Skip to main content
NCBI home page
Immunology logoLink to Immunology
. 2010 Jun;130(2):262–272. doi: 10.1111/j.1365-2567.2009.03232.x

The Toll-like receptor 2 (TLR2) ligand FSL-1 is internalized via the clathrin-dependent endocytic pathway triggered by CD14 and CD36 but not by TLR2

Haque M Shamsul 1,*, Akira Hasebe 1,*, Mitsuhiro Iyori 1, Makoto Ohtani 1,2, Kazuto Kiura 1, Diya Zhang 1,3, Yasunori Totsuka 2, Ken- ichiro Shibata 1
PMCID: PMC2878470  PMID: 20113368

Abstract

Little is known of how Toll-like receptor (TLR) ligands are processed after recognition by TLRs. This study was therefore designed to investigate how the TLR2 ligand FSL-1 is processed in macrophages after recognition by TLR2. FSL-1 was internalized into the murine macrophage cell line, RAW264.7. Both chlorpromazine and methyl-β-cyclodextrin, which inhibit clathrin-dependent endocytosis, reduced FSL-1 uptake by RAW264.7 cells in a dose-dependent manner but nystatin, which inhibits caveolae- and lipid raft-dependent endocytosis, did not. FSL-1 was co-localized with clathrin but not with TLR2 in the cytosol of RAW264.7 cells. These results suggest that internalization of FSL-1 is clathrin dependent. In addition, FSL-1 was internalized by peritoneal macrophages from TLR2-deficient mice. FSL-1 was internalized by human embryonic kidney 293 cells transfected with CD14 or CD36 but not by the non-transfected cells. Also, knockdown of CD14 or CD36 in the transfectants reduced FSL-1 uptake. In this study, we suggest that (i) FSL-1 is internalized into macrophages via a clathrin-dependent endocytic pathway, (ii) the FSL-1 uptake by macrophages occurs irrespective of the presence of TLR2, and (iii) CD14 and CD36 are responsible for the internalization of FSL-1.

Keywords: CD14, CD36, clathrin-dependent endocytosis, Toll-like receptor 2

Introduction

Toll-like receptors (TLRs) are type-I transmembrane proteins with extracellular leucine-rich repeat motifs and an intracellular Toll/interleukin-1 receptor domain, and they play important roles in recognition of microbial invasion.1 Numerous lines of evidence have indicated that TLRs orchestrate not only the innate immune system but also adaptive immune responses to microbial infections.2 The TLR signals are known to induce activation of the nuclear factor-κB in antigen-presenting cells, which results in the expression of various cytokine genes, induction of co-stimulatory molecules, B7-1 (CD80) and B7-2 (CD86), and class II major histocompatibility complex molecules.3–5 Therefore, TLRs are able to orchestrate the adaptive immune responses to microbial infections.

We have purified and characterized mycoplasmal diacylated lipoproteins responsible for the activation of macrophages and fibroblasts6,7 and have synthesized a diacylated lipopeptide called FSL-1 [S-(2,3-bispalmitoyloxypropyl) CGDPKHPKSF] on the basis of the N-terminal structure of a 44 000 molecular weight Mycoplasma salivarium lipoprotein.7 We have also investigated various biological activities of FSL-18–11 and the mechanism by which it is recognized by TLRs.12–14 Recently, it was found that FSL-1 can enhance phagocytosis of bacteria by macrophages through a TLR2-mediated signalling pathway.10 In the course of these studies, we have become interested in how the TLR2 ligand FSL-1 is processed by macrophages after recognition. Although Triantafilou et al.15 recently reported that recognition of lipoteichoic acid (LTA), which had been considered to be a TLR2 ligand, occurs at the cell surface and that LTA is internalized in a lipid raft-dependent manner, details of internalization of TLR2 ligands after recognition remain unknown.

This study therefore was designed to investigate how the TLR2 ligand FSL-1 is processed in macrophages after recognition by TLR2.

Materials and methods

Chemicals and antibodies

FSL-1 was synthesized as described previously,7 and fluorescein isothiocyanate-conjugated FSL-1 (FITC-FSL-1) was purchased from BioSynthesis (Lewisville, TX). Alexa Fluor 594-conjugated concanavalin A (Alexa-Con A), Lysotracker Red DND-99, and Alexa Fluor 594-conjugated anti-mouse immunoglobulin G were purchased from Invitrogen-Molecular Probes (Eugene, OR); nystatin (Nys), chlorpromazine (CPZ) and methyl-β-cyclodextrin (MbCD) were obtained from Sigma-Aldrich (St Louis, MO); anti-clathrin heavy chain monoclonal antibody (mAb) (clone X22) was obtained from Calbiochem-Novabiochem (La Jolla, CA); and anti-mouse/human TLR2 mAb (clone T2.5), and phycoerythrin-conjugated anti-mouse TLR2 mAb (clone 6C2) were obtained from eBioscience (San Diego, CA). Anti-human CD14 mAb (clone MY4) was obtained from Beckman Coulter (Fullerton, CA), and anti-human CD36 mAb (clone FA6-152) was obtained from Abcam (Cambridge, UK). An enzyme-linked immunosorbent assay kit used to determine the amount of tumour necrosis factor-α (TNF-α) in cell culture supernatants was obtained from BD Biosciences (San Diego, CA).

All other chemicals were obtained from commercial sources and were of analytical or reagent grade.

Cell cultures and mouse peritoneal macrophages (PMφs)

Macrophage cell line, RAW264.7 cells [TIB-71; American Type Culture Collection (ATCC), Manassass, VA] were grown at 37° and in 5% CO2 in RPMI-1640 medium (Sigma) supplemented with 10% (volume/volume) heat-inactivated fetal bovine serum (Gibco BRL, Rockville, MD), 100 units/ml penicillin (Sigma) and 100 μg/ml streptomycin (Sigma) (complete medium). Human embryonic kidney (HEK)293 cells (CRL-1573; ATCC) were grown in Dulbecco’s modified Eagle’s complete medium (Sigma).

Sex-matched C57BL/6 mice (TLR2+/+ mice) were purchased from Japan Clea (Tokyo, Japan). The TLR2-deficient mice on the same background (TLR2−/− mice) were kindly provided by Dr Shizuo Akira, Department of Host Defence, Research Institute for Microbial Diseases, Osaka University (Osaka, Japan). All mice were maintained in specific pathogen-free conditions at the animal facility of Hokkaido University, and all experiments were approved by Hokkaido University Animal Care and Use Committee. Peritoneal macrophages were prepared from mice as described previously.10

HEK293 transfectants

The complementary DNAs (cDNAs) of human CD14, CD36 and TLR2 were obtained as described previously.10,13,16 Briefly, they were obtained by reverse transcription–polymerase chain reaction (PCR) of total RNA isolated from a human monocyte/macrophage cell line, THP-1 cells, and then they were cloned into a pEF6/V5-His TOPO vector (Invitrogen, Carlsbad, CA) or pcDNA3.1-His-TOPO vector (Invitrogen). Their transfection into wild-type HEK293 cells (HEK293WT) was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. To obtain stable transfectants of CD14 (HEK293/CD14) or CD36 (HEK293/CD36), the cells were selected in the presence of blasticidin S (50 μg/ml) (Invitrogen) with limiting dilution.

The cDNAs of TLR2 was cloned into a pEF6/V5-His TOPO vector (Invitrogen) and transiently transfected into HEK293/CD14 (HEK293/CD14/TLR2) or HEK293/CD36 (HEK293/CD36/TLR2) by using metafectene (Biontex Laboratories GmbH, Martinsried/Planegg, Germany).

The surface expression level of CD14, CD36 or TLR2 was confirmed by using a flow cytometer (FCM), FACSCalibur (BD Biosciences). For FCM analysis, data for 30 000 cells falling within appropriate forward-scatter and side-scatter gates were collected from each sample. The results were analysed by using CellQuest software (BD Biosciences) or FlowJo software (Tree Star, Ashland, OR).

FSL-1 uptake

Uptake of FSL-1 by various types of cells was determined by modifying the phagocytosis assay described previously.10,11 Briefly, a 2-ml cell suspension was incubated at 37° for 2 hr with FITC-FSL-1 (100 μg/ml) in base medium appropriate for each of the cells. Then the cells were washed three times with cold phosphate-buffered saline (PBS), suspended in PBS containing 0·2% [weight/volume (w/v)] trypan blue to quench fluorescence caused by cell surface FITC-FSL-1, and treated with 1% (w/v) paraformaldehyde. The uptake levels of FSL-1 by the cells were analysed by using FCM as described above and assessed by change in the mean fluorescence intensity (MFI). For an assay using a confocal laser scanning microscope (CLSM, LSM510 invert Laser Scan Microscope, Carl Zeiss, Tokyo, Japan), a 2-ml suspension of the cells (1 × 105/ml) was added to each well of a six-well plate and incubated at 37° for 24 hr. Then the cells were washed three times at 37° with appropriate base medium and incubated with FITC-FSL-1. The cells were washed with PBS and reacted for 20 min with 50 μg/ml Alexa-Con A in PBS and then treated with PBS containing 3% (w/v) paraformaldehyde.

To exclude non-specific incorporation of FSL-1, inhibition of FITC-FSL-1 uptake by unlabelled FSL-1 was also examined. Uptake of FITC-FSL-1 was measured in the presence of 9 or 35 μg/ml unlabelled FSL-1 under the experimental conditions described above.

Effects of chemicals on FSL-1 uptake

To test the effects of Nys, CPZ and MbCD on FSL-1 uptake, RAW264.7 cells were treated for 30 min with various concentrations of the inhibitors as indicated in Fig. 4, which do not affect the viability of the cells. After the cells had been washed with RPMI-1640 base medium, the uptake level of FSL-1 was determined as described above.

Figure 4.

Figure 4

Open in a new tab

Effects of chemicals on FSL-1 uptake by RAW264.7 cells. RAW264.7 cells were incubated for 30 min without (control) or with various concentrations of nystatin (Nys), and (a–c), chlorpromazine (CPZ) (d–f), and methyl-β-cyclodextrin (MbCD) (g–i) and then incubated for 2 hr with 100 μg/ml fluorescein isothiocyanate-conjugated (FITC-) FSL-1. Results are shown as images obtained by CLSM (FITC-FSL-1, green; Alexa-Concanvalin A, red) and as histograms (b, e, h) and mean fluorescence intensity (MFI) obtained from the histograms by flow cytometry.

RNA interference and real-time PCR

A mouse clathrin heavy-chain-specific small interfering RNA (siRNA) (ACUAAGUAGCGAGAAAGGCtt) and negative control siRNA were purchased from Applied Biosystems (Foster City, CA). A 500-μl suspension of RAW264.7 cells (5 × 105 cells/ml) in a 24-well plate was prepared with antibiotic-free RPMI-1640 complete medium. The cells were incubated for 24 hr and then transfected with the siRNA (20 pmol/well) by using Lipofectamine 2000 according to the manufacturer’s instructions. The medium was exchanged at 5 hr and 24 hr after transfection, and the cells were examined for FSL-1 uptake at 48 hr after transfection. To confirm the effects of siRNAs, Real-Time TaqMan PCR was performed according to the manufacturer’s standard PCR protocol by using a StepOne Real-Time PCR system (Applied Biosystems) with specific pre-made TaqMan probes for mouse clathrin heavy chain (CGTTAATTGACCAGGTTGTACAGAC, Applied Biosystems) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; GAACGGATTTGGCCGTATTGGGCGC, Applied Biosystems).

For down-regulation of CD14 or CD36, their specific siRNA cocktails were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Eighty picomoles of siRNA or negative control siRNA were transfected into HEK293/CD14 or HEK293/CD36 using Metafectene (Biontex Laboratories GmbH). The effects of siRNA transfection on CD14 and CD36 expression level were confirmed by FCM analysis.

Effects of co-transfection of CD14 and CD36 on the uptake of FSL-1

HEK293 cells were prepared in a six-well plate (5 × 105/well). Then the cells were transiently transfected with CD14 (1 or 2 μg) and/or CD36 (1 or 2 μg). After a 48-hr incubation, FITC-FSL-1 (100 μg/ml) was added and the uptake level was determined. After a 2-hr incubation, the uptake level was determined and shown as relative MFI, which is expressed by [(MFI of transfectants incubated with FITC-FSL-1)/(MFI of transfectants)].

Results

FSL-1 uptake by macrophages

First, we examined whether FITC-FSL-1 is able to activate macrophages, because there is a possibility that FITC conjugation affects the ability of FSL-1 to activate them.13 It was found that both FITC-FSL-1 and FSL-1 induced tumour necrosis factor-α production by a murine macrophage cell line, RAW264.7 cells, in a dose-dependent manner (Fig. 1), suggesting that FITC-FSL-1 is also able to activate macrophages, possibly through TLR2. However, it remains unknown how FSL-1 is processed in macrophages after recognition by TLR2. To address this question, an experiment was carried out to determine whether FSL-1 is internalized by macrophages after recognition by TLR2. RAW264.7 cells were incubated with FITC-FSL-1 for 2 hr at 4° (on ice) or at 37°, and then uptake of FSL-1 was determined. FSL-1 was found in the cell membrane but not in the cytosol of RAW264.7 cells at 4° (Fig. 2a,c). However, FSL-1 was found in both the cell membrane and the cytosol of the cells at 37° (Fig. 2b,d). These results suggest that FSL-1 is clearly internalized into the cells in a temperature-dependent manner. To confirm whether FSL-1 is specifically internalized, effects of unlabelled FSL-1 on FITC-FSL-1 uptake were also examined. It was found that unlabelled FSL-1 significantly inhibited FITC-FSL-1 in a dose-dependent manner (Fig. 3), suggesting that FITC-FSL-1 uptake by the cells occurs specifically.

Figure 1.

Figure 1

Open in a new tab

Induction of tumour necrosis factor-α (TNF-α) production by RAW264.7 cells stimulated with FSL-1 or fluorescein isothiocyanate-conjugated (FITC-) FSL-1. RAW264.7 cells in 96-well plates were cultured and then stimulated at 37° for 15 hr with various concentrations of FSL-1 or FITC-FSL-1 in RPMI-1640 base medium. The culture supernatants were collected and examined for the amount of TNF-α, which was determined by enzyme-linked immunosorbent assay. Results are expressed as the means ± SD of three determinations.

Figure 2.

Figure 2

Open in a new tab

Temperature dependency of FSL-1 internalization into RAW264.7 cells. RAW264.7 cells were incubated with 100 μg/ml fluorescein isothiocyanate-conjugated (FITC-) FSL-1 at 4° (on ice) or 37° for 2 hr. The uptake level of FITC-FSL-1 was observed by using confocal laser scanning microscopy at (a) 4° and (b) 37° and flow cytometry at (c) 4° and (d) 37°.

Figure 3.

Figure 3

Open in a new tab

Inhibition of fluorescein isothiocyanate-conjugated (FITC-) FSL-1 uptake by unlabelled FSL-1. FITC-FSL-1 uptake by RAW264.7 cells was measured in the presence of 9 or 35 μg/ml FSL-1 by flow cytometry. The results shown are a histogram and their relative mean fluorescence intensity (MFI) for A, cell only; B, cell + FITC-FSL-1; C, cell + FSL-1 (9 μg/ml) + FITC-FSL-1 (100 μg/ml); D, cell + FSL-1 (35 μg/ml) + FITC-FSL-1 (100 μg/ml). Relative MFIs were calculated as [(MFI of cells incubated with FITC-FSL-1in the absence or the presence of unlabelled FSL-1)/(MFI of cells incubated without FSL-1).

Clathrin-dependent endocytosis of FSL-1

It has been demonstrated that modes of endocytosis of small soluble molecules can be mainly divided into three pathways: clathrin-, caveolae- and lipid raft-dependent endocytic pathways.17 Therefore, experiments were carried out to determine the effects of three chemicals, Nys, CPZ and MbCD, on internalization of FSL-1. Nys selectively disrupts caveolae- and lipid raft-dependent endocytosis but has no effect on clathrin-dependent endocytosis.18 CPZ disrupts clathrin-dependent endocytosis.19 MbCD disrupts both lipid raft- and clathrin-dependent endocytosis.20–23 It has been demonstrated that TLR2 is enriched in lipid rafts24 and that the TLR2 ligand LTA is internalized into cells with TLR2 via lipid rafts.15 The present study demonstrated that Nys had no effect on FSL-1 uptake by RAW264.7 cells (Fig. 4a–c), suggesting that FSL-1 is not internalized by caveolae- and lipid raft-dependent endocytosis. Both CPZ and MbCD inhibited FSL-1 uptake by the cells in a dose-dependent manner (Fig. 4d–i), suggesting that FSL-1 is internalized into macrophages by a clathrin-dependent endocytosis.

The next experiment was therefore carried out to determine whether FSL-1 is co-localized with clathrin in cells. RAW264.7 cells were incubated for 2 hr with FITC-FSL-1, permeabilized with Cytofix/Cytoperm (BD Biosciences), and treated with an anti-clathrin mAb. Both clathrin and FSL-1 were found in endosome-like compartments of the cytosol, and some FSL-1-containing compartments were co-localized with clathrin-coated compartments (Fig. 5a). These results also suggest that clathrin is involved in the uptake of FSL-1. To further confirm this, the effects of gene silencing of clathrin messenger RNA (mRNA) on FSL-1 uptake were examined. The gene-silencing efficiency was confirmed by Real-Time TaqMan PCR using clathrin- or GAPDH-specific TaqMan probes. Analysis by PCR revealed that the level of clathrin mRNA was down-regulated by approximately 35% (Fig. 5b). Then, the effects of gene silencing of these siRNAs on the level of FSL-1 uptake were determined. It was found that the MFI of FSL-1 uptake without any siRNA was 1897, whereas MFIs when transfected with clathrin heavy-chain-specific siRNA and negative control RNA were 1036 and 1721 (Fig. 5c,d), respectively. Down-regulation of clathrin mRNA expression was therefore correlated with a decrease in the level of FSL-1 uptake. These results strongly suggest that FSL-1 is internalized into cells via a clathrin-dependent endocytic pathway.

Figure 5.

Figure 5

Open in a new tab

Involvement of clathrin in FSL-1 uptake by RAW264.7 cells. RAW264.7 cells were incubated for 2 hr with100 μg/ml of fluorescein isothiocyanate-conjugated (FITC-) FSL-1 (green) and then stained with anti-clathrin monoclonal antibody and second antibody (red). White arrows show co-localization of FSL-1-containing compartments with clathrin-coated compartments (a). Down-regulation of clathrin messenger RNA (mRNA) by transfection of clathrin heavy-chain-specific small interfering (siRNA) was determined by using Real-time TaqMan polymerase chain reaction (b). Effect of knockdown of clathrin mRNA on FSL-1 uptake by RAW264.7 cells was determined by flow cytometry. Black line, cell only; grey area, cells with FITC-FSL-1; red line, negative control siRNA-transfected cells with FITC-FSL-1; and blue line, clathrin siRNA-transfected cells with FITC-FSL-1 (c) and mean fluorescence intensity (MFI) obtained from the histogram (d, N, cells with FITC-FSL-1; SC, clathrin siRNA-transfected cells with FITC-FSL-1; and NC, negative control siRNA-transfected cells with FITC-FSL-1).

Maturation of FSL-1-containing endosomes

Endosomes formed by endocytosis sequentially display specific markers dependent on the maturation stage, early endosomes and late endosomes fused with lysosomes.25 To investigate whether FSL-1-containing endosomes mature, Lysotracker Red was employed because it is a dye that is specific for acidified compartments such as late endosomal and lysosomal organelles.26 LysoTracker Red freely permeates cell membranes and remains trapped in acidic compartments upon protonation.26 It was found that some FSL-1-containing endosomes were co-localized with Lysotracker-containing ones (Fig. 6), suggesting that FSL-1-containing endosomes mature to acidified late endosomes.

Figure 6.

Figure 6

Open in a new tab

Maturation of FSL-1-containing endosome. The maturation was determined by staining RAW264.7 cells with Lysotracker, which had been incubated with 100 μg/ml of fluorescein isothiocyanate-conjugated (FITC-) FSL-1. White arrows show co-localization of FSL-1-containing endosomes with Lysotracker-containing endosomes.

TLR2-independent uptake of FSL-1

It has recently been demonstrated that triacylated lipopeptides bind to TLR2 when they are recognized by TLR2.16,27,28 On the basis of these findings, we thought that the complex of TLR2 and FSL-1 was internalized into cells after recognition, because involvement of receptors is indispensable for clathrin-dependent endocytosis.29–31 Therefore, at first, an experiment was carried out to examine the intracellular localization of FSL-1 and TLR2. Both FSL-1 and TLR2 were found to localize on the cell membrane as well as in the cytosol, although no FSL-1 was found to co-localize with TLR2 in the intracellular compartments (Fig. 7a). This result demonstrated that FSL-1 uptake by macrophages occurs in a manner different from that of LTA, because LTA is internalized into a cell and co-localized with TLR2.15 Although no co-localization of FSL-1 with TLR2 cannot rule out that TLR2 is involved in the FSL-1 uptake. Therefore, FSL-1 uptake by PMφs from TLR2+/+ and TLR2−/− mice was examined in the next experiment. There was no difference in the mode of FSL-1 uptake by these PMφs (Fig. 7b–e). These results suggest that FSL-1 uptake occurs irrespective of the presence of TLR2. In the next experiment, we examined whether FSL-1 stimulation affects the expression level of TLR2 on the surface of the cells, because TLR2 was detected in the cytosol after incubation with FSL-1 (Fig. 7a). It was found that incubation with FSL-1 induced down-regulation of the surface expression level of TLR2 (Fig. 8a,b), suggesting that FSL-1 stimulation is required for TLR2 internalization.

Figure 7.

Figure 7

Open in a new tab

Involvement of Toll-like receptor 2 (TLR2) in FSL-1 uptake. Co-localization of fluorescein isothiocyanate-conjugated FITC-) FSL-1 (green) and TLR2 (red) in RAW264.7 cells was observed by confocal laser scanning microscopy (CLSM) (a). Peritoneal macrophages (PMφs) from TLR2+/+ mice and TLR2−/− mice were incubated for 2 hr with 100 μg/ml FITC-FSL-1 and the uptake was determined by flow cytometry (b, c) and CLSM (d, e). Small histograms in (b) and (c) show the surface expression level of TLR2 in each PMφ.

Figure 8.

Figure 8

Open in a new tab

The time–course of cell surface Toll-like receptor 2 (TLR2) expression after FSL-1 stimulation. RAW264.7 cells were stimulated with FSL-1 (10 nm), and cell surface expression level of TLR2 was determined by flow cytometry. The results were shown as both histograms (a, black line, cell only; grey line, cells with isotype control antibody; faint green area, TLR2 expression on unstimulated cells; blue line, TLR2 expression on 1-hr stimulated cells; red line, TLR2 expression on 2-hr stimulated cells) and mean fluorescence intensity (MFI) obtained from the histogram (b).

CD14- and CD36-dependent uptake of FSL-1

We speculated that receptor(s) that mediate(s) the uptake of FSL-1 are CD36 and CD14, because they function as co-receptors for the recognition of a mycoplasmal diacylated lipopeptide, MALP-2,32 and a triacylated lipopeptide, Pam3CSK4,16,33 by TLR2. Therefore, experiments were carried out to determine the roles of CD14 and CD36 in the uptake of FSL-1 by using HEK293WT, HEK293/CD14, HEK293/CD36, HEK293/TLR2, HEK293/CD14/TLR2 or HEK293/CD36/TLR2. They were incubated with FITC-FSL-1 for 2 hr and then examined for the uptake of FSL-1 by CLSM and FCM (Fig. 9). It was clearly demonstrated that FSL-1 internalization occurs in both HEK293/CD14 (Fig. 9b) and HEK293/CD36 (Fig. 9c) but not in HEK293WT (Fig. 9a) and HEK293/TLR2 (Fig. 9d). In addition, co-transfection of TLR2 had no effect on the uptake of FSL-1 by HEK293/CD14 (Fig. 9b,e) and HEK293/CD36 (Fig. 9c,f). These results demonstrated that both CD14 and CD36 are responsible for the uptake of FSL-1.

Figure 9.

Figure 9

Open in a new tab

Involvement of CD14 or CD36 in FSL-1 uptake. HEK293WT (a), HEK293/CD14 (b), HEK293/CD36 (c), HEK293/TLR2 (d), HEK293/CD14/TLR2 (e) or HEK293/CD36/TLR2 (f) were incubated with 100 μg/ml of fluorescein isothiocyanate-conjugated (FITC-) FSL-1 for 2 hr. Results are shown as images obtained by confocal laser scanning microscopy (FITC-FSL-1, green; Alexa-Concanavalin A, red) and as histograms obtained by flow cytometry (faint grey area, cell only; black line, cell + FITC-FSL-1).

To further confirm the involvement of CD14 and CD36 in FSL-1 uptake, the experiments were carried out to investigate the effects of knockdown of CD14 and CD36 on FSL-1 uptake. The gene silencing of CD14 and CD36 were attempted by transfecting their specific siRNAs into HEK293/CD14 and HEK293/CD36, respectively. FCM analysis revealed that the level of both CD14 and CD36 was significantly down-regulated by siRNA transfection (Fig. 10a,b). Then, the effects of transfection of these siRNAs on the level of FSL-1 uptake were determined. It was found that the internalization level was down-regulated in both HEK293/CD14 by CD14 siRNA transfection and HEK293/CD36 by CD36 siRNA transfection. Hence, down-regulation of CD14 and CD36 expression was correlated with a decrease in the level of FSL-1 uptake, suggesting that CD14 and CD36 are responsible for the uptake of FSL-1. Then, the effect of co-transfection of CD14 and CD36 on the uptake of FSL-1 was examined. No synergistic effect by co-transfection was observed, suggesting that FSL-1 uptake mediated by these molecules occurs independently (Fig. 11).

Figure 10.

Figure 10

Open in a new tab

Effects of knockdown of CD14 in HEK293/CD14 and knockdown of CD36 in HEK293/CD36 on the uptake of FSL-1. HEK293/CD14 and HEK293/CD36 cells were transiently transfected with small interfering RNA (siRNA) against CD14 and CD36, respectively. The cell surface expression levels of CD14 (a) and CD36 (b) were confirmed by using flow cytometry. The cells transfected with siRNA against CD14 and CD36 were incubated with 100 μg/ml of fluorescein isothiocyanate-conjugated (FITC-) FSL-1 and the uptake was shown as both relative mean fluorescence intensity (MFI) (c, d) and the histograms (e, f). Relative MFIs were calculated as [(MFI obtained by specific antibody)/(MFI obtained by isotype control antibody)] (a, b) or [(MFI of transfectants with FITC-FSL-1)/(MFI of HEK293WT)] (c, d).

Figure 11.

Figure 11

Open in a new tab

Effect of co-transfection of CD14 and CD36 on the uptake of FSL-1. HEK293 cells were transiently transfected with CD14 and/or CD36. The level of CD14 and CD36 expression was confirmed by flow cytometry (not shown). FSL-1 uptake by the transfectants was measured in the presence of 100 μg/ml of fluorescein isothiocyanate-conjugated (FITC-) FSL-1. Relative mean fluorescence intensities (MFIs) were calculated as [(MFI of transfectants incubated with FITC-FSL-1)/(MFI of transfectants)].

Discussion

This study demonstrated that the diacylated lipopeptide FSL-1 was incorporated into mammalian cells through a clathrin-dependent endocytic pathway in which CD14 and CD36 were involved. First we thought TLR2 is involved in the FSL-1 uptake, because TLR2 is a receptor for FSL-1. However, TLR2 was not co-localized with FSL-1 in the cytosol of macrophages (Fig 7a) and FSL-1 was internalized into PMφs from TLR2−/− mice (Fig. 7c,e). These results suggest the TLR2 is not involved in the FSL-1 uptake. This unique finding is supported by the recent findings of Triantafilou et al.15 on the uptake of the other TLR2 ligand LTA. They found, by using HEK293 cells transfected with both TLR2 and CD14, that TLR2 is recruited within lipid rafts following LTA stimulation, that LTA is internalized in a lipid-raft-dependent manner and that TLR2 is co-localized with LTA in the Golgi apparatus.15 However, they concluded that LTA internalization is not dependent on TLR2, because LTA internalization occurs even in HEK293 cells transfected with only CD14.15 This is in good agreement with our finding that FSL-1 is internalized into PMφs from TLR2−/− mice (Fig. 7c,e). However, their findings that LTA is internalized into a cell in a lipid-raft-dependent manner and is co-localized with TLR2 in the cytosol15 are in contrast to our findings that FSL-1 is internalized in a clathrin-dependent manner (Figs. 3, 4) and FSL-1 is not co-localized with TLR2 in the cytosol (Fig. 7a). This discrepancy may be because of the difference in cell types and ligands used. Triantafilou et al. used non-phagocytic HEK293 transfectants with LTA, whereas we used professional phagocytes, RAW264.7 cells. In addition, several lines of evidence have indicated that LTA is not a TLR2 ligand.34–36 They have described that contaminants in the LTA preparation, but not LTA itself, are responsible for TLR2-mediated activation of innate immune cells. For these reasons there can be no doubt about the difference in uptake mechanisms between LTA and FSL-1. More recently, Triantafilou et al.37 have also reported that TLR2 is co-localized with TLR6 and CD36 in the Golgi apparatus after stimulation with FSL-1 in HEK293 cells transfected with CD14, TLR2, TLR1, TLR6 and CD36, although they did not investigate whether FSL-1 is co-localized with TLR2 in the cytosol.37

Taken together, these results suggest that TLR2 ligands are internalized into cells irrespective of the presence of TLR2 after recognition by TLR2.

There was great interest as to what kind of receptors other than TLR2 are involved in the FSL-1 uptake. We speculated that CD14 or CD36 may mediate the uptake, because they function as co-receptors of TLR2 to recognize lipopeptide.32,33 CD36 is a glycosylated transmembrane protein that is expressed in various cell types and tissues including monocytes/macrophages.38 Especially for innate immune responses, Hoebe et al.32 showed that CD36 is involved in the recognition of TLR2/6 ligands. CD36 is also known as a class B scavenger receptor, and it has been reported that the C-terminal cytoplasmic domain of CD36 is required for bacterial internalization.39 Therefore, it is reasonable that CD36 is responsible for FSL-1 uptake, although Mairhofer et al.40 showed that most of the CD36 is in the lipid-raft fraction. CD14 is found in a soluble form in serum or as a glycosylphosphatidylinositol-anchored protein on the cell membrane, and is one of the essential accessory proteins for lipopolysaccharide recognition.41 It is also known that CD14 functions as a co-receptor of TLR2 for the recognition of a triacylated lipopeptide.16,33 In addition, it has been reported that CD14 is constitutively presented in lipid rafts42 and it remains in lipid rafts after stimulation with LTA.15 In this study, we have shown that both CD14 and CD36 were responsible for the uptake of FSL-1 (Figs. 9 and 10), although it remains unknown how CD14 and CD36 in lipid rafts play roles in clathrin-dependent endocytosis. Therefore, studies are in progress to elucidate the detailed mechanism of FSL-1 uptake by CD14 and CD36.

Mycoplasmas are wall-less prokaryotes characterized by small genomes, and known as the smallest self-replicating organisms.43 Lipoprotein, an integral component of mycoplasmal cell membrane, is a potent pathogenic factor in mycoplasmal infections.44–47 This study showed that the diacylated lipopeptide FSL-1, the active entity of mycoplasmal lipopeptide, was internalized by a clathrin-dependent endocytosis. Some pathogenens, such as influenza A viruses, adenoviruses and the bacterial pathogen Listeria monocytogenes, use clathrin-dependent endocytosis as an invasion mechanism into target cells.48,49 Some mycoplasma species are also known to have invasive properties to host cells,43 but their invasion mechanism still remains unclear. For example, Mycoplasma penetrans, which is the most representative invasive mycoplasma, is known to possess a 65 000 molecular weight fibronectin-binding protein, which is considered to play an important role for its adhesion on a host cell.50 Our finding that the lipopeptide FSL-1 derived from mycoplasmal membrane protein is internalized by a clathrin-dependent endocytosis strongly suggests that membrane lipoproteins play a key role in the invasion of mycoplasmas into host cells.

Studies to clarify the roles of mycoplasmal lipoproteins in invasion into host cells are in progress.

Acknowledgments

This work was supported by Grants-in-Aid for Scientific Research (B19390477 and C19592166) provided by the Japan Society for the Promotion of Science, Grant-in-Aid for Young Scientists (B2179178009) provided by the Ministry of Education, Culture, Sports, Science and Technology, and Grants-in-Aid provided by the Akiyama Foundation (PK430031).

Glossary

Abbreviations:

Alexa-Con A

Alexa Fluor 594-conjugated concanavalin A

ATCC

American Type Culture Collection

cDNA

complementary DNA

CLSM

confocal laser scanning microscope

CPZ

chlorpromazine

FCM

flow cytometer

FITC-FSL-1

fluorescein isothiocyanate-conjugated FSL-1

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

HEK

human embryonic kidney

LTA

lipoteichoic acid

mAb

monoclonal antibody

MbCD

methyl-β-cyclodextrin

MFI

mean fluorescence intensity

mRNA

messenger RNA

Nys

nystatin

PBS

phosphate-buffered saline

PCR

polmerase chain reaction

PMφs

peritoneal macrophages

siRNA

small interfering RNA

TLR

Toll-like receptor

WT

wild-type

Disclosures

The authors have no financial conflict of interest.

References

  • 1.Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell. 2006;124:783–801. doi: 10.1016/j.cell.2006.02.015. [DOI] [PubMed] [Google Scholar]
  • 2.Parker LC, Prince LR, Sabroe I. Translational mini-review series on Toll-like receptors: networks regulated by Toll-like receptors mediate innate and adaptive immunity. Clin Exp Immunol. 2007;147:199–207. doi: 10.1111/j.1365-2249.2006.03203.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Medzhitov R, Janeway C., Jr Innate immunity. N Engl J Med. 2000;343:338–44. doi: 10.1056/NEJM200008033430506. [DOI] [PubMed] [Google Scholar]
  • 4.Hallman M, Ramet M, Ezekowitz RA. Toll-like receptors as sensors of pathogens. Pediatr Res. 2001;50:315–21. doi: 10.1203/00006450-200109000-00004. [DOI] [PubMed] [Google Scholar]
  • 5.Blander JM. Signalling and phagocytosis in the orchestration of host defence. Cell Microbiol. 2007;9:290–9. doi: 10.1111/j.1462-5822.2006.00864.x. [DOI] [PubMed] [Google Scholar]
  • 6.Dong L, Shibata K, Sawa Y, Hasebe A, Yamaoka Y, Yoshida S, Watanabe T. Transcriptional activation of mRNA of intercellular adhesion molecule 1 and induction of its cell surface expression in normal human gingival fibroblasts by Mycoplasma salivarium and Mycoplasma fermentans. Infect Immun. 1999;67:3061–5. doi: 10.1128/iai.67.6.3061-3065.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Shibata K, Hasebe A, Into T, Yamada M, Watanabe T. The N-terminal lipopeptide of a 44-kDa membrane-bound lipoprotein of Mycoplasma salivarium is responsible for the expression of intercellular adhesion molecule-1 on the cell surface of normal human gingival fibroblasts. J Immunol. 2000;165:6538–44. doi: 10.4049/jimmunol.165.11.6538. [DOI] [PubMed] [Google Scholar]
  • 8.Kiura K, Kataoka H, Nakata T, Into T, Yasuda M, Akira S, Inoue N, Shibata K. The synthetic analogue of mycoplasmal lipoprotein FSL-1 induces dendritic cell maturation through Toll-like receptor 2. FEMS Immunol Med Microbiol. 2006;46:78–84. doi: 10.1111/j.1574-695X.2005.00002.x. [DOI] [PubMed] [Google Scholar]
  • 9.Kiura K, Kataoka H, Yasuda M, Inoue N, Shibata K. The diacylated lipopeptide FSL-1 induces TLR2-mediated Th2 responses. FEMS Immunol Med Microbiol. 2006;48:44–55. doi: 10.1111/j.1574-695X.2006.00119.x. [DOI] [PubMed] [Google Scholar]
  • 10.Mae M, Iyori M, Yasuda M, et al. The diacylated lipopeptide FSL-1 enhances phagocytosis of bacteria by macrophages through a Toll-like receptor 2-mediated signalling pathway. FEMS Immunol Med Microbiol. 2007;49:398–409. doi: 10.1111/j.1574-695X.2007.00218.x. [DOI] [PubMed] [Google Scholar]
  • 11.Iyori M, Kataoka H, Shamsul HM, Kiura K, Yasuda M, Nakata T, Hasebe A, Shibata K. Resveratrol modulates phagocytosis of bacteria through an NF-κB-dependent gene program. Antimicrob Agents Chemother. 2008;52:121–7. doi: 10.1128/AAC.00210-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fujita M, Into T, Yasuda M, et al. Involvement of leucine residues at positions 107, 112, and 115 in a leucine-rich repeat motif of human Toll-like receptor 2 in the recognition of diacylated lipoproteins and lipopeptides and Staphylococcus aureus peptidoglycans. J Immunol. 2003;171:3675–83. doi: 10.4049/jimmunol.171.7.3675. [DOI] [PubMed] [Google Scholar]
  • 13.Okusawa T, Fujita M, Nakamura J, et al. Relationship between structures and biological activities of mycoplasmal diacylated lipopeptides and their recognition by toll-like receptors 2 and 6. Infect Immun. 2004;72:1657–65. doi: 10.1128/IAI.72.3.1657-1665.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kataoka H, Yasuda M, Iyori M, Kiura K, Narita M, Nakata T, Shibata K. Roles of N-linked glycans in the recognition of microbial lipopeptides and lipoproteins by TLR2. Cell Microbiol. 2006;8:1199–209. doi: 10.1111/j.1462-5822.2006.00702.x. [DOI] [PubMed] [Google Scholar]
  • 15.Triantafilou M, Manukyan M, Mackie A, Morath S, Hartung T, Heine H, Triantafilou K. Lipoteichoic acid and toll-like receptor 2 internalization and targeting to the Golgi are lipid raft-dependent. J Biol Chem. 2004;279:40882–9. doi: 10.1074/jbc.M400466200. [DOI] [PubMed] [Google Scholar]
  • 16.Nakata T, Yasuda M, Fujita M, Kataoka H, Kiura K, Sano H, Shibata K. CD14 directly binds to triacylated lipopeptides and facilitates recognition of the lipopeptides by the receptor complex of Toll-like receptors 2 and 1 without binding to the complex. Cell Microbiol. 2006;8:1899–909. doi: 10.1111/j.1462-5822.2006.00756.x. [DOI] [PubMed] [Google Scholar]
  • 17.Parton RG, Richards AA. Lipid rafts and caveolae as portals for endocytosis: new insights and common mechanisms. Traffic. 2003;4:724–38. doi: 10.1034/j.1600-0854.2003.00128.x. [DOI] [PubMed] [Google Scholar]
  • 18.Rothberg KG, Heuser JE, Donzell WC, Ying YS, Glenney JR, Anderson RG. Caveolin, a protein component of caveolae membrane coats. Cell. 1992;68:673–82. doi: 10.1016/0092-8674(92)90143-z. [DOI] [PubMed] [Google Scholar]
  • 19.Wang LH, Rothberg KG, Anderson RG. Mis-assembly of clathrin lattices on endosomes reveals a regulatory switch for coated pit formation. J Cell Biol. 1993;123:1107–17. doi: 10.1083/jcb.123.5.1107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kilsdonk EP, Yancey PG, Stoudt GW, Bangerter FW, Johnson WJ, Phillips MC, Rothblat GH. Cellular cholesterol efflux mediated by cyclodextrins. J Biol Chem. 1995;270:17250–6. doi: 10.1074/jbc.270.29.17250. [DOI] [PubMed] [Google Scholar]
  • 21.Rodal SK, Skretting G, Garred O, Vilhardt F, van Deurs B, Sandvig K. Extraction of cholesterol with methyl-beta-cyclodextrin perturbs formation of clathrin-coated endocytic vesicles. Mol Biol Cell. 1999;10:961–74. doi: 10.1091/mbc.10.4.961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.van der Luit AH, Budde M, Ruurs P, Verheij M, van Blitterswijk WJ. Alkyl-lysophospholipid accumulates in lipid rafts and induces apoptosis via raft-dependent endocytosis and inhibition of phosphatidylcholine synthesis. J Biol Chem. 2002;277:39541–7. doi: 10.1074/jbc.M203176200. [DOI] [PubMed] [Google Scholar]
  • 23.Subtil A, Gaidarov I, Kobylarz K, Lampson MA, Keen JH, McGraw TE. Acute cholesterol depletion inhibits clathrin-coated pit budding. Proc Natl Acad Sci U S A. 1999;96:6775–80. doi: 10.1073/pnas.96.12.6775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Soong G, Reddy B, Sokol S, Adamo R, Prince A. TLR2 is mobilized into an apical lipid raft receptor complex to signal infection in airway epithelial cells. J Clin Invest. 2004;113:1482–9. doi: 10.1172/JCI20773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Desjardins M, Huber LA, Parton RG, Griffiths G. Biogenesis of phagolysosomes proceeds through a sequential series of interactions with the endocytic apparatus. J Cell Biol. 1994;124:677–88. doi: 10.1083/jcb.124.5.677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Via LE, Fratti RA, McFalone M, Pagan-Ramos E, Deretic D, Deretic V. Effects of cytokines on mycobacterial phagosome maturation. J Cell Sci. 1998;111:897–905. doi: 10.1242/jcs.111.7.897. [DOI] [PubMed] [Google Scholar]
  • 27.Meng G, Rutz M, Schiemann M, et al. Antagonistic antibody prevents toll-like receptor 2-driven lethal shock-like syndromes. J Clin Invest. 2004;113:1473–81. doi: 10.1172/JCI20762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Jin MS, Kim SE, Heo JY, Lee ME, Kim HM, Paik SG, Lee H, Lee JO. Crystal structure of the TLR1–TLR2 heterodimer induced by binding of a tri-acylated lipopeptide. Cell. 2007;130:1071–82. doi: 10.1016/j.cell.2007.09.008. [DOI] [PubMed] [Google Scholar]
  • 29.Conner SD, Schmid SL. Regulated portals of entry into the cell. Nature. 2003;422:37–44. doi: 10.1038/nature01451. [DOI] [PubMed] [Google Scholar]
  • 30.Neel NF, Schutyser E, Sai J, Fan GH, Richmond A. Chemokine receptor internalization and intracellular trafficking. Cytokine Growth Factor Rev. 2005;16:637–58. doi: 10.1016/j.cytogfr.2005.05.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wolfe BL, Trejo J. Clathrin-dependent mechanisms of G protein-coupled receptor endocytosis. Traffic. 2007;8:462–70. doi: 10.1111/j.1600-0854.2007.00551.x. [DOI] [PubMed] [Google Scholar]
  • 32.Hoebe K, Georgel P, Rutschmann S, et al. CD36 is a sensor of diacylglycerides. Nature. 2005;433:523–7. doi: 10.1038/nature03253. [DOI] [PubMed] [Google Scholar]
  • 33.Manukyan M, Triantafilou K, Triantafilou M, et al. Binding of lipopeptide to CD14 induces physical proximity of CD14, TLR2 and TLR1. Eur J Immunol. 2005;35:911–21. doi: 10.1002/eji.200425336. [DOI] [PubMed] [Google Scholar]
  • 34.Hashimoto M, Tawaratsumida K, Kariya H, Kiyohara A, Suda Y, Krikae F, Kirikae T, Gotz F. Not lipoteichoic acid but lipoproteins appear to be the dominant immunobiologically active compounds in Staphylococcus aureus. J Immunol. 2006;177:3162–9. doi: 10.4049/jimmunol.177.5.3162. [DOI] [PubMed] [Google Scholar]
  • 35.Hashimoto M, Tawaratsumida K, Kariya H, Aoyama K, Tamura T, Suda Y. Lipoprotein is a predominant Toll-like receptor 2 ligand in Staphylococcus aureus cell wall components. Int Immunol. 2006;18:355–62. doi: 10.1093/intimm/dxh374. [DOI] [PubMed] [Google Scholar]
  • 36.Hashimoto M, Furuyashiki M, Kaseya R, et al. Evidence of immunostimulating lipoprotein existing in the natural lipoteichoic acid fraction. Infect Immun. 2007;75:1926–32. doi: 10.1128/IAI.02083-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Triantafilou M, Gamper FG, Haston RM, Mouratis MA, Morath S, Hartung T, Triantafilou K. Membrane sorting of toll-like receptor (TLR)-2/6 and TLR2/1 heterodimers at the cell surface determines heterotypic associations with CD36 and intracellular targeting. J Biol Chem. 2006;281:31002–11. doi: 10.1074/jbc.M602794200. [DOI] [PubMed] [Google Scholar]
  • 38.Febbraio M, Silverstein RL. CD36: implications in cardiovascular disease. Int J Biochem Cell Biol. 2007;39:2012–30. doi: 10.1016/j.biocel.2007.03.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Stuart LM, Deng J, Silver JM, Takahashi K, Tseng AA, Hennessy EJ, Ezekowitz RA, Moore KJ. Response to Staphylococcus aureus requires CD36-mediated phagocytosis triggered by the COOH-terminal cytoplasmic domain. J Cell Biol. 2005;170:477–85. doi: 10.1083/jcb.200501113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Mairhofer M, Steiner M, Mosgoeller W, Prohaska R, Salzer U. Stomatin is a major lipid-raft component of platelet alpha granules. Blood. 2002;100:897–904. doi: 10.1182/blood.v100.3.897. [DOI] [PubMed] [Google Scholar]
  • 41.Ulevitch RJ, Tobias PS. Receptor-dependent mechanisms of cell stimulation by bacterial endotoxin. Annu Rev Immunol. 1995;13:437–57. doi: 10.1146/annurev.iy.13.040195.002253. [DOI] [PubMed] [Google Scholar]
  • 42.Triantafilou M, Miyake K, Golenbock DT, Triantafilou K. Mediators of innate immune recognition of bacteria concentrate in lipid rafts and facilitate lipopolysaccharide-induced cell activation. J Cell Sci. 2002;115:2603–11. doi: 10.1242/jcs.115.12.2603. [DOI] [PubMed] [Google Scholar]
  • 43.Razin S, Herrmann R. Molecular Biology and Pathogenicity of Mycoplasmas. New York: Kluwer Academic/Plenum Publishers; 2002. [Google Scholar]
  • 44.Shimizu T, Kida Y, Kuwano K. A dipalmitoylated lipoprotein from Mycoplasma pneumoniae activates NF-κB through TLR1, TLR2, and TLR6. J Immunol. 2005;175:4641–6. doi: 10.4049/jimmunol.175.7.4641. [DOI] [PubMed] [Google Scholar]
  • 45.Muhlradt PF, Kiess M, Meyer H, Sussmuth R, Jung G. Isolation, structure elucidation, and synthesis of a macrophage stimulatory lipopeptide from Mycoplasma fermentans acting at picomolar concentration. J Exp Med. 1997;185:1951–8. doi: 10.1084/jem.185.11.1951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hasebe A, Pennock ND, Mu HH, Chan FV, Taylor ML, Cole BC. A microbial TLR2 agonist imparts macrophage-activating ability to apolipoprotein A-1. J Immunol. 2006;177:4826–32. doi: 10.4049/jimmunol.177.7.4826. [DOI] [PubMed] [Google Scholar]
  • 47.Hasebe A, Mu HH, Washburn LR, Chan FV, Pennock ND, Taylor ML, Cole BC. Inflammatory lipoproteins purified from a toxigenic and arthritogenic strain of Mycoplasma arthritidis are dependent on Toll-like receptor 2 and CD14. Infect Immun. 2007;75:1820–6. doi: 10.1128/IAI.00516-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Veiga E, Cossart P. Listeria hijacks the clathrin-dependent endocytic machinery to invade mammalian cells. Nat Cell Biol. 2005;7:894–900. doi: 10.1038/ncb1292. [DOI] [PubMed] [Google Scholar]
  • 49.Marsh M, Helenius A. Virus entry: open sesame. Cell. 2006;124:729–40. doi: 10.1016/j.cell.2006.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Giron JA, Lange M, Baseman JB. Adherence, fibronectin binding, and induction of cytoskeleton reorganization in cultured human cells by Mycoplasma penetrans. Infect Immun. 1996;64:197–208. doi: 10.1128/iai.64.1.197-208.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES