Skip to main content
NCBI home page
Plant Signaling & Behavior logoLink to Plant Signaling & Behavior
. 2010 Mar;5(3):239–246. doi: 10.4161/psb.5.3.10573

Stimulation or Inhibition Conflicting evidence for (±)-catechin’s role as a chemical facilitator and disease protecting agent

Harsh P Bais 1,✉, L Venkatachalam 1, Meredith L Biedrzycki 1
PMCID: PMC2881267  PMID: 20023372

Abstract

The occurrence of plant hormesis is a poorly understood phenomenon, wherein low doses of phytotoxins unusually promote growth responses in higher plants. In contrast, negative plant-plant interactions mediated through secreted small molecular weight compounds initiate growth inhibitory responses. Studies related to (±)-catechin mediated allelopathy have transpired both novel information and generated significant controversy. Specifically, studies related to the phytotoxicity responses mediated by (±)-catechins have been seriously debated. The pronged opinion that (±)-catechin is phytotoxic versus non-phytotoxic relies more on the target plant systems and the conditions used to test phytotoxic responses. It is reported that lower than MIC dosage supplementation of (±)-catechin could promote growth responses in the model plant Arabidopsis thaliana. Furthermore, it was shown that sub-MIC levels of (±)-catechin supplementation leads to elicitation of disease resistance against Pseudomonas syringae DC3000 (hereafter DC3000). Intrigued by the unique hormesis response observed, we tested whether (±)-catechin indeed promotes growth responses in A. thaliana. In our hands, we observed no growth promotion responses of (±)-catechin against A. thaliana under in vitro or in soil conditions. We also evaluated the previously reported disease protecting properties of (±)-catechin in A. thaliana against DC3000. The systematic observations to evaluate disease protecting properties entailing colony counts, disease incidences and loss of chlorophyll studies showed no disease protecting properties of (±)-catechin. The transcriptional response for a marker pathogenesis related PR1 defense gene showed no induction post (±)-catechin supplementation. The cell death genes (AC D2 and CA D1) associated with programmed cell death revealed unchanged expression levels in plants treated with sub-MIC levels of (±)-catechin. Further, we report supplementation of sub-MIC levels of (±)-catechin negates any change in the expression of an auxin responsive gene. Our results refute the previous claims of growth and defense inducing effects of (±)-catechin, thus suggesting that a thorough reexamination is required to evaluate the hormetic effect of (±)-catechin under both controlled and natural conditions.

Key words: Arabidopsis thaliana, (±)-catechin, hormesis, Pseudomonas syringae DC3000

Introduction

Invasive weeds exert enormous financial costs due to reduced agricultural productivity and the escalating time and labor required for weed control. Understanding why some exotic plants become so successful is critical to predicting and controlling invasions, and may yield insights into the ecological processes that govern homeostasis and perturbation in natural plant communities. Various hypotheses have been forwarded to explain the rapid invasion of invasive plants in non-native geographical locations. The most tantalizing and controversial hypothesis is the novel weapons hypothesis,1 wherein it is suggested that invasive plants adapt changes linked to biochemical traits to displace native plants. The biochemical changes in the invasive plants are primarily linked to the production of small molecular weight compounds that act as novel phytotoxins to inhibit the growth of native plants.1,2

Plants are unparalleled factories for the production of diverse biochemicals, and allelochemistry has recently re-emerged as a possible mechanism for the success of some invasive weeds.1,3,4 The idea that some invaders may succeed because they possess unique allelopathic, defense, or antimicrobial biochemistry to which natives have not adapted. Indeed, there are a number of studies that support this hypothesis.1–6 Despite progress towards understanding the ecology of invasive plants and recipient communities,3,7,8 there is significant controversy in terms of whether allelochemicals are produced at a biologically significant level to inhibit the growth of native plant communities.9–12 One such case to explain the novel weapons hypothesis is seen with the Eurasian invasive plant species, Centaurea maculosa (spotted knapweed), that uses root exudation of the phytotoxin (±)-catechin as one of several suggested mechanisms to gain advantage over native North American plants.3,13–17 It is reported that in susceptible species such as Arabidopsis thaliana, this compound has been found to induce a wave of reactive oxygen species (ROS) initiated at the root meristem, followed by genome-wide changes in gene expression and ultimately death of the root system.3

It has been shown that C. maculosa exudes a racemic mixture of a polyphenol, (±)-catechin, from its roots.3,13–20 Although (±)-catechin secretions from C. maculosa represent one of the most widely studied systems to understand toxin-mediated invasion in plants, it has also remained highly controversial in the ecological front. Studies conducted by two labs questioned the overall ecological significance, phytotoxicity and mechanism of action reported in the literature. Blair and others9,10 and Duke and others,11,12 showed that (±)-catechin secreted by C. maculosa is a weak phytotoxin and possesses strong antioxidant activity. In contrast to the reports produced by Blair and others9,10 and Duke and others,11,12 other researchers3,13–20 showed that (±)-catechin induces potent phytotoxic activity in soil, in field conditions and in vitro with the minimum inhibitory concentration (MIC) 1.4–5 µgg−1 soil.

Interestingly, a recent report dictates that (±)-catechin can act as both a growth and defense inducing agent in A. thaliana.21 Prithiviraj and others21 showed that (±)-catechin, when administered at lower than MIC concentration could induce growth and a disease protecting phenotype in A. thaliana against DC3000. Although, no mechanism was pinpointed for the growth promoting effects of (±)-catechin in A. thaliana, it was concluded that the disease protection against DC3000 inflicted by (±)-catechin was dependent on non-expressor of pathogenesis related protein (NPR1) pathway.21 The physiological, biochemical and molecular mechanisms that inflict hormesis in plants are poorly investigated.22 It is also suspected that an onward curve to show increase in growth phenotype in plants subjected with low dosage of toxins could simply be because of a poor test design and data analysis.22 Additionally, the central dogma that surrounds the field of hormesis is that the observed growth promotion effects are not highly reproducible and are thoroughly dependent on the exact dose response events.22 It is usually argued that the subtle growth promotion effects observed with a low dosage of toxins could stem from induction of growth regulator pathways in plants. This theory is well demonstrated using synthetic auxins which have been shown to induce hormetic response in several studies.23,24

Of late, researchers have turned their interest to natural organic compounds that may function as growth promoters and disease protecting agents.25 In the past, we have worked with microbial-derived chemical components that induce growth promotion and disease protection in A. thaliana,26 hence we were intrigued to test catechin’s growth promotion and disease protecting properties. In the present work we have focused on the re-examination of the hormesis response of (±)-catechin at both physiological and molecular levels using A. thaliana as a model system. We show that (±)-catechin at low dosage bears no activity to induce a growth inducing phenotype in A. thaliana under in vitro and soil conditions. Our results were also supported by lack of induction of a marker auxin responsive gene in the presence sub-MIC levels of (±)-catechin. Our studies refuted the previously observed disease protecting phenotype of (±)-catechin in A. thaliana against DC3000. In contrast to the published report,21 we show no dependency of the NPR1 pathway to induce a disease resistance phenotype in A. thaliana treated with a low dosage of (±)-catechin.

Results and Discussion

Low dosage of (±)-catechin failed to induce growth responses in A. thaliana under in vitro and in soil conditions.

Intrigued by the previous reports of growth inducing effects of sub-MIC levels of (±)-catechin,21 we systematically evaluated the hormesis effects of (±)-catechin in A. thaliana. We recently re-evaluated the MIC levels of (±)-catechin in A. thaliana, wherein we showed that the (−)-enantiomer is more phytotoxic compared to the (+)-isomer.27 In this recent report we showed that racemic catechin treatment (100 µg ml−1) resulted in severe rhizotoxicity in A. thaliana plants.29 In here, to test the hormesis effect inflicted by alow dosage of (±)-catechin, we evaluated various concentrations (1–20 µg ml−1) of (±)-catechin supplemented in solid MS media. In contrast to the published growth promoting effect (±)-catechin,21 we did not observe any growth inducing effects of (±)-catechin in A. thaliana (Fig. 1A; Suppl. Fig. 1).

Figure 1.

Figure 1

Open in a new tab

Treatment of sub-MIC levels of (±)-catechin on A. thaliana seedlings. (A) A. thaliana plants growing in solid MS full strength media were supplemented with different concentrations of (±)-catechin (1–20 µg ml−1). Post ten days of treatment plants were evaluated for total biomass (fresh weight basis). All data presented are the mean values of five replicates, and the data have been presented as means with standard errors of the means. Means with different letters are significantly different at p ≤ 0.05, according to Duncan’s multiple-range test. (B) A. thaliana plants growing in liquid MS full strength media were supplemented with different concentrations of (±)-catechin (0.02–100 µg ml−1). Post ten days of treatment plants were evaluated for total biomass (fresh weight basis). All data presented are the mean values of five replicates, and the data have been presented as means with standard errors of the means. Means with different letters are significantly different at p ≤ 0.05, according to Duncan’s multiple-range test.

Similar non-growth inducing effects were observed when A. thaliana plants grown in MS liquid media were supplemented with sub-MIC levels of (±)-catechin (0.02–100 µg ml−1). The concentrations below 100 µg ml−1 of (±)-catechin did not promote growth in either solid or liquid media conditions. Consistent with the existing reports of phytotoxicity of (±)-catechin,3,14–20,27 100 µg ml−1 of racemic catechin induced growth inhibitory responses in A. thaliana under liquid media conditions (Fig. 1B; Suppl. Fig. 1). In contrast to the published report,21 we did not observe doubling in the aerial mass of A. thaliana plants treated with sub MIC levels of (±)-catechin (0.3-10 µg g-1) (Fig. 2) under soil conditions. In our study, the A. thaliana plants grown in soil and treated with the sub-MIC levels of (±)-catechin showed no significant difference in the aerial biomass compared to the untreated control (Fig. 2).

Figure 2.

Figure 2

Open in a new tab

Growth responses of A. thaliana plants treated with (±)-catechin. (A) Pictorial evidence to show growth responses in A. thaliana grown in soil and treated with sub-MIC levels of (±)-catechin (0.3–10 µg g−1). (B) Quantitative data showing the growth responses in the A. thaliana grown in soil and treated with sub-MIC levels of (±)-catechin (0.3–10 µg g−1). Data was collected post ten days of treatment and total biomass (fresh weight basis) was evaluated. All data presented are the mean values of at least five replicates, and the data have been presented as means with standard errors of the means. Means with different letters are significantly different at p ≤ 0.05, according to Duncan’s multiple-range test (B).

It is known that several phytotoxins, specifically herbicides and synthetic auxin derivatives induce growth promoting effects in higher plants. Strikingly, the literature suggests that hormesis responses are highly concentration dependent and occur only under stringent conditions.23,24 We were interested in revaluating the previously published hormesis response inflicted by (±)-catechin as other reports dictate that (±)-catechin acts as a major growth inhibitory agent.3,14-20,27 It was speculated that the low dosage release of (±)-catechin from C. maculosa may indirectly benefit neighboring plants to induce growth responses21 although, no data exists which shows the uptake, onward translocation and mode of action of (±)-catechin in the recipient plant communities to induce growth promoting effects. In our hands, using some of the previously published concentrations of (±)-catechin,21 we failed to observe any growth inducing affects in A. thaliana. We do not know the reason for the disparity between our results showing no growth inducing effects for (±)-catechin and experiments that have shown the hormesis,21 but there are several possibilities worth considering. First, the rate at which different forms of catechin oxidize could lead to substantial differences if the oxidized forms are not bio-available to induce growth promoting effects. Keeping in mind that hormesis is usually observed under highly specific and stringent conditions, there is a possibility that media and conditions such as light exposure and source may also impart changes in oxidation status of catechins leading to its unavailability to induce growth promoting effects in our hands. Sub-MIC levels of (±)-catechin negate transcriptional changes in an auxin responsive gene in A. thaliana.

As shown above and almost in contrast to the previously published report of growth inducing effects of (±)-catechin, our current study failed to observe any hormetic effects of (±)-catechin in A. thaliana. Since it is argued that most of the growth related changes in higher plants are partly due to direct and indirect involvement of auxins, we decided to check the involvement of an auxin responsive gene (DR5) in A. thaliana treated with low dosage of (±)-catechin. Auxin is an important plant hormone which controls primary growth by regulating cell proliferation and enlargement.28 Since all of above results showed no growth inducing effect in A. thaliana treated with sub-MIC levels of (±)-catechin, we further questioned the role of auxin in this scenario. To examine this speculation, we conducted in vitro assays using an A. thaliana Col-0 transgenic line stably expressing a GFP reporter gene fusion to the auxin responsive promoter DR5 (DR5::GFP). The results presented in Figure 3 show no transient changes in DR5 expression in the plants treated with sub-MIC levels of (±)-catechin (1–20 µg ml−1). These results suggest that the plants treated with sub-MIC levels of (±)-catechin negate any transient changes in auxin biosynthesis/perception. This result strongly supports our earlier observation of no growth inducing effects of (±)-catechin at low dosage, which could be attributed to failure of catechin to induce auxin perception or biosynthesis.

Figure 3.

Figure 3

Open in a new tab

The expression of an auxin responsive gene in A. thaliana post treatment with sub-MIC levels of (±)-catechin. The DR5::GFP A. thaliana plants treated with sub-MIC levels of (±)-catechin and the expression of DR5 were monitored post 5 days of catechin treatment. Each experiment was repeated twice with three replicates each and a representative image of at least ten roots imaged for each treatment was presented.

It is argued that most of the herbicides and insecticides that show a hormetic response in higher plants mediate the effect through intervention with the endogenous growth regulators. Studies stemming from synthetic auxin derivative work showed higher growth regulator biosynthesis in the phytotoxin treated plants leading to growth inducing effects.29 Reports also show increased Ca2+ transients over cell membranes may also enhance synthetic auxin induced hormesis in cotton and corn plants.30 As discussed previously, our results showed a deviation from the published report21 that sub-MIC levels of (±)-catechin could induce growth promoting effects in A. thaliana, further, the evidence that a low dosage of (±)-catechin did not upregulate the perception and biosynthesis of auxin, supports the fact that (±)-catehin may not induce an auxin dependent hormesis response in A. thaliana.

No disease protection in A. thaliana treated with low dosage of (±)-catechin.

Previous reports showed that A. thaliana plants treated with sub-MIC levels of (±)-catechin induced disease protection responses against P. syringae DC3000. Since our above results refuted the growth inducing properties of (±)-catechin in A. thaliana, we re-evaluated the disease protection hypothesis.21 We tested the disease protection hypothesis of (±)-catechin under in vitro and in soil conditions. The leaves of A. thaliana plants grown in soil supplemented with (±)-catechin (0.3 µg g−1) were pressure infiltrated with DC3000. The results shown in Figure 4A reveal that post 24 h and 48 h of DC3000 infiltration, plants treated with catechin and infected with DC3000 showed no difference in bacterial cell counts compared to the alone DC3000 treatments. Post 4 days of DC3000 infection revealed a similar zone of infection in plants treated with catechin and infected with DC3000 compared to lone DC3000 infections (Fig. 4A). We also stretched our studies to test the disease protection ability of (±)-catechin under in vitro conditions. In here, we followed a previously published protocol (Schreiber et al., 2008), wherein A. thaliana plants treated with different concentration of (±)-catechin (0, 0.25, 5, 25 and 50 µg ml−1) were infected with DC3000. The results shown in Figure 4B reveal that post 24 h and 48 h of DC3000 infection, plants grown in the medium containing catechin and infected with DC3000 showed no significant difference in CFU’s compared to the controls (plants grown in medium without catechin). Secondly, sub-MIC levels of (±)-catechin (25 µg ml−1) treated plants were infected with DC3000 and we followed loss of chlorophyll as a marker to show disease infection phenotype in these plants.31 The results shown in Figure 5 revealed no difference in loss of chlorophyll in plants treated with catechin and infected with DC3000 compared to lone DC3000 infected plants. Our results reveal that (±)-catechin at sub-MIC levels failed to protect A. thaliana against DC3000 under soil and in vitro conditions.

Figure 4.

Figure 4

Open in a new tab

Effect of sub-MIC levels of (±)-catechin on disease protection in A. thaliana against DC3000. (A) A. thaliana plants grown in soil primed with sub-MIC levels of (±)-catechins (0.3 µg g−1) were leaf infiltrated with DC3000. Colony forming units (CFU) were evaluated post 24 and 48 h of DC3000 infiltration. Inset picture shows prolonged disease in A. thaliana plants infected with DC3000. Number 1–4 refer to 1,4 = Control (Untretaed); 2 = DC3000; 3 = DC3000 + 0.3 µg g−1 catechin. (B) One week old A. thaliana plants grown in vitro with medium containing different concentrations of catechin (control, control + methanol, 0.25, 5, 25 and 50 µg ml−1) with 0.02OD of DC3000. Colony forming units (CFU’s) were calculated for 24 and 48 h of in vitro culturing.

Figure 5.

Figure 5

Open in a new tab

A. thaliana plants grown in vitro primed with sub-MIC levels of (±)-catechin (25 µg ml−1) and infected with DC3000. The micrographs showing loss of chlorophyll as a marker of DC3000 infection was taken post 24 and 48 h of infection. Each experiment was repeated twice with three replicates each and a representative image of at least ten plants imaged for each treatment was presented. Scale bar = 1 cm.

No induction in the levels of PR1, ACD2 and CAD1 in A. thaliana treated with low dosage of (±)-catechin.

It was reported that disease protection against DC3000 in A. thaliana offered by low dosage treatment of (±)-catechin was mediated through induction of PR1.21 Since in our hands we did not observe any disease protection ability of (±)-catechin against DC3000, we envisaged to test the induction of PR1 in A. thaliana post catechin treatment. We utilized Arabidopsis lines carrying PR1::GUS fusions to study the PR1 expression.26 Ten day old A. thaliana plants treated with different concentrations of (±)-catechin (0, 0.04, 0.25, 5, 25 and 50 µg ml−1) were analyzed for PR1 expressions post 24 and 48 h. In our hands, we did not observe any PR1 induction in sub-MIC level catechin treated plants (Fig. 6, Suppl. Figs. 2 and 3). As a positive control we used A. thaliana plants treated with Bacillus subtilis FB17, which is known to induce PR1 expression.26 Roots colonized with FB17 showed higher PR1::GUS expression in the leaves compared to un-inoculated control and catechin treated plants (Fig. 6). Consistent with our PR1::GUS expression data, the transcriptional expressions of PR1 remain unchanged post catechin treatment in A. thaliana Col-0 plants (Suppl. Figs. 2 and 3). Recently, we have shown that MIC levels of (±)-catechin (100 µg ml−1) induce two cell death associated marker genes (ACD2 and CAD1) responses in A. thaliana plants.27 In here we wanted to evaluate the induction of these marker cell death genes in plants treated with sub-MIC levels of (±)-catechin. Interestingly, our results showed that sub- MIC (±)-catechin treatment to A. thaliana plants resulted in nonactivation of signature cell death genes such as ACD2 and CAD1 (Suppl. Figs. 2 and 3). The unchanged expressions of cell death associated genes in sub-MIC catechin treated plants confirms the non-phytotoxic levels of (±)-catechin used in our study.

Figure 6.

Figure 6

Open in a new tab

Effect of sub-MIC levels of (±)-catechin on PR1::GUS expression post 24 and 48 hrs of catechin treatment. A control with B. subtilis FB17 treated plants showed enhanced PR1 expression in leaves compared to (±)-catechin (20 µg ml−1) treated plants. (Scale = 2,000 µm).

Material and Methods

Plant material and chemicals.

Arabidopsis thaliana wild type cultivar Columbia 0 (Col-0) seeds were procured from Lehle Seeds (Round Rock, TX). The aseptic cultures were used for the in vitro studies. Racemic catechin (#C1788; Sigma lot number 045k1052; for purity and MSDS check: www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do) was obtained from Sigma-Aldrich.

Culture conditions.

Seeds were washed in double-distilled water thrice and surface-sterilized using 50% commercial bleach (sodium hypochlorite) for 3–5 min followed by 3–4 washes in sterile distilled water. The seeds were cultured on Murashige and Skoog’s (MS)32 solid medium with 3% sucrose and allowed to germinate for 5 days until the roots and shoots emerged. The seedlings were then incubated at 25 ± 2°C under 16 h light and 8 h dark. The plates were illuminated with cool fluorescent light with an intensity of 24 µmol m−2 s−1.

In vitro hormesis assays.

One week old A. thaliana Col-0 seedlings that had been germinated on MS solid medium with 3% sucrose were transferred to solid MS plates with 3% sucrose and supplemented with different concentrations of (±)-catechin (1–20 µg ml−1). (±)-Catechin was administered into solid MS media dissolved in methanol, a corresponding methanol control (0.5% v/v) was also checked to evaluate the solvent effect on plants. (±)-Catechin treated plants were harvested post 10 days of treatment. To evaluate the hormesis response the fresh weight analysis of plants was recorded. Each Petri dish contained 3 plants and there was a minimum five replicates per (±)-catechin treatment. We also compared the solid hormesis assays with the liquid MS media treatments. In here, week-old A. thaliana plants grown in MS solid media (1% sucrose) were transferred to 24 well plates containing liquid MS media (1% sucrose). Subsequently, the liquid media was supplemented with different concentrations of (±)-catechin (0.02–100 µg ml−1). The catechin treated plants were harvested 10 days post treatment and fresh weight was recorded to evaluate the hormesis effect. The experiment was repeated twice with a minimum of five replicates per catechin treatment.

In soil hormesis assay.

One week old A. thaliana seedlings were transferred from MS solid media to peat pellets (Jiffy Co.,). A week after establishment of the plants in the peats, plants were irrigated with solutions of (±)-catechin dissolved in methanol (0.5% v/v) at different concentrations (0–10 µg g−1 soil). Post 10 days of treatment, plants were weighed to evaluate the hormesis effect of (±)-catechin. A minimum of five replicates per catechin treatment was performed. The experiments were performed in vitro and soil to analyze the hormetic effect of (±)-catechin, and were replicated as per the published protocol.21 We also followed published protocol21 to establish plant cultures and supplementation of (±)-catechin in vitro and soil.

DR5 expressions with sub-MIC levels of (±)-catechin.

Ten-day old seedlings of A. thaliana Col-0 transgenic line stably expressing a DR5::GFP fusion were used to study the effect of low dosage supplementation of (±)-catechin on auxin responsive gene expression in Arabidopsis. Ten day old DR5::GFP seedlings grown in MS solid media were treated with sub-MIC levels of (±)-catechin (1–20 µg ml−1). Post five days of treatment of (±)-catechin treatment, seedlings were harvested for confocal microscopy. Single median optical sections were captured with a Zeiss 10X Plan-Apochromat (numerical aperture 0.45) objective lens using a Zeiss LSM 510 NLO on an Axiovert 200M. The 488 nm laser line of the Argon laser and a 505 nm long pass filter were used for excitation and emission, respectively. Each experiment was repeated twice with three replicates each and a representative image of at least ten roots imaged for each treatment was presented.

P. syringae DC3000 infection under in vitro and in soil conditions.

P. syringae DC3000 (obtained from Dr. Jorge M. Vivanco, Colorado State University, Fort Collins, CO 80523-1173) were maintained on LB plates with 50 µg ml−1 rifampicin. A single colony from a freshly streaked plate with or without antibiotic selection of each of the cultures was used to grow overnight cultures from which approximately 0.02–0.05 OD600 culture was prepared and used in all the experiments. For routine plant based studies, cells were grown in LB medium at 37°C with shaking 220 rpm. A. thaliana Col-0 plants were grown on peat pellets in a growth chamber set for a photoperiod of 16 h light and 8 h dark at 23 ± 2°C and illuminated with cool fluorescent light with an intensity of 24 µmol m−2 s−1 for a twenty day period. Leaves of A. thalina plants primed with (±)-catechin (0.3 µg g FW−1) were pressure inoculated with 100 µl of 0.02 OD600 culture of P. syringae DC3000. Different treatments included control (without DC3000 infiltration and catechin treatment), and DC3000 (only leaf infiltration). The plants were transferred to magenta boxes and incubated in the growth chamber for an additional four days. The experiment was terminated after four days and observations such as disease incidence and number of colony forming units (CFU’s) per gram fresh weight of the leaf were recorded. Each treatment had at least 6 biological replicates and the experiment was repeated at two independent occasions.

For the in vitro assay we used a previously established protocol (Schreiber and others 2008) to analyze the disease protection effect of (±)-catechin (0–50 µg ml−1) against DC3000 in A. thaliana seedlings. The assays were performed in liquid media, wherein surface-sterilized A. thaliana (Col-0) seedlings (10 days old) were suspended in 24 well plates containing MS (1%) media supplemented with 2.5 mm 2-(N-morpholino) ethanesulfonic acid (MES), pH 5.8 (Sigma-Aldrich) and different concentrations of (±)-catechin (0–50 µg ml−1). Ten-day-old seedlings were inoculated with P. syringae DC3000 at a final concentration of 1 × 107 CFU ml−1 (OD600 = 0.02). Plates were continuously stirred at 80 rpm under continuous light at 22–25°C in a controlled environment room. Seedling phenotypes were assessed at 24 and 48 h post-inoculation using stereo microscope (Zeiss Axioskop-2), wherein, chlorophyll degradation with loss of red fluorescence was used as an indicator of DC3000 disease progression. For further confirmation, CFUs of DC3000 per gram fresh weight of the seedlings were recorded at 24 and 48 h post inoculation by extracting a known fresh biomass of the seedlings and plating on Luria-Bertani plates containing 50 µg ml−1 rifampicin.

RNA isolation and reverse transcription-polymerase chain reaction (RT-PCR).

Ten day old A. thaliana seedlings were transferred to MS solid media (3% sucrose), subsequently, (±)-catechin (control, control + 0.5% methanol, 0.25, 5, 25 and 50 µg ml−1) was added to the media. Total RNA was isolated from the seedlings post 24 and 48 h (±)-catechin treatment. RNA was extracted using PureLink RNA isolation buffer according to the manufacturer’s instruction manual (Invitrogen, CA). Possible contaminant genomic DNA in RNA extract was removed using turbo DNA-free™ kit (Ambion). The concentration of total RNA was determined spectrophotometrically at 260 nm. The integrity of RNA was checked by electrophoresis in formaldehyde denaturing gels stained with ethidium bromide. The gene-specific primers for the genes PR1, ACD2, CAD1 and UBQ1, were designed using Primer3 software and synthesized (Invitrogen) (T1|Table 1). First-strand complementary DNAs were synthesized from 500 ng of total RNA in 20-µl final volume, using M-MuLV reverse transcriptase and oligo-dT (18 mer) primer (Fermentas GmbH, Germany). PCR amplifications were performed using PCR mixture (15 µl) that contained 1 µl of RT reaction product as template, 1× PCR buffer, 200-µM dNTPs (Fermentas GmbH), 1 U of Taq DNA polymerase (Promega), and 0.1 µm of each primer depending on the gene. PCR was performed at initial denaturation at 94°C for 4 min, 22 or 26 cycles (30 sec at 94°C; 30 sec at 60°C; 30 sec at 94°C), and final elongation (8 min at 72°C) using a thermal cycler (Bio-rad). The PCR products obtained were separated on 1.4% agarose gel, stained with ethidium bromide (0.001%), and documented in a gel documentation system and the bands were quantified using E.A.S.Y. WIN 32. Each band was normalized against the intensity obtained with the same cDNA using the UBQ1 primers. For calculating the transcript abundance each gene in the (±)-catechin treatments, transcripts of the control (without methanol and (±)-catechin) were used for comparison.

PR1::GUS expression with lower than MIC concentration of (±)-catechin.

Transgenic Arabidopsis (Col-0) plants (10 days old) carrying PR1::GUS fusion construct were grown on MS solid media supplemented with different concentrations of (±)-catechin (20 µg ml−1). Post 24 and 48 hrs treatment with (±)-catechin, plants were analyzed for PR1 expressions. The plants were stained for GUS assay using a GUS staining kit (obtained from Sigma-Aldrich, USA) according to manufacturer’s instructions. The control and treated plants were imaged for the expression of PR1::GUS in the leaves as per the published protocol (Shapiro and Zhang 2001). A representative image of at least 12 leaves imaged was presented for each treatment. Each treatment had six replicates and the experiment was repeated on two independent occasions. We used a positive control wherein PR1::GUS plants were also treated with Bacillus subtilis (FB17 strain) as per the published protocol.26

Data analysis.

All data presented are the mean values of six replicates, and the data have been presented as means with standard errors of the means. The data were analyzed by one-way analysis of variance (ANOVA) using Microsoft Excel 2007® (Microsoft Corporation, WA), and post-hoc mean separations were performed by Duncan’s Multiple Range Test at p ≤ 0.05,33 by using the software SPASS version 12.0.

Conclusions

The published report demonstrating that some of the growth inhibitors like (±)-catechin could also serve as a growth stimulant was not reproducible in our hands. Our results showed a complete deviation from the published report defying that a growth inhibitor like (±)-catechin did not induce growth and disease protection in A. thaliana. Our observation again reveals the variation that is often observed in reporting stimulation activity with phytotoxins. It is important that a high relevance should be placed in terms of experimental design and conditions to evaluate the hormesis response by phytotoxins and allelochemicals. It was speculated that the low dosage release of (±)-catechin from C. maculosa plants would help protect neighboring plants from pathogens and promote growth responses.21 In the light of our results, it is difficult to speculate and assess the ecological significance of growth promotion effect of (±)-catechin on recipient plant communities.

Table 1.

Specific primers, annealing temperatures and total numbers of amplification cycles used for RT-PCR

Primer Primer sequence (5′–3′) Annealing temperature (°C) Total number of amplification cycle Amplicon size (bp)
ACD2-forward AGTCCATGGAAGACCACGAC 60 23 450
ACD2-reverse AGCACAAGCGACTTGGAACT
CAD1-forward TCAACGCCTAGCTTTGCTCCAG 60 26 480
CAD1-reverse CTTGAGCAAAGCCATGCTCGTTGG
UBQ1-forward TCGTAAGTACAATCAGGATAAGATG 55 22 210
UBQ1-reverse CACTGAACAAGAACAAACCCT
Open in a new tab

Footnotes

Supplementary Material

Supplementary Figures and Tables
psb0503_0239SD1.pdf (3.9MB, pdf)

References

  • 1.Callaway RM, Aschehoug ET. Invasive plants versus their new and old neighbors: A mechanism for exotic invasion. Science. 2000;290:3–4. doi: 10.1126/science.290.5491.521. [DOI] [PubMed] [Google Scholar]
  • 2.Inderjit, Callaway RM, Vivanco JM. Plant biochemistry helps to understand invasion ecology. Trends Plant Sci. 2006;11:574–580. doi: 10.1016/j.tplants.2006.10.004. [DOI] [PubMed] [Google Scholar]
  • 3.Bais HP, Vepachedu R, Gilroy S, Callaway RM, Vivanco JM. Allelopathy and exotic plant invasion: from molecules and genes to species interactions. Science. 2003;301:1377–1380. doi: 10.1126/science.1083245. [DOI] [PubMed] [Google Scholar]
  • 4.Baldwin IT. Finally, proof of weapons of mass destruction. Sci STKE. 2003;42 doi: 10.1126/stke.2003.203.pe42. [DOI] [PubMed] [Google Scholar]
  • 5.Cappuccino N, Arnason JT. Novel chemistry of invasive exotic plants. Biol Lett. 2006;2:189–193. doi: 10.1098/rsbl.2005.0433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bais HP, Weir TL, Perry LG, Gilroy S, Vivanco JM. Role of root exudates in rhizosphere interactions with plants and other organisms. Annu Rev Plant Boil. 2006;57:233–266. doi: 10.1146/annurev.arplant.57.032905.105159. [DOI] [PubMed] [Google Scholar]
  • 7.Sakai AK, Allendorf FW, Holt JS, Lodge DM, Molofsky J, With KA, et al. The population biology of invasive species. Annu Rev Ecol Syst. 2001;32:305–332. [Google Scholar]
  • 8.Vivanco JM, Bais HP, Stermitz FR, Thelen GC, Callaway RM. Biogeographical variation in community response to root allelochemistry: novel weapons and exotic invasion. Ecol Lett. 2004;7:285–292. [Google Scholar]
  • 9.Blair AC, Hanson BD, Brunk GR, Marrs RA, Westra P, Nissen SJ, et al. New techniques and findings in the study of a candidate allelochemical implicated in invasion success. Ecol Lett. 2005;8:1039–1047. [Google Scholar]
  • 10.Blair AC, Nissen SJ, Brunk GR, Hufbauer RA. A lack of evidence for an ecological role of the putative allelochemical (±)-catechin in spotted knapweed invasion success. J Chem Ecol. 2006;32:2327–2331. doi: 10.1007/s10886-006-9168-y. [DOI] [PubMed] [Google Scholar]
  • 11.Duke SO, Blair AC, Dayan FE, Johnson RD, Meepagala KM, Cook D, et al. Is (−)-catechin a novel weapon of spotted knapweed (Centaurea stoebe)? J Chem Ecol. 2009a;35:141–153. doi: 10.1007/s10886-008-9587-z. [DOI] [PubMed] [Google Scholar]
  • 12.Duke SO, Dayan FE, Bajsa J, Johnson RD, Meepagala KM, Cook D, et al. The case against (−)-catechin involvement in allelopathy of Centaurea stoebe (spotted knapweed) Plant Signal Behav. 2009b;4:422–424. doi: 10.4161/psb.4.5.8273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Inderjit, Pollock JL, Callaway RM, Holben W. Phytotoxic effects of (±)-catechin in vitro, in soil, and in the field. PLoS ONE. 2008a;3:2536. doi: 10.1371/journal.pone.0002536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Inderjit, Seastedt TR, Callaway RM, Pollock JL, Kaur J. Allelopathy and plant invasions: traditional, congeneric and biogeographical approaches. Biol Invasions. 2008b;10:875–890. [Google Scholar]
  • 15.Perry LG, Johnson C, Alford ER, Vivanco JM, Paschke MW. Screening of grassland plants for restoration after spotted knapweed invasion. Restor Ecol. 2005;13:725–735. [Google Scholar]
  • 16.Perry LG, Thelen GC, Ridenour WM, Callaway RM, Paschke MW, Vivanco JM. Soil concentrations of the allelochemical (±)-catechin. J Chem Ecol. 2007;15:2171–2345. doi: 10.1007/s10886-007-9383-1. [DOI] [PubMed] [Google Scholar]
  • 17.Pollock JL, Callaway RM, Thelen GC, Holben WE. Catechin-metal interactions as a mechanism for conditional allelopathy by the invasive plant Centaurea maculosa. J Ecol. doi: 10.1111/j.1365-2745.2009.01553.x.
  • 18.Ridenour WM, Vivanco JM, Feng YL, Horiuchi J, Callaway RM. No evidence for trade-offs: Centaurea plants from America are better competitors and defenders. Ecol Mono. 2008;78:369–386. [Google Scholar]
  • 19.Weir TL, Bais HP, Stull VJ, Callaway RM, Thelen GC, Ridenour WM, et al. Oxalate contributes to the resistance of Gaillardia grandiflora and Lupinus sericeus to a phytotoxin produced by Centaurea maculosa. Planta. 2006;223:785–795. doi: 10.1007/s00425-005-0192-x. [DOI] [PubMed] [Google Scholar]
  • 20.Triebwasser D, Tharayil N, Callaway RM. Diurnal Rhythm of Catechin Exudation by an Invasive Plant-Spotted Knapweed (Centaurea maculosa) Weed Science Society of America Meeting. 2009 [Google Scholar]
  • 21.Prithiviraj B, Perry LG, Badri DV, Vivanco JM. Chemical facilitation and induced pathogen resistance mediated by a root-secreted phytotoxin. New Phytol. 2007;173:852–860. doi: 10.1111/j.1469-8137.2006.01964.x. [DOI] [PubMed] [Google Scholar]
  • 22.Cedergreen N, Streibig JC, Per Kudsk, Mathiassen SK, Duke SO. The occurrence of hormesis in plants and algae. Dose response. 2007;5:150–162. doi: 10.2203/dose-response.06-008.Cedergreen. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Duke SO, Cedergreen N, Velini ED, Belz RG. Hormesis: is it an important factor in herbicide use and allelopathy? Outlooks Pest Management. 2007;17:29–33. [Google Scholar]
  • 24.Calabrese EJ, Blain R. The occurrence of hormetic dose responses in the toxicological literature, the hormesis database: an overview. Toxicol Appl Pharmacol. 2005;202:289–301. doi: 10.1016/j.taap.2004.06.023. [DOI] [PubMed] [Google Scholar]
  • 25.Compant S, Duffy B, Nowak J, Clément C, Barka A. Use of plant growth-promoting bacteria for biocontrol of plant diseases: Principles, mechanisms of action, and future prospects. Appl Environ Microbiol. 2005;71:4951–4959. doi: 10.1128/AEM.71.9.4951-4959.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Rudrappa T, Czymmek KJ, Pare PW, Bais HP. Rootsecreted malic acid recruits beneficial soil bacteria. Plant Physiol. 2008;148:1547–1556. doi: 10.1104/pp.108.127613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bais HP, Venkatachalam L, Biedrzycki ML. Is (±)-catechin, a root sercreted toxin, a antioxidant or proxidant? Plant & Soil (Under Revision) 2009.
  • 28.Fukaki H, Okushima Y, Tasaka M. Auxin-mediated lateral root formation in higher plants. Int Rev Cytol. 2007;256:111–137. doi: 10.1016/S0074-7696(07)56004-3. [DOI] [PubMed] [Google Scholar]
  • 29.Morré DJ. Chemical hormesis in cell growth: A molecular target at the cell surface. J Appl Toxicol. 2000;20:157–163. [PubMed] [Google Scholar]
  • 30.Allender WJ, Cresswell GC, Kaldor J, Kennedy IR. Effect of lithium and Lanthium on herbicide induced hormesis in hydrophonically-grown cotton and corn. J Plant Nutr. 1997;20:81–95. [Google Scholar]
  • 31.Schreiber K, Ckurshumova W, Peek J, Desveaux D. A high-throughput chemical screen for resistance to Pseudomonas syringae in Arabidopsis. Plant J. 2008;54:522–531. doi: 10.1111/j.1365-313X.2008.03425.x. [DOI] [PubMed] [Google Scholar]
  • 32.Murashige T, Skoog F. A revised medium for rapid growth and bioassay with tissue culture. Physiol Plant. 1962;15:473–497. [Google Scholar]
  • 33.Harter LN. A critical value for Duncan’s new multiple range test. Biometrics. 1960;16:671–685. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures and Tables
psb0503_0239SD1.pdf (3.9MB, pdf)

Articles from Plant Signaling & Behavior are provided here courtesy of Taylor & Francis

RESOURCES