-blaKPC-2 probe revealed the same hybridization signal, suggesting that these plasmids share a large fragment harboring blaKPC-2 (Fig. 3), similar to what we found previously in the 2005 isolates (21). Southern blot analysis following restriction with the SmaI endonuclease, which digests blaKPC-2 at nucleotide 790, led to two hybridization signals, suggesting the presence of a single copy of blaKPC-2 in all of the transferred plasmids (Fig. 3B).

FIG. 3.

FIG. 3.

Restriction analysis of blaKPC-2-harboring plasmids (A) and Southern blotting using a blaKPC-2 probe (B). Restriction analysis of blaKPC-2-containing plasmids derived from six CREC isolates after EcoRV (A) or SmaI (B) digestion, followed by Southern blotting using a blaKPC-2 probe. The two isolates belonging to cluster I (isolates 360 and 386) display the same restriction pattern; therefore, isolate 386 was chosen to depict the restriction pattern of both isolates. SmaI endonuclease cleaves blaKPC-2 at position 790 and the IstB and ISKpn6 open reading frames at positions 203 and 676, respectively, creating fragments of ∼1 and ∼1.5 kb. Lanes M, 1-kb DNA ladder (New England Biolabs, Boston, MA).

PCR screening and sequencing of all Tn4401 elements (18) revealed the presence of tnpA transposase, tnpR, and the insertion sequences ISKpn6 and ISKpn7 in all of the isolates and transformants. Based on the sequence recognition of SmaI, blaKPC-2 should be digested, as well as the two genes surrounding it—IstB (part of ISKpn7) and ISKpn6—in a single site, resulting in two DNA fragments of ∼1 and 1.7 kb. These two fragments were visualized by Southern hybridization (Fig. 3B), which may indicate that the structure of Tn4401 in the close vicinity surrounding blaKPC-2 in our strains is conserved.

While carbapenem resistance in Enterobacteriaceae is increasing worldwide, CREC isolates are still rare. However, carbapenem resistance in E. coli is considered to be a great public health threat due to its potential to spread in hospital and community settings (29). This is the first study focusing on the molecular epidemiology and nature of carbapenem resistance in a collection of E. coli isolates within a hospital setting. This paper presents an extension of our previous study in which we first described CREC isolates residing outside the United States (21).

Isolates showed a multidrug resistance phenotype, like all KPC-producing Enterobacteriaceae; however, they possessed lower carbapenem MICs (4- to 8-fold lower) compared to the MICs of carbapenem-resistant Klebsiella pneumoniae ST258 (12). Genotyping of the isolates revealed that resistance to carbapenems in E. coli from 2005 to 2008 was not clonally related, except for four cases in 2006 that were genetically identical, but epidemiological data did not prove an apparent linkage among them. Sixty percent of the KPC-2-producing strains were also ESBL producers but apparently belonged to clones different from those described before (7).

Carbapenem resistance in E. coli during the years studied was rendered by a KPC-2 carbapenemase encoded on various-sized plasmids, which differed between clones but had regions in common. This is the first report describing the presence of Tn4401 elements in the vicinity of blaKPC-2 in E. coli previously described (18). The exact source of the blaKPC-2 gene from E. coli identified in our hospital is still uncertain. Originally, KPC-2 was detected from Enterobacter cloacae in our hospital in 2004 (6, 15), suggesting that they may have acted as a reservoir for the blaKPC-2 gene.

In contrast to epidemic K. pneumoniae clone ST258 (20), carbapenem-resistant E. coli clones did not spread significantly during the last 4 years since their emergence in our hospital or worldwide. However, the potential transfer of blaKPC-2 genes into highly fit, rapidly spreading E. coli strains is disturbing. Strict infection control policies, together with joint efforts, will aid in limiting the further dissemination of blaKPC into E. coli, the most common clinical pathogen.

Acknowledgments

This work was supported in part by European Commission FP7: SATURN—Impact of Specific Antibiotic Therapies on the Prevalence of Human Host Resistant Bacteria research grant 241796.

We thank George Jacoby, Lahey Clinic, Burlington, MA, for providing the strains used as positive controls in the IEF and PCR experiments. Doripenem was kindly provided by Karen Bush and Anne Marie Queenan, R. W. Johnson Pharmaceutical Research Institute, Raritan, NJ. We thank Tali Kotlovsky for her helpful computerized analysis of epidemiological links and potential contact between patients.

This work was performed in partial fulfillment of the requirements for an M.S. degree of Moran G. Goren, Department of Microbiology and Clinical Immunology, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel.

Footnotes

▿

Published ahead of print on 15 March 2010.

REFERENCES

  • 1.Barton, B. M., G. P. Harding, and A. J. Zuccarelli. 1995. A general method for detecting and sizing large plasmids. Anal. Biochem. 226:235-240. [DOI] [PubMed] [Google Scholar]
  • 2.Bratu, S., S. Brooks, S. Burney, S. Kochar, J. Gupta, D. Landman, and J. Quale. 2007. Detection and spread of Escherichia coli possessing the plasmid-borne carbapenemase KPC-2 in Brooklyn, New York. Clin. Infect. Dis. 44:972-975. [DOI] [PubMed] [Google Scholar]
  • 3.Cai, J. C., H. W. Zhou, R. Zhang, and G. X. Chen. 2008. Emergence of Serratia marcescens, Klebsiella pneumoniae, and Escherichia coli isolates possessing the plasmid-mediated carbapenem-hydrolyzing beta-lactamase KPC-2 in intensive care units of a Chinese hospital. Antimicrob. Agents Chemother. 52:2014-2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Cendejas, E., R. Gómez-Gil, P. Gómez-Sánchez, and J. Mingorance. 14 July 2009, posting date. Detection and characterization of Enterobacteriaceae producing metallo-beta-lactamases in a tertiary-care hospital in Spain. Clin. Microbiol. Infect. doi: 10.1111/j.1469-0691.2009.02888. [DOI] [PubMed]
  • 5.Chmelnitsky, I., O. Hermesh, S. Navon-Venezia, J. Strahilevitz, and Y. Carmeli. 2009. Detection of aac(6′)-Ib-cr in KPC-producing Klebsiella pneumoniae isolates from Tel Aviv, Israel. J. Antimicrob. Chemother. 64:718-722. [DOI] [PubMed] [Google Scholar]
  • 6.Chmelnitsky, I., S. Navon-Venezia, J. Strahilevitz, and Y. Carmeli. 2008. Plasmid-mediated qnrB2 and carbapenemase gene blaKPC-2 carried on the same plasmid in carbapenem-resistant ciprofloxacin-susceptible Enterobacter cloacae isolates. Antimicrob. Agents Chemother. 52:2962-2965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chmelnitsky, I., Y. Carmeli, A. Leavitt, M. J. Schwaber, and S. Navon-Venezia. 2005. CTX-M-2 and a new CTX-M-39 enzyme are the major extended-spectrum beta-lactamases in multiple Escherichia coli clones isolated in Tel Aviv, Israel. Antimicrob. Agents Chemother. 49:4745-4750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Clinical and Laboratory Standards Institute. 2006. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard—seventh edition. M7-A7. Clinical and Laboratory Standards Institute, Wayne, PA.
  • 9.Clinical and Laboratory Standards Institute. 2010. Performance standards for antimicrobial susceptibility testing. M100-S20. Vol 30, no 1. Clinical and Laboratory Standards Institute, Wayne, PA.
  • 9a.Dice, L. R. 1945. Measures of the amount of ecologic association between species. Ecology 26:297-302. [Google Scholar]
  • 10.Héritier, C., L. Poirel, D. Aubert, and P. Nordmann. 2003. Genetic and functional analysis of the chromosome-encoded carbapenem-hydrolyzing oxacillinase OXA-40 of Acinetobacter baumannii. Antimicrob. Agents Chemother. 47:268-273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Jaureguy, F., L. Landraud, V. Passet, L. Diancourt, E. Frapy, G. Guigon, E. Carbonnelle, O. Lortholary, O. Clermont, E. Denamur, B. Picard, X. Nassif, and S. Brisse. 2008. Phylogenetic and genomic diversity of human bacteremic Escherichia coli strains. BCM Genomics 9:560. doi: 10.1186/1471-2164-9-560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Leavitt, A., S. Navon-Venezia, I. Chmelnitsky, M. J. Schwaber, and Y. Carmeli. 2007. Emergence of KPC-2 and KPC-3 in carbapenem-resistant Klebsiella pneumoniae strains in an Israeli hospital. Antimicrob. Agents Chemother. 51:3026-3029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Leavitt, A., I. Chmelnitsky, I. Ofek, Y. Carmeli, and S. Navon-Venezia. 2010. Plasmid pKpQIL encoding KPC-3 and TEM-1 confers carbapenem resistance in an extremely drug-resistant epidemic Klebsiella pneumoniae strain. J. Antimicrob. Chemother. 65:243-248. [DOI] [PubMed] [Google Scholar]
  • 14.Liu, Y. F., J. J. Yan, W. C. Ko, S. H. Tsai, and J. J. Wu. 2008. Characterization of carbapenem-non-susceptible Escherichia coli isolates from a university hospital in Taiwan. J. Antimicrob. Chemother. 61:1020-1023. [DOI] [PubMed] [Google Scholar]
  • 15.Marchaim, D., S. Navon-Venezia, M. J. Schwaber, and Y. Carmeli. 2008. Isolation of imipenem-resistant Enterobacter species: emergence of KPC-2 carbapenemase, molecular characterization, epidemiology, and outcomes. Antimicrob. Agents Chemother. 52:1413-1418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Mathew, M., M. Harris, M. J. Marshall, and G. W. Rose. 1975. The use of analytical isoelectric focusing for detection and identification of beta-lactamases. J. Gen. Microbiol. 88:169-178. [DOI] [PubMed] [Google Scholar]
  • 17.Miriagou, V., E. Tzelepi, D. Gianneli, and L. S. Tzouvelekis. 2003. Escherichia coli with a self-transferable, multiresistant plasmid coding for metallo-beta-lactamase VIM-1. Antimicrob. Agents Chemother. 47:395-397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Naas, T., G. Cuzon, M. V. Villegas, M. F. Lartique, J. P. Quinn, and P. Nordmann. 2008. Genetic structures at the origin of acquisition of the β-lactamase blaKPC gene. Antimicrob. Agents Chemother. 52:1257-1263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Naseer, U., B. Haldorsen, S. Tofteland, K. Hegstad, F. Scheutz, G. S. Simonsen, A. Sundsfjord, and the Norwegian ESBL Study Group. 2009. Molecular characterization of CTX-M-15-producing clinical isolates of Escherichia coli reveals the spread of multidrug-resistant ST131 (O25:H4) and ST964 (O102:H6) strains in Norway. APMIS 117:526-536. [DOI] [PubMed] [Google Scholar]
  • 20.Navon-Venezia, S., A. Leavitt, M. J. Schwaber, J. K. Rasheed, A. Srinivasan, J. B. Patel, Y. Carmeli, and the Israeli KPC Kpn Study Group. 2009. First report on a hyperepidemic clone of KPC-3-producing Klebsiella pneumoniae in Israel genetically related to a strain causing outbreaks in the United States. Antimicrob. Agents Chemother. 53:818-820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Navon-Venezia, S., I. Chmelnitsky, A. Leavitt, M. J. Schwaber, D. Schwartz, and Y. Carmeli. 2006. Plasmid-mediated imipenem-hydrolyzing enzyme KPC-2 among multiple carbapenem-resistant Escherichia coli clones in Israel. Antimicrob. Agents Chemother. 50:3098-3101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Noller, A. C., M. C. McEllistrem, O. C. Stine, J. G. Morris, Jr., D. J. Boxrud, B. Dixon, and L. H. Harrison. 2003. Multilocus sequence typing reveals a lack of diversity among Escherichia coli O157:H7 isolates that are distinct by pulsed-field gel electrophoresis. J. Clin. Microbiol. 41:675-679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Odeh, R., S. Kelkar, A. M. Hujer, R. A. Bonomo, P. C. Schreckenberger, and J. P. Quinn. 2002. Broad resistance due to plasmid-mediated AmpC β-lactamases in clinical isolates of Escherichia coli. Clin. Infect. Dis. 35:140-145. [DOI] [PubMed] [Google Scholar]
  • 24.Oteo, J., A. Delgado-Iribarren, D. Vega, V. Bautista, M. C. Rodríguez, M. Velasco, J. M. Saavedra, M. Pérez-Vázquez, S. García-Cobos, L. Martínez-Martínez, and J. Campos. 2008. Emergence of imipenem resistance in clinical Escherichia coli during therapy. Int. J. Antimicrob. Agents. 32:534-537. [DOI] [PubMed] [Google Scholar]
  • 25.Peleg, A. Y., C. Franklin, J. M. Bell, and D. W. Spelman. 2005. Dissemination of the metallo-beta-lactamase gene blaIMP-4 among gram-negative pathogens in a clinical setting in Australia. Clin. Infect. Dis. 41:1549-1556. [DOI] [PubMed] [Google Scholar]
  • 26.Petrella, S., N. Ziental-Gelus, C. Mayer, M. Renard, V. Jarlier, and W. Sougakoff. 2008. Genetic and structural insights into the dissemination potential of the extremely broad-spectrum class A beta-lactamase KPC-2 identified in an Escherichia coli strain and an Enterobacter cloacae strain isolated from the same patient in France. Antimicrob. Agents Chemother. 52:3725-3736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Poirel, L., C. Heritier, and C. Spicq. 2004. In vivo acquisition of high-level resistance to imipenem in Escherichia coli. J. Clin. Microbiol. 42:3831-3833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Poirel, L., S. Marque, C. Heritier, C. Segonds, G. Chabanon, and P. Nordmann. 2005. OXA-58, a novel class D β-lactamase involved in resistance to carbapenems in Acinetobacter baumannii. Antimicrob. Agents Chemother. 49:202-208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Schwaber, M. J., and Y. Carmeli. 2008. Carbapenem-resistant Enterobacteriaceae: a potential threat. JAMA 300:2911-2913. [DOI] [PubMed] [Google Scholar]
  • 30.Schwaber, M. J., S. Klarfeld-Lidji, S. Navon-Venezia, D. Schwartz, A. Leavitt, and Y. Carmeli. 2008. Predictors of carbapenem-resistant Klebsiella pneumoniae acquisition among hospitalized adults and effect of acquisition on mortality. Antimicrob. Agents Chemother. 52:1028-1033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Stapleton, P. D., K. P. Shannon, and G. L. French. 1999. Carbapenem resistance in Escherichia coli associated with plasmid-determined CMY-4 β-lactamase production and loss of an outer membrane protein. Antimicrob. Agents Chemother. 43:1206-1210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Urban, C., P. A. Bradford, M. Tuckman, S. Segal-Maurer, W. Wehbeh, L. Grenner, R. Colon-Urban, N. Mariano, and J. J. Rahal. 2008. Carbapenem-resistant Escherichia coli harboring Klebsiella pneumoniae carbapenemase beta-lactamases associated with long-term care facilities. Clin. Infect. Dis. 46:e127-e130. [DOI] [PubMed] [Google Scholar]
  • 33.Vitti, D., E. Protonotariou, and D. Sofianou. 2009. Carbapenem-resistant Escherichia coli carrying the blaVIM-1 gene in the community. Int. J. Antimicrob. Agents 34:187-188. [DOI] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES