Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Jun 7.
Published in final edited form as: Mol Microbiol. 2009 Nov 25;75(1):76–91. doi: 10.1111/j.1365-2958.2009.06955.x

Pseudomonas aeruginosa OspR is an oxidative stress sensing regulator that affects pigment production, antibiotic resistance and dissemination during infection

Lefu Lan 1, Thomas S Murray 2, Barbara I Kazmierczak 3, Chuan He 1,*
PMCID: PMC2881571  NIHMSID: NIHMS197041  PMID: 19943895

Abstract

Summary

Oxidative stress is one of the main challenges bacteria must cope with during infection. Here, we identify a new oxidative stress sensing and response ospR (oxidative stress response and pigment production Regulator) gene in Pseudomonas aeruginosa. Deletion of ospR leads to a significant induction in H2O2 resistance. This effect is mediated by de-repression of PA2826, which lies immediately upstream of ospR and encodes a glutathione peroxidase. Constitutive expression of ospR alters pigment production and β-lactam resistance in P. aeruginosa via a PA2826-independent manner. We further discovered that OspR regulates additional genes involved in quorum sensing and tyrosine metabolism. These regulatory effects are redox-mediated as addition of H2O2 or cumene hydroperoxide leads to the dissociation of OspR from promoter DNA. A conserved Cys residue, Cys-24, plays the major role of oxidative stress sensing in OspR. The serine substitution mutant of Cys-24 is less susceptible to oxidation in vitro and exhibits altered pigmentation and β-lactam resistance. Lastly, we show that an ospR null mutant strain displays a greater capacity for dissemination than wild-type MPAO1 strain in a murine model of acute pneumonia. Thus, OspR is a global regulator that senses oxidative stress and regulates multiple pathways to enhance the survival of P. aeruginosa inside host.

Introduction

Pseudomonas aeruginosa is a Gram-negative bacillus that is ubiquitous in diverse environments. It is also an opportunistic pathogen of humans, most notably those afflicted with cystic fibrosis or whose immune systems have been compromised (Reynolds et al., 1975; Cross et al., 1983; Govan and Harris, 1986). Similar to many other human pathogens, P. aeruginosa must overcome the oxidative stress response generated by phagocytic cells for successful infection. Phagocytes utilize the cytotoxic effects of reactive oxygen species (ROS), such as superoxide, H2O2, and hydroxyl radical, to contain bacterial infections. In order to counter this innate immune response, P. aeruginosa possesses a multifaceted defence system against oxidative stress, with proteins such as catalase and superoxide dismutase, thioredoxin, glutaredoxin, and small molecules such as glutathione and melanin (Hassett and Cohen, 1989; Scandalios, 1997; Rodríguez-Rojas et al., 2009).

As key regulators, OxyR and SoxR have been well known to modulate oxidative stress response in bacteria (Storz and Imlay, 1999). Homologues of these two proteins have been identified in many bacterial species, including P. aeruginosa. In P. aeruginosa, OxyR is important for oxidative stress defence (Ochsner et al., 2000) and is required for full virulence in rodent and insect models of infection (Lau et al., 2005). Recently, OxyR has also been shown to regulate secretion of potent cytotoxic factors in P. aeruginosa (Melstrom et al., 2007). On the contrary, P. aeruginosa does not rely on SoxR for an oxidative stress response (Kobayashi and Tagawa, 2004; Palma et al., 2005). Instead, P. aeruginosa SoxR responds to phenazines (Dietrich et al., 2006), which act as signalling molecules in the bacterium (Dietrich et al., 2006). Phenazines produced by P. aeruginosa are colourful, redox-active antibiotics. These compounds have profound effects on the structural organization of colony biofilms (Dietrich et al., 2009) and have been identified as virulence factors in a number of in vivo model systems (Wilson et al., 1988; Mahajan-Miklos et al., 1999; Ran et al., 2003; Gibson et al., 2009). A connection between phenazine biosynthesis and oxidative stress response in P. aeruginosa is as yet unclear.

In our previous work, we showed that the MarR family transcriptional regulators MgrA and SarZ play key roles in virulence regulation in Staphylococcus aureus using an oxidation-sensing mechanism (Chen et al., 2006; 2008a). Both MgrA and SarZ are members of a subfamily of MarR proteins that utilize cysteine oxidation to sense oxidative stress and regulate bacterial responses. The prototype, OhrR in Bacillus subtilis, regulates bacterial resistance to organic hydroperoxides (Fuangthong et al., 2001; Sukchawalit et al., 2001; Mongkolsuk and Helmann, 2002; Newberry et al., 2007). However, in a pathogenic bacterium such as S. aureus, these regulators seem to play regulatory roles that have much broader and profound effects on global properties of the pathogen. These discoveries in S. aureus raise the possibility that the OhrR/MgrA homologues in pathogenic P. aeruginosa may also assume global roles through sensing oxidative stress. Here, we present a new redox-active regulator, OspR, in P. aeruginosa. This protein, using an oxidation-sensing mechanism, is involved in oxidative stress response, pigment production, β-lactam resistance and dissemination of P. aeruginosa during infection. OspR also affects expression of genes involved in tyrosine metabolism (hmgA, PA2010) and quorum sensing (phzM, phzS, PA1897). These results should help shed light on the multifaceted oxidative stress response in P. aeruginosa and contribute to understanding its role in P. aeruginosa physiology and pathogenesis.

Results

Identification of S. aureus mgrA homologous genes in P. aeruginosa

As demonstrated in our previous work, the global regulator MgrA plays a key role in virulence regulation in S. aureus using an oxidation-sensing mechanism (Chen et al., 2006). To identify the MgrA homologues in P. aeruginosa, we performed BLASTP analyses with S. aureus mgrA against the genome of P. aeruginosa PAO1. Two hits were obtained with PA2825 showing 37.59% identity to MgrA while PA2849 sharing 31.25% identity with MgrA (Fig. S1A). Pfam analysis indicated that both PA2825 and PA2849 proteins possess the MarR-type helix–turn–helix motif and as such belong to the family of MarR proteins.

Downstream of PA2849 is PA2850, and there exists a 142 bp intergenic region between PA2849 and PA2850. The encoding protein of PA2850 shows a 78% similarity to Ohr (organic hydroperoxide resistance) protein in Xanthomonas campestris pv. phaseoli. The gene encoding OhrR (transcriptional regulator, MarR family) from X. campestris pv. phaseoli is co-transcribed with its downstream adjacent gene, ohr (Panmanee et al., 2002; Klomsiri et al., 2005). Considering that numerous bacteria maintain this genetic organization of ohrR and ohr (Fuangthong et al., 2001; Sukchawalit et al., 2001; Chuchue et al., 2006), it is very likely that PA2849 is an OhrR homologue in P. aeruginosa.

According to the annotation of P. aeruginosa PAO1 genome, PA2825 is a likely transcriptional regulator gene. The coding regions of PA2825 and PA2826 (a putative glutathione peroxidase gene) overlap by four base pairs; the coding region of PA2825 starts at the fourth nucleotide before the end of PA2826 (Fig. S1B). Sequence analysis of this genetic organization in Pseudomonas species indicates that PA2825 orthologues are present in various P. aeruginosa and P. fluorescens strains but absent in P. putida, P. syringae and P. entomophila L48 strains (Fig. S2). We focused on PA2825 and named it as ospR based on observed phenotypes presented in this study.

ospR null mutant and the analysis of PA2827, PA2826 and PA2824 RNA expression

To probe the biological functions of ospR, we generated an ospR null mutant strain (ΔospR, Fig. S1B) through the method of allelic replacement as described in Experimental procedures. Further, the complementing plasmid of p-ospR (Table 1) was constructed and then transformed into ΔospR, yielding the ΔospR/p-ospR strain. Introduction of p-ospR into ΔospR provided for constitutive expression of ospR without IPTG induction (data not shown). We performed the Northern blot analysis of mRNA of the ospR neighbouring genes PA2827, PA2826 and PA2824 respectively. The Northern blot results showed that there was no significant difference in mRNA levels of PA2827 and PA2824 between the ΔospR strain (harbouring pAK1900) and the wild-type MPAO1 strain (harbouring pAK1900) (Fig. 1A). However, a significant overexpression of the PA2826 transcript was detected in the ΔospR strain as compared with the wild-type strain (Fig. 1A). Complementation with p-ospR in the ΔospR strain restored the low mRNA level of PA2826 similar to that observed in the wild-type strain (Fig. 1A). These results indicate that OspR represses expression of PA2826. Interestingly, the deletion of ospR in P. aeruginosa MPAO1 also resulted in a slight increase of the mRNA level of PA2850 (ohr) (Fig. S3A).

Table 1.

Promoters identified by consensus sequence search.

Genes Starta Enda Sequenceb
NP_250033.1|PA1342 −202 −194 tccaAATTtAATTtctt
NP_250034.1|PA1343 −258 −250 aagaAATTaAATTtgga
NP_250564.1|PA1873 −378 −370 gaaaAATTcAATTtaga
NP_250565.1|PA1874 −131 −123 tctaAATTgAATTtttc
NP_250588.1|PA1897 −247 −239 tgacAATTtAATTcgac
NP_250699.1|hmgA/PA2009 −88 −80 gcgtAATTgAATTacga
NP_250700.1|PA2010 −81 −73 tcgtAATTcAATTacgc
NP_251516.1|PA2826 −56 −48 gtgcAATTgAATTgcga
NP_252252.1|PA3562 −261 −253 tgccAATTtAATTaagt
NP_252253.1|fruR/PA3563 −75 −67 acttAATTaAATTggca
NP_254148.1|PA5461 −226 −218 gaaaAATTgAATTcctg
a

Upstream regions from the start codon.

b

Uppercase letters indicate the conserved inverted repeat.

Fig. 1.

Fig. 1

Northern blot analysis and phenotypes of P. aeruginosa strains under oxidative stresses.

A. Northern blot analysis of the transcripts of PA2827 PA2826 and PA2824. Total cellular RNA samples were obtained at log phase (the overnight culture was diluted 100-fold in fresh media and incubated at 37°C for 2.5–3 h until the culture reached OD600 = 1.2–1.5). The coding region of each gene was polymerase chain reaction (PCR) amplified and radiolabelled with 32P-dCTP as probes. All genes were tested with the same RNA samples. Five micrograms of total cellular RNA was used in each experiment with the ethidium bromide-stained gel picture of the loaded RNA sample shown below each lane. 1: MPAO1/pAK1900; 2: ΔospR/pAK1900; 3: ΔospR/p-ospR.

B and C. The ospR null mutant strains show increased resistance to H2O2(B) and sensitivity to paraquat (PQ) (C) compared with wild-type MPAO1 strains (harbouring pAK1900) and ΔospR/p-ospR strains. P. aeruginosa strains were grown on LB agar plates with or without H2O2 (1 mM) at 37°C for 24 h (B). P. aeruginosa strains were grown on LB agar plates with or without paraquat (0.1 mM) at 37°C for 48 h (C).

D. The constitutive expression of PA2826 enhances P. aeruginosa MPAO1 growth on LB agar plates containing H2O2 (1 mM) but reduces P. aeruginosa MPAO1 growth on LB agar plates supplied with paraquat (PQ) (0.1 mM). P. aeruginosa strains were grown at 37°C for 24 h. All experiments were repeated several times and similar results were obtained.

OspR contributes to oxidative stress response through regulation of PA2826

Deletion of ospR in P. aeruginosa leads to de-repression of PA2826, a gene encoding a glutathione peroxidase (GPx) protein based on the annotation of the P. aeruginosa PAO1 genome and sequence analysis. The main biological role of glutathione peroxidase is to protect the organism from oxidative damage. In order to assess whether ospR plays a role in bacterial response to oxidative stress, we tested the sensitivity of the ΔospR strain to H2O2 and paraquat by using stress plate assay as described in Experimental procedures. From the assay ΔospR strain exhibited an increased resistance to H2O2 (Fig. 1B and Table S1), but showed a hypersensitivity to paraquat when compared with the wild-type MPAO1 strain (Fig. 1C). These phenotypes could be complemented by the introduction of p-ospR (Fig. 1B and C, and Table S1).

To examine whether the altered resistance/sensitivity to H2O2/paraquat is due to the overexpression of PA2826 in the ΔospR strain, a plasmid for constitutive expression of PA2826 (p-PA2826) was constructed and then transformed to the wild-type strain. Additional stress plate assays were performed and results are shown in Fig. 1D. The MPAO1/p-PA2826 strain displayed an increased resistance to H2O2, and an increased sensitivity to paraquat when compared with the control strain MPAO1/pAK1900. The increase of H2O2 resistance is more evident in a strain overexpressing PA2826 (p-PA2826) than the ospR mutant strain (Fig. 1 and Table S1). This phenotype correlates with the transcription levels of PA2826 in these stains as shown by Northern blot analysis (Fig. S3).

To further demonstrate that PA2826 mediates the altered resistance/sensitivity to H2O2/paraquat, we generated a PA2826-ospR null mutant strain (ΔPA2826-ospR), as described in Experimental procedures. Stress plate assay indicated no significant difference in resistance/sensitivity to H2O2/paraquat between the ΔPA2826-ospR strain and the wild-type MPAO1 strain. Moreover, the introduction of p-PA2826 to the ΔPA2826-ospR strain led to increased resistance to H2O2 and increased sensitivity to paraquat when compared with the ΔPA2826-ospR strain harbouring pAK1900 (Fig. S4). These results showed that OspR contributes to the oxidative stress response of P. aeruginosa and this process is mediated through PA2826.

PA2826 encodes a glutathione peroxidase (GPx) that catalyses the reduction of hydroperoxides, including H2O2, by using glutathione, and functions to protect bacterial cells from oxidative damage. To examine this role, we measured the redox state of the GSH/glutathione disulphide (GSSG) couple in MPAO1/pAK1900, ΔospR/pAK1900, ΔospR/p-ospR and MPAO1/p-PA2826 strains, respectively, when bacteria were grown to an early stationary phase (OD600 = 2.2–2.3). As a result, ΔospR/p-ospR displayed a similar GSH/GSSG ratio as that of wild-type MPAO1/pAK1900. However, both ΔospR/pAK1900 and MPAO1/p-PA2826 exhibited a 1.7-fold and 5.5-fold higher intracellular GSH/GSSG ratio compared with that of the wild-type strain.

OspR physically binds to the promoter of ospR-PA2826

Genetic evidence indicates that OspR regulates the expression of PA2826 (Fig. 1A). In order to probe the putative OspR binding site, we examined the PA2827–PA2826 intergenic region. An AT-rich inverted repeat sequence, 5′-ttcaatcaagttgtgtgcAATTgAATTgcgagctactt tattt-3′ (B2, uppercase letters indicate the conserved inverted repeat), was found (Fig. 2A). It is well known that the MarR family proteins specifically bind palindromic or pseudopalindromic sites using conserved winged helix fold (Wilkinson and Grove, 2006; Newberry et al., 2007). The inverted repeat overlaps the core promoter elements for PA2826 (Fig. 2A). The direct interaction of OspR with PA2826 promoter was tested by gel mobility shift assay using purified 6His-OspR and a 43 bp DNA fragment (B2) containing the putative OspR binding site. As shown in Fig. 2B, OspR bound to the 43 bp PA2826 promoter sequence in the presence of non-specific salmon sperm DNA, while failed to shift a 43 bp DNA fragment (B1: 5′-agagcgacgacccgtctttggttcgggtcgtttttcattcaat-3′, Fig. 2A) of the Rho-independent terminator sequence as a control (data not shown).

Fig. 2.

Fig. 2

The proposed OspR binding site, gel shift assay and Northern blot analysis.

A. The PA2826–PA2827 intergenic region. The putative −35 and −10 elements are underlined and arrows show the palindromic putative OspR-binding sequence. A putative Rho-independent terminator is also indicated.

B. A gel shift experiment showing binding of 6His-OspR to this promoter DNA.

C. Northern blots analysis of the transcripts of ospR PA2826 in P. aeruginosa MPAO1 strains untreated and/or treated with H2O2.

D. Northern blots analysis of the transcripts of PA2826 in P. aeruginosa MPAO1 strains untreated and/or treated with paraquat. The overnight culture was diluted 100-fold in fresh media and incubated at 37°C for 2.5–3 h until the culture reached OD600 = 1.2–1.5 before treatment with H2O2 or paraquat.

E. Electrophoretic mobility shift assay showing the effect of oxidation on the DNA binding of purified OspR. A gel shift experiment showed binding of 6His-OspR to this promoter DNA. Addition of H2O2 (0.5 mM) or CHP (32 mM) led to dissociation of 6His-OspR from this promoter DNA. When indicated, 1 mM DTT was added after incubation of the protein with oxidants for 30 min, and the mixture was incubated for an additional 30 min at room temperature before samples were run on the gel; 300 nM 6His-OspR was used in each reaction.

Oxidation regulation of ospR and PA2826

We have shown that OspR contributes to bacterial oxidative stress response through regulating the expression of PA2826. To further assess whether ospR responds to oxidative stress, we treated P. aeruginosa MPAO1 (log phase, OD600 = 1.2–1.5) with different amounts of H2O2 for 10 min. Subsequently, the bacterial cells were harvested and the total RNAs were isolated. Northern blot analysis showed elevated transcripts of PA2826 and ospR when the wide-type bacterial cells were treated with H2O2 as compared with the untreated bacteria (Fig. 2C). The transcription enhancements of PA2826 and ospR are positively correlated with the concentrations of H2O2 applied to the bacterium. Increased transcriptions of PA2826 mRNA were also observed when P. aeruginosa MPAO1 was treated with paraquat. As shown in Fig. 2D, the expression of PA2826 is significantly induced by 0.05 µM paraquat in Luria–Bertani (LB) medium; however, unlike the situation with H2O2, higher concentrations of paraquat failed to further induce the expression of PA2826. We currently do not have an explanation for this observation with the paraquat treatment. Since increased transcription of PA2826 is also detected in the ΔospR strain (Fig. 1A), it is reasonable to suggest that OspR represses PA2826-ospR, and oxidation with H2O2 leads to dissociation of OspR from the promoter DNA and de-repression of PA2826 in P. aeruginosa. To confirm this hypothesis, we performed gel mobility shift assay with 6His-OspR and the same 43 bp promoter DNA fragment (B2) used in Fig. 2B. Addition of H2O2 or cumene hydroperoxide (CHP) led to dissociation of OspR from the DNA (Fig. 2E). In addition, the binding of OspR to the promoter DNA could be restored by the addition of excess reducing agent (DTT) (Fig. 2E).

OspR affects pigment production in P. aeruginosa

Unexpectedly, the introduction of p-ospR into ΔospR in the complementary experiments described above also led to the production of dark red, water-soluble pigments when bacterial cells were grown on the LB agar plate (Fig. 3A). We were intrigued by this observation which suggests that OspR may have a broader role of regulation. We introduced p-ospR into the wild-type MPAO1 strain (MPAO1/p-ospR). MPAO1/p-ospR displayed the same dark red pigmentation on the LB agar plate (Fig. 3B) as observed with ΔospR/p-ospR. This phenotype is independent of PA2826 as MPAO1/p-PA2826 exhibits the wild-type pigmentation (Fig. 3B), and ΔPA2826-ospR/pAK1900 and ΔPA2826-ospR/p-PA2826 show the same normal pigmentation as MPAO1/pAK1900 while ΔPA2826-ospR/p-ospR displays the dark red pigment like the strain with constitutive expression of ospR when grown on the LB plate (Fig. S5A).

Fig. 3.

Fig. 3

Constitutive expression of ospR in P. aeruginosa.

A. Phenotype of MPAO1/pAK1900 strains, ΔospR/pAK1900 and ΔospR/p-ospR strains grown on LB agar plate at 37°C for 24 h.

B. Phenotype of MPAO1/pAK1900 strains, MPAO1/p-PA2826 and MPAO1/p-ospR strains grown on LB agar plates at 37°C for 20 h.

C. Northern blot of phzS and phzM showing that constitutive expression of ospR decreased the expression of these two phenazine-modifying genes. The overnight culture was diluted 1000-fold and 50 µl of dilution was plated on LB agar plate. Bacteria were harvested after incubating at 37°C for 24 h and then subjected to total RNA isolation. 1: MPAO1/pAK1900; 2: MPAO1/p-ospR.

D. Northern blot of phzS and phzM. The overnight culture was diluted 100-fold in fresh LB medium. Bacteria were harvested after incubating at 37°C for 9 h (OD600 = 2.5) and then subjected to total RNA isolation. 1: MPAO1/pAK1900; 2: ΔospR/pAK1900; 3: ΔospR/p-ospR.

E. The constitutive expression of ospR enhances growth of P. aeruginosa MPAO1 strain on LB agar plate containing cefotaxime (2.5 µg ml−1). The plates were incubated at 37°C for 48 h. All experiments were repeated multiple times with similar results obtained.

A previous study with mutation of two P. aeruginosa phenazine-modifying genes, phzM and phzS, led to accumulation of yellow and dark red phenazines (Mavrodi et al., 2001). To examine whether ospR affects the expression of these two P. aeruginosa phenazine-modifying genes, we performed the Northern blot analysis of mRNAs of phzM and phzS. As shown in Fig. 3C, the constitutive expression of ospR severely reduces the expression of both phzM and phzS in the MPAO1 strain. Consistent with this, the mRNA levels of phzM and phzS (Fig. 3D) were increased in the ΔospR strain while further reduced in the ΔospR strain complemented with p-ospR as compared with the wild-type strain (Fig. 3D).

Overexpression of OspR affects P. aeruginosa β-lactam resistance

The OhrR/MgrA family proteins are known to control oxidative stress response, bacterial virulence and antibiotic resistance (Fuangthong et al., 2001; Sukchawalit et al., 2001; Chen et al., 2006; 2008b). To assess whether OspR contributes to drug resistance in P. aeruginosa, we examined bacterial growth on TSA plates supplied with chloramphenicol, ciprofloxacin and cefotaxime respectively. Results showed that ΔospR did not exhibit noticeable difference from the wild-type strain (data not shown) while MPAO1/p-ospR displayed higher resistance to cefotaxime (Fig. 3E) and ceftazidime (data not shown) when compared with the wild-type strain. This cefotaxime resistance phenotype is not mediated through PA2826 as ΔPA2826-ospR/p-ospR showed the same resistance to cefotaxime as MPAO1/p-ospR (data not shown), and ΔPA2826-ospR/p-ospR displays enhanced resistance to cefotaxime when compared with ΔPA2826-ospR/pAK1900 (Fig. S5B).

Cys-24 as a key functional residue in OspR

OspR harbours two cysteine residues, Cys-24 and Cys-134 (Fig. S1). To investigate the contributions of these two residues to the function of OspR, each residue was mutated to serine. The ospR C24S mutant (in pAK1900, p-ospRC24S), ospR C134S mutant (in pAK1900, p-ospRC134S) and ospR C24S/C134S double mutant (in pAK1900, p-ospRC24SC134S) were prepared and introduced into the wild-type MPAO1 strain respectively. The introduction of p-ospRC24S, p-ospRC134S or p-ospRC24SC134S into the wild-type MPAO1 strain led to the production of the dark red, water-soluble pigments, a phenotype similar to that observed in MPAO1/p-ospR when bacteria were grown on LB agar plate (Fig. S6). In liquid culture, the MPAO1/p-ospR strain displayed the usual blue-green pigmentation (Fig. 4A). However, both MPAO1/p-ospRC24S and MPAO1/p-ospRC24SC134S strains exhibited dark red pigmentation, while a yellow-green pigmentation was observed for the MPAO1/p-ospRC134S strain grown in LB liquid (Fig. 4A). This observation indicates that Cys-24 plays the key role in the regulatory function of OspR. We further examined β-lactam resistance of the two cysteine mutant strains. As shown in Fig. 4B, both OspR C24S mutant and OspR C24SC134S mutant strains showed enhanced β-lactam resistance but OspR C134S mutant showed normal sensitivity to β-lactam as the control strain (MPAO1/p-ospR).

Fig. 4.

Fig. 4

Phenotypes of P. aeruginosa strains and Northern blot assay.

A. The overnight culture was diluted 100-fold in fresh LB medium and then incubated at 37°C for 16 h with shaking at 250 r.p.m. C24S: MPAO1/p-ospRC24S; C134S: MPAO1/p-ospRC134S; C24SC134S: MPAO1/p-ospRC24SC134S.

B. P. aeruginosa MPAO1 strain grown on LB agar plate containing cefotaxime (2.5 µg ml−1) incubated at 37°C for 48 h.

C and D. Northern blot analysis of the transcripts of PA2826 and ohr (PA2850) in the P. aeruginosa MPAO1, ΔospR/p-ospR and ΔospR/p-ospRC24S strains treated with or without H2O2. The overnight culture was diluted 100-fold in fresh media and incubated at 37°C for 2.5–3 h until the culture reached OD600 = 1.2–1.5 before treatment with H2O2 for 10 min.

To further investigate the role of Cys-24 in the regulatory function of OspR, we introduced p-ospRC24S into the ospR mutant strain and performed Northern blot analysis of transcripts of PA2826 and PA2850 (ohr). As shown in Fig. 4C, elevated transcriptions of PA2826 and ohr were observed when the wide-type bacterial cells were treated with H2O2 as compared with the untreated bacteria, and this observation is consistent with previous transcriptional profiling result (Palma et al., 2004). There was no significant increase of the mRNA level of PA2826 in the ΔospR/p-ospR strain treated with H2O2 as compared with the untreated bacteria; however, a decrease of the mRNA level of PA2826 was observed in the ΔospR/p-ospRC24S strain treated with H2O2 compared with that of the untreated bacteria (Fig. 4D). Interestingly, an increase of ohr transcription was observed in the ΔospR/p-ospRC24S strain treated with H2O2, but to a much less extent as compared with those of the ΔospR/p-ospR and the wild-type strains treated with H2O2 (Fig. 4D). Thus, OspR also affects ohr and Cys-24 plays a major role in the regulatory function of OspR.

Next, we purified 6His-OspR C24S mutant protein and tested its interaction with the PA2826 promoter (43 bpDNA fragment, B2) using gel mobility shift assay. This mutant protein binds the promoter DNA tighter than the wild-type OspR (Fig. 5A). Importantly, treatment with either H2O2 or CHP failed to dissociate OspRC24S from the 43 bp DNA fragment (B2) (Fig. 5B), indicating that Cys-24 is the key residue involved in the oxidant sensing. Not surprisingly, Cys-24 is the conserved cysteine used for oxidant sensing in MgrA, SarZ and OhrR (Fuangthong et al., 2001; Sukchawalit et al., 2001; Chen et al., 2006; 2008a). Residues that form the hydrogen-bonding network (Tyr) with the redox-active cysteine and the nearby hydrophobic pocket (Tyr/Phe) are also conserved in OspR (Fig. S1).

Fig. 5.

Fig. 5

Gel shift assay and oxidation of Cys-24 in vitro.

A. A gel shift experiment showing binding of 6His-OspRC24S to the PA2825 promoter DNA.

B. Addition of H2O2 or CHP failed to dissociate 6His-OspRC24S from the PA2825 promoter DNA; 300 nM 6His-OspRC24S was used in each reaction except for lane 1.

C. Disulphide bond formation in OspR as monitored by non-reducing SDS-PAGE. Protein samples were treated with or without CHP for 10 min prior to analysis, as described in Experimental procedures. When indicated, 50 mM DTT was added before samples were run on SDS-PAGE. The first lane in the panel contains molecular mass standards corresponding to 15, 25, 32, 50 and 75 kDa (bottom to top).

D. Cys-24-sulphenic acid formation in vitro through oxidation with four equivalents (per OspRC134S monomer) of CHP as indicated by the NBD-Cl assay. Cys-S(O)-NBD absorbs at 347 nm.

Cysteine oxidation in OspR

Our next step was to confirm the redox activity of Cys-24 in OspR. We performed experiments to detect the potential formation of Cys-24-SOH in the wild-type OspR following CHP treatment by using NBD chloride (Chen et al., 2006; 2008a; Panmanee et al., 2006). However, this assay failed to yield an R-S(O)-NBD derivative in the CHP-oxidized OspR (data not shown). We suspected that this could be due to a rapid reaction of the generated sulphenic acid intermediate (R-SOH) with the second Cys residue, Cys-134, in OspR. We used non-reducing sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) gel to investigate whether intermonomer disulphides are formed in the oxidized OspR and OspRC24S in vitro (Panmanee et al., 2006; Chen et al., 2008a). Indeed, upon CHP treatment, OspR was oxidized to give a covalent dimer (Fig. 5C). Treatment with DTT prior to electrophoresis converted the oxidized protein back to its monomeric form, indicating a disulphide linkage between the two monomers in the oxidized OspR (Fig. 5C). We note that two distinct bands appeared in the size range corresponding to dimeric OspR (Fig. 5C). Formation of the lower dimeric protein band was dependent on the addition of the oxidant and the presence of Cys-24, while formation of the upper band did not require the presence of Cys-24 (Fig. 5C). The upper dimeric protein band could be a single-disulphide cross-link between two Cys-134 residues in the two monomers, whereas the lower dimeric band is doubly cross-linked OspR between Cys-24 from one monomer and Cys-134 from the other monomer (Soonsanga et al., 2008). To test if Cys-24-SOH is produced upon oxidation and subsequently trapped by Cys-134, the NBD chloride trapping experiment was repeated using CHP-oxidized OspRC134S. The UV-visible absorbance spectrum of NBD-labelled, oxidized OspRC134S exhibited a maximal absorbance at 347 nm, indicating formation of a sulphenic acid species in the oxidized OspRC134S protein (Fig. 5D).

OspR binds the PA2009–PA2010 intergenic region and the promoter region of PA1897

Six additional potential OspR binding targets (Table 1), corresponding to the promoter regions of 10 genes, were identified by a search in the P. aeruginosa genome sequence for the putative conserved OspR binding motif (AATTnAATT) located upstream (−1 bp to −400 bp) of the coding region by using RAST (http://rsat.ulb.ac.be/rsat/index.html). Interestingly, the promoter region of PA1897 and the hmgA(PA2009)–PA2010 intergenic region were found as a potential binding site for OspR (Table 1 and Fig. S7). While PA1897 is a quorum-sensing-regulated gene, hmgA encodes an enzyme homogentisate-1,2-dioxygenase involved in tyrosine metabolism. Mutation of hmgA yielded strains with the hyperproduction of a dark-brown pyomelanin pigment in various Pseudomonas species including P. aeruginosa, P. chlororaphis O6 and P. putida (Arias-Barrau et al., 2004; Kang et al., 2008; Rodríguez-Rojas et al., 2009). An adjacent but oppositely transcribed gene PA2010 (hmgR) was proposed to encode a regulator that induces hmgA expression when homogentisate is present (Arias-Barrau et al., 2004). We tested whether OspR binds to these two promoter regions using gel mobility shift assays. As shown in Fig. 6A, OspR could shift the 70 bp hmgA(PA2009)–PA2010 intergenic region sequence (hmgA-p: 5′-tggcacgctggctgcgttatt tttatcgtAATTcAATTacgcataacgtaatttgagtggaaggcagcgt-3′) (uppercase letters indicate the conserved inverted repeat), and the 70 bp PA1897 promoter sequence (PA1897-p: 5′-ggcaggttgtccctgccgggctgtgacAATTtAATTc gaccaggcatttcattgtccgtgccgattttca-3′) (uppercase letters indicate the conserved inverted repeat), respectively, while OspR failed to shift a 43 bp control DNA fragment (B2). To test whether the AATTnAATT direct repeat is required for the binding of OspR to the B2 DNA fragment, we performed the gel shift assay using a 34 bp B2d DNA fragment (B2 lacking AATTnAATT, 5′-ttcaatcaagttgtgtg cgcgagctactttattt-3′) and B2 DNA fragment as a control. As shown in Fig. 6B, OspR failed to bind to B2d DNA lacking the AT-rich repeat. Interestingly, the AT-rich inverted repeat sequence, 5′-AATTnAATT-3′, is similar to the putative OhrR box sequence thought to be involved in the binding of OhrR to the target promoters in B. subtilis (Fuangthong et al., 2001), X. campestris (Sukchawalit et al., 2001) and Agrobacterium tumefaciens (Chuchue et al., 2006). The role of this AATTnAATT motif in regulation awaits further study.

Fig. 6.

Fig. 6

Electrophoretic mobility shift assay and Northern blot analysis.

A. Purified wild-type OspR could bind radiolabelled nucleotide containing PA2009–PA2010 intergenic region and PA1897 promoter region respectively (see Experimental procedures).

B. Electrophoretic mobility shift assay showing that the putative OspR binding site (AATTnAATT) is required for the binding of OspR to the PA2826 promoter sequence (B2).

C. Northern blot analysis for hmgA PA2010 and PA1897. The overnight culture was diluted 100-fold in fresh LB medium. Bacteria were harvested after incubating at 37°C for 9 h (OD600 = 2.5) and then subjected to total RNA isolation. 1: MPAO1/pAK1900; 2: ΔospR/pAK1900; 3: ΔospR/p-ospR.

To further examine if ospR affects the expression of PA1897, hmgA and PA2010, we performed the Northern blot analysis of mRNAs of these three genes in MAPO1 (harbouring pAK1900), ΔospR (harbouring pAK1900) and ΔospR/p-ospR respectively. The result showed that deletion of ospR led to increased expression of PA1897 while decreased expression of hmgA and PA2010 as compared with those of the wild-type strain when bacteria were grown in early stationary phase (OD600 = 2.5). Complementation with p-ospR in ΔospR restored the mRNA levels of hmgA, PA2010 and PA1897 to normal levels observed in the wild-type MPAO1 strain (Fig. 6C).

Virulence phenotypes in animal experiments

The in vitro results presented above suggest that ospR plays global roles in oxidative stress response, pigment production and antibiotic resistance. We tested whether ospR also impacts the virulence in a mouse model of acute pneumonia. C57BL/6 mice were infected intranasally with approximately 1 × 107 wild-type bacteria (MPAO1/pAK1900), ospR null mutant bacteria (ΔospR/pAK1900) or ospR null mutant bacteria expressing ospR in pAK1900 (ΔospR/p-ospR). Figure 7 shows the ratio of bacteria recovered from the lungs and spleens relative to the initial inoculum at 18 h post infection, with geometric means indicated for each group. In this assay, the wild-type MPAO1/pAK1900 was recovered in numbers approximately at 0.008% and 0.00001% of initial inoculum dose from lungs and spleens respectively. In marked contrast, ΔospR/pAK1900 bacteria were recovered in numbers equal to approximately 0.08% of the inoculum dose from lungs and 0.0005% of the inoculum dose from spleens. These differences achieve statistical significance. Further, bacteria of the complementary strain (ΔospR/p-ospR) were recovered from lungs or spleens with a similar recovery ratio to that of the wild-type MPAO1/pAK1900 strain. These results indicate that ospR has an impact on the capacity for dissemination in this model. Mutation of ospR leads to an increased bacterial virulence.

Fig. 7.

Fig. 7

Recovery of P. aeruginosa derivatives in a mouse model of acute pneumonia. Lightly anaesthetized 8-week-old female C57BL/6 mice were infected with approximately 2 × 107 cfu (colony-forming units) of each bacterial strain. The mice were euthanized 18 h post infection, and the lungs and spleens were each removed, homogenized and re-suspended in PBS plus 0.1% Triton X. Serial dilutions of organ suspensions were plated on Vogel-Bonner minimal medium to determine cfu per organ. Results are expressed as the ratio of cfu recovered per organ (output) to cfu present in the initial inoculum (input) and represent results from n = 7–10 mice per strain; the line shows the geometric mean for each group. The Mann–Whitney test was used to calculate P-values (two-tailed). 1: MPAO1/pAK1900; 2: ΔospR/pAK1900; 3: ΔospR/p-ospR.

Discussion

Reactive oxygen species were originally considered to be exclusively detrimental to cells; however, redox regulation involving ROS is now recognized as a vital component to cellular signalling and regulation (Scandalios, 1997; Imlay, 2008; Poole and Nelson, 2008). In this study, we identified a new gene, ospR, which encodes a MarR family protein in P. aeruginosa. OspR is a functional homologue of the bacterial OhrR/MgrA family oxidative stress sensing and regulatory proteins. OspR binds to the promoter of PA2826, which encodes a glutathione peroxidase, and represses the expression of PA2826 and likely itself. Additional sites (hmgA–PA2010 intergenic region and PA1897 promoter region) in the P. aeruginosa genome may be recognized by OspR. OspR may bind to some of these sites and exert regulatory functions. It is still unclear if OspR can act as a direct transcriptional activator. A cysteine residue, Cys-24, is used by OspR to sense potential oxidative stress and regulates bacterial response. Oxidation of Cys-24 in OspR leads to the dissociation of the protein from promoter DNA. OspR is also involved in pigment production, impacts β-lactam resistance and affects dissemination during infection. Thus, it is a global regulator that controls multiple pathways in P. aeruginosa.

Orthologues of ospR are present in various P. aeruginosa and P. fluorescens strains while absent in some other Pseudomonas species such as P. putida, P. syringae and P. entomophila L48. This gene in P. aeruginosa and P. fluorescens may help to provide an optimal response to the altered redox environment for these bacteria. This response seems to be partially mediated through regulation of PA2826, a glutathione peroxidase. GPx is an enzyme that removes H2O2 with the oxidation of glutathione. Glutathione reductase recycles glutathione for further H2O2 removal (Miller and Britigan, 1997). Thus, it is not surprising that either de-repression of PA2826 in ΔospR or constitutive expression of PA2826 in the wild-type MPAO1 increases the bacterial resistance to H2O2.

Unexpectedly, constitutive expression of PA2826 led to a higher intracellular GSH/GSSG ratio and a reduction in bacterial paraquat resistance. The mechanism underlying these observations is currently unknown. Perhaps, the higher intracellular GSH/GSSG ratio is caused by a compensation pathway induced by overexpression of PA2826, as proposed in Fig. 8. It has been reported that a P. aeruginosa zwf mutant shows an increased sensitivity to paraquat and it is believed that the NADPH level is essential in defending against paraquat toxicity (Ma et al., 1998). The zwf gene encodes glucose-6-phosphate dehydrogenase (G6PDH), an enzyme that catalyses the conversion of glucose-6-phosphate to 6-phosphogluconate while producing NADPH (Ma et al., 1998). Depletion of NADPH via glutathione reductase-catalysed production of GSH may explain the higher sensitivity of the ΔospR strain towards paraquat. This hypothesis needs to be further tested experimentally in the future.

Fig. 8.

Fig. 8

Proposed function of ospR in P. aeruginosa MPAO1. In P. aeruginosa, OspR senses oxidative stress and regulates the intracellular redox state through de-repression of PA2826. OspR also affects phenazine biosynthesis and β-lactam resistance in P. aeruginosa through pathways independent of PA2826. GSH, glutathione; GSSG, glutathione disulphide; NADP, nicotinamide adenine dinucleotide phosphate.

Distinct from OhrR, OspR plays multiple regulatory roles as a transcriptional regulator in addition to protection against oxidative stress, as evidenced by the effects of ospR on pigment production and β-lactam resistance in a PA2826-independent manner. OspR is not required for β-lactam resistance in P. aeruginosa, considering that ospR mutant showed no increased sensitivity to cefotaxime or ceftazidime compared with the wild-type MPAO1 strain. However, enhanced expression or activation of OspR may contribute to the increased β-lactam resistance in P. aeruginosa. How OspR impacts β-lactam resistance is unclear and awaits further study. PA1874, a potential OspR-regulated gene (Table 1), has been reported to associate with antibiotic resistance in P. aeruginosa (Zhang and Mah, 2008).

Pseudomonas species are well known to produce multiple-coloured phenazine pigments. These molecules can undergo redox cycling to produce toxic superoxide and H2O2, and play roles in bacterial virulence and redox balance (Price-Whelan et al., 2006). OspR affects the expression of two phenazine-modifying genes, phzM and phzS, indicating that OspR impacts on phenazine biosynthesis or modification (Fig. 3). Interestingly, the MPAO1/p-ospR strains exhibit the dark red pigmentation on agar plates while it shows a normal blue-green pigmentation in liquid culture (Fig 3 and Fig 4). The pathways underlying this observation are still unknown. P. aeruginosa produces several pigmented chemicals in addition to phenazine and the final colour is the combination of these pigments. We found that OspR binds to the promoter region of hmgA and affected its expression. The hmgA gene has recently been shown to be involved in pyomelanin pigment (dark-brown) production (Rodríguez-Rojas et al., 2009). This pathway could contribute to the observed pigment phenotypes.

The regulations of pigment production and quorum-sensing-regulated genes by OspR are unique observations for the OhrR/MgrA family redox-active regulatory proteins. Aside from regulating the expression of phzM and phzS (Fig. 3), two well-known quorum-sensing-regulated genes (Wagner et al., 2006), OspR also binds to the promoter of PA1897 and exerts a regulatory function (Fig. 6). PA1897 is a quorum-sensing-regulated gene controlled by QscR, which is a modulator of quorum-sensing signal synthesis and virulence (Chugani et al., 2001; Lee et al., 2006). It has been known that P. aeruginosa quorum sensing controls expression of catalase and superoxide dismutase genes (Hassett et al., 1999). Our results reveal additional links between oxidative response and quorum sensing through OspR in P. aeruginosa.

The chronic lung infection in cystic fibrosis (CF) patients is a state of chronic oxidative stress (Wood et al., 2001; Lagrange-Puget et al., 2004). In CF P. aeruginosa infections, bacteria routinely reach very high densities within the respiratory secretions [108 to 1010 colony-forming units (cfu) ml−1] (Hoiby, 1998) and their infections are thought to involve co-ordinated bacterial activities facilitated by quorum sensing systems (Wagner and Iglewski, 2008; Willcox et al., 2008; Winstanley and Fothergill, 2009). The cross-talk between oxidative stress and quorum sensing system revealed in this study may co-ordinate various pathways in P. aeruginosa to cope with changes in the host environment.

There are two subfamilies of OhrR type redox-active regulatory proteins (Panmanee et al., 2006; Soonsanga et al., 2008). The 1-Cys type OhrR proteins sense peroxides by formation of a sulphenic acid intermediate that may further react with intracellular small molecule thiols to give a mixed disulphide. The 2-Cys type proteins sense peroxides by forming intermonomer disulphides. OspR belongs to the 2-Cys class as indicated in Fig. 5C. Cys-24 is a key residue involved in pigment production, drug resistance, and expression of oxidative stress-related genes such as PA2826 and ohr in OspR (Fig. 4). Our data indicate that Cys-24 is likely oxidized first, and the resulting sulphenic intermediate is trapped by Cys-134 to form an intermonomer disulphide. Unexpectedly, although H2O2 induced the transcription of PA2826 in the wild-type MPAO1 strain, it failed to induce the expression of PA2826 in the complementation strain (ΔospR/p-ospR) in our study (Fig. 4D). It is likely that the constitutive expression of OspR in ΔospR/p-ospR yielded a large excess of OspR which compromised its redox-sensitive regulation of PA2826 when bacteria were treated with H2O2.

Lastly, the ΔospR strain shows enhanced dissemination in a murine model of acute pneumonia (Fig. 7). The de-repression of PA2826 (Fig. 1), and the enhanced expression of phzS and phzM (Fig. 3) may contribute to increased bacterial virulence observed for this strain, considering that de-repression of PA2826 leads to increased resistance to H2O2 (Fig. 2) while phzS and phzM are required for full virulence of P. aeruginosa in murine lungs (Lau et al., 2004a,b). In addition, the downregulation of hmgA in ΔospR (Fig. 6C) may help bacteria adapt to immune systems since disruption of hmgA leads to higher resistance to oxidative stress and increased persistence in chronic lung infections (Rodríguez-Rojas et al., 2009). All of these pathways intersect at OspR, showing a connection between oxidative stress response and dissemination in pathogenic P. aeruginosa. These results also suggest that exposure to certain levels of oxidative stress may switch on defensive pathways in P. aeruginosa, thus rendering the bacterium more resistant to killing by immune cells. Similarly, it has been shown that nitric oxide-mediated activation of bacterial defence is important for the in vivo virulence of Bacillus anthracis (Shatalin et al., 2008). An interesting avenue for future research therefore would be to identify genes targeted by OspR in a genome scale, which should help to shed light on the role of oxidative stress response in P. aeruginosa physiology and pathogenesis.

Experimental procedures

Bacterial strains and growth conditions

Pseudomonas aeruginosa and Escherichia coli strains were maintained in LB medium. All P. aeruginosa and E. coli strains used in this study are listed in Table 2. For plasmid maintenance in E. coli, the medium was supplemented with 100 µg ml−1 ampicillin, 10 µg ml−1 tetracycline or 15 µg ml−1 gentamicin. For marker selection in P. aeruginosa, 100 µg ml−1 tetracycline or 30 µg ml−1 gentamicin was used, as appropriate.

Table 2.

Bacterial strains and plasmids used in this study.

Plasmids or strains Genetype, relevant characteristics Source
Plasmids
    pET28a T7 lac promoter–operator, N-terminal His tag, kanr Novagen
    pAK1900 E. coli–P. aeruginosa shuttle cloning vector, Apr Cbr Jansons et al. (1994)
    pJQ200mp18 Gene replacement vector, mob+sacB, Gmr Quandt and Hynes (1993)
    pEX18Ap Gene replacement vector, mob+sacB, Apr Hoang et al. (1998)
    pPS858 pBR322 derivative carrying a FRT-Gm cassette, Apr Hoang et al. (1998)
    p-ospR PAk 1900 derivative carrying ospR(PA2825) on a c. 0.9 kb HindIII/BamHI
    fragment in same orientation as plac
This study
    p-ospRC24S p-ospR derivative carrying serine substitution mutant at the site C24 This study
    p-ospRC134S p-ospR derivative carrying serine substitution mutant at the site C134 This study
    p-ospRC24SC134S p-ospR derivative carrying serine substitution mutant at the site C24 and
    C134
This study
    p-PA2826 PAk 1900 derivative carrying PA2826 on a c. 0.7 kb HindIII/BamHI fragment in
    same orientation as plac
This study
    pET28a–His-ospR pET28a derivative carrying ospR(PA2825) This study
    pET28a–His-ospRC24S pET28a derivative carrying ospR(PA2825) which has serine substitution
    mutant at the site C24
This study
    pET28a–His-ospRC134S pET28a derivative carrying ospR(PA2825) which has serine substitution
    mutant at the site C134
This sduty
    pJQ200mp18∷2825UTD pJQ200mp18 derivative, for replacing MPAO1 ospR(PA2825) gene with a
    tetracycline resistance cassette
This study
    pEX18Ap∷26-25UGD pEX18Ap derivative, for replacing MPAO1 PA2826–2825 locus with a
    gentamicin resistance cassette
This study
Strains
    Pseudomonas aeruginosa
        MPAO1 Wild type Jacobs et al. (2003)
        ΔospR PA-MgrA∷Tetr; MPAO1 derivative with a tetracycline resistance cassette
    replaced the ospR(PA2825) gene
This study
        ΔPA2826-ospR PA2826-ospR∷Genr, MPAO1 derivative with a gentamicin resistance cassette
    replaced the PA2826-ospR locus
This study
        MPAO1/PAK1900 MPAO1 carrying plasmid PAK1900 This study
        MPAO1/p-ospR MPAO1 carrying plasmid p-ospR This study
        MPAO1/p-PA2826 MPAO1 carrying plasmid p-PA2826 This study
        ΔospR/PAK1900 ΔospR carrying PAK1900 This study
        ΔospR/p-ospR ΔospR carrying p-ospR This study
        ΔPA2826-ospR/PAK1900 ΔPA2826-ospR carrying PAK1900 This study
        ΔPA2826-ospR/p-ospR ΔPA2826-ospR carrying p-ospR This study
        ΔPA2826-ospR/p-PA2826 ΔPA2826-ospR carrying p-PA2826 This study
    E. coli
        DH5a endA hsdR17 supE44 thi-1 recA1 gyrA relA1 Δ(lacZYA-argF)U169 deoR
    (φ80dlacΔ(lacZ)M15)
Lab stock
        BL21 F−ompT hsdSB (rB mB) gal dcm met (DE3) Lab stock

Nucleotide sequences (5–3′) of the primers

FD2825downF: GTTTCTAGACAACGAGATGTTCGACCT GC; FD2825downR: TTTCTGCAGCCTGGAGTACAAGCG TCTGG; FD2825upF: TTTGGATCCGGGTTGCGTTACTG CATCA; FD2825upR: TTTTCTAGAAGCAGCAGCGATT CTTCG; Tet-XbaI-F: ATTTCTAGATTTCAGTGCAATTTAT CT; Tet-XbaI-R: TTTTCTAGAGGACGCGATGGATATGTT CT; D26-25UpF: CTCGAATTCCCACCTGCTTCTGCTGGTA; D26-25UpR: TCCTCTAGAAATCGCTCATGGCTTGTCTT; D26-25DownF: TCCTCTAGACTCAACGAGATGTTCGACC TG; D26-25DownR: TCGAAGCTTCCTGGAGTACAAGCGT CTGG; PA2825FCF: TTAAGCTTGCATCAAGTGGAACT TCACC; PA2825FCR: TTGGATCCACTACCTGGCCAAGC CTTTC; FO2826F: TGCAAGCTTTATTTCGAGACCCAC CCTCA; FO2826R: CGGGGATCCGGCGTACAGCTTGAAA CACA; PA2827FNF: GTTGACCGAAGAGCAGTTCC; PA2827FNR: GTGGCTGAAGTCGTCCAGTT; PA2826FNF: ATCAAGGGCGAACAGAAGAC; PA2826FNR: GAAGCT CACCCCGTAGTTCA; PA2824FNF: CTTCGTAGCCGTC CATCACT; PA2824FNR: CTACGGCAGTTTCCTCGAAC; phzM-FNF: CTGCTGCGCGTAATTTGATA; phzM-FNR: CAA CAGGCTGGAAAGGTTGT; phzS-FNF: GGAAAGCAG CAGCGAGATAC; phzS-FNR: CGGGTACTGCAGGATC AACT; C24SF: GCTCGACAACCAGCTGAGTTTCAAGCTG TACGC; C24SR: GCGTACAGCTTGAAACTCAGCTGGT TGTCGAGC; hmgAFNF: GAGGTCAGCACGGTGAAGAT; hmgAFNR: CTACCAGTACCTGGCCAACC; PA2010FNF: CGCCTCCACCAATCATTACT; PA2010FNR: CAACTGAT AGCCCGAGTCGT; PA1897FNF: AGATCGGGAAGTCG CTGTAG; PA1897FNR: CGGGTGATCTTCCTCAACAT; Pa2825C2toSF: TGCGCCAGCAGCTGATCTCCAGCACCG GTTTCGACCT; Pa2825C2toSR: AGGTCGAAACCGGT GCTGGAGATCAGCTGCTGGCGCA; PA2850FNF: CTCGA CGTGAAACTCAGCAC; PA2850FNR: GTTGGAGTAGGG GCAGACCT; PA2825F-NdeI: TTGGACACATATGATGAG CACCCGGGGAAAAGT; PA2825R-XhoI: CACACTCGA GCTAGCCTCCTACCACCAGACGGA.

Construction of P. aeruginosa ΔospR and ΔPA2826-ospR mutants

For gene replacement, a sacB-based strategy (Schweizer and Hoang, 1995) was employed. To construct the ospR null mutant (ΔospR), polymerase chain reactions (PCRs) were performed to amplify sequences upstream (706 bp) and downstream (764 bp) of the intended deletion. The upstream fragment was amplified from MPAO1 genomic DNA using primers FD2825upF (with BamHI site) and FD2825upR (with XbaI site), while the downstream fragment was amplified with primers, FD2825downF (with XbaI site) and FD2825downR (with PstI site, see in Experimental procedures). The two PCR products were digested with BamHI–XbaI or XbaI–PstI, as appropriate, and then cloned into BamHI/PstI-digested gene replacement vector pJQ200mp18 via a three-piece ligation, which yielded pJQ200mp18::2825UD. A tetracycline resistance cassette was amplified from EZ-Tn5 <TET-1> (EPICENTRE® Biotechnologies) with primers, Tet-XbaI-F and Tet-XbaI-R (see in Experimental procedures). The PCR product was digested with XbaI and cloned into XbaI-digested pJQ200mp18::2825UD. The resultant plasmid, pJQ200mp18::2825UTD, was electroporated into MPAO1 with selection for tetracycline resistance. Colonies were screened for gentamicin sensitivity and loss of sucrose (5%) sensitivity, which typically indicates a double-cross-over event and thus of gene replacement occurring. The ΔospR strain was further confirmed by PCR and Southern blot analysis.

The ΔPA2826-ospR strain was constructed by a similar strategy using the suicide vector pEX18Ap::26-25UD. Briefly, the 972 bp fragments of the upstream region of PA2826 gene were amplified using primers D26-25UpF (with EcoRI site) and D26-25UpR (with XbaI site). The primers D26-25DownF (with XbaI site) and D26-25DownR (with HindIII site) were used for amplification of 765 bp of PA2825 downstream region. The two PCR products were digested with EcoRI–XbaI or XbaI– HindIII, as appropriate, and then cloned into EcoRI/HindIII-digested gene replacement vector pEX18Ap via a three-piece ligation, yielding pEX18Ap::26-25UD. A 1.8 kb gentamicin resistance cassette was cut from pPS858 with XbaI and then cloned into pEX18Ap::26-25UD, yielding pEX18Ap::26-25UD.

Plasmid construction for constitutive expression of ospR and PA2826

In order to construct the plasmid for constitutive expression of ospR, the following were amplified using primers PA2825FCF (with HindIII site) and PA2825FCR (with BamHI site): a 705 bp PCR product covering 115 bp of the ospR upstream region, the ospR gene, and 98 bp downstream of ospR gene. The product was digested with HindIII and BamHI and ligated into PAK1900 in the same orientation as plac to generate p-ospR. To construct the plasmid for constitutive expression of PA2826, a 605 bp PCR product covering 36 bp of the PA2826 upstream region, the PA2826 gene, and 84 bp downstream of PA2826 was amplified using primers FO2826F (with HindIII site) and FO2826R (with BamHI site) and then cloned into PAK1900, yielding p-PA2826. The three mutations, p-OspRC24S, p-OspSPRC134S and p-OspRC24SC134S, were obtained by using QuikChange II site-directed mutagenesis kit (Stratagene). Primer pairs C24SF/C24SR and Pa2825C2toSF/Pa2825C2toSR were used for generating C24S and C124S mutation respectively. All the constructs were sequenced to ensure that no unwanted mutations resulted.

RNA isolation and Northern blotting

Total RNA was isolated using a Qiagen RNeasy kit according to the manufacturer’s recommendations. RNA concentration and purity were determined by absorbency at 260 and 280 nm. Northern blotting was performed following previously reported procedures (Chen et al., 2008a).

Construction, expression and purification of 6His-OspR, 6His-OspRC24S and 6His-OspRC134S

OspR was cloned into pET28a with a thrombin-cleavable N-terminal His-tag and expressed in E. coli strain BL21 (DE3) (Novagen). Two sets of primers were used to amplify the OspR gene from P. aeruginosa MPAO1 chromosomal DNA: PA2825-NdeI and PA2825-XhoI. The amplified fragments were ligated into similarly cut pET28a (Novagen) to produce the plasmids pET28a-his-OspR. OspRC24S and ospRC134S was amplified from p-ospRC24S and p-ospRC134S by using primer pair PA2825F-NdeI/PA2825R-XhoI and then cloned into pET28a, respectively, as described above. Clones were verified by DNA sequencing and transformed into BL21 (DE3) for expression.

The expression and purification procedures for OspR, OspRC24S and OspRC134S are described as follows. The strains were grown at 37°C overnight in 10 ml of LB medium containing 50 µg ml−1 kanamycin (LBkan50). The next day, the cultures were transferred into 1 l of LBkan50, incubated at 37°C until the OD600 reached 0.6, after which IPTG (isopropyl-1-thio-β-d-galactopyranoside) was added to a final concentration of 1.0 mM.After 4 h incubation at 30°C, the cells were harvested by centrifugation and stored at −80°C. The cells were lysed at 4°C by sonication in lysis buffer [10 mM Tris (pH 7.4), 300 mM NaCl, 1 mM PSMF and 2 mM DTT]. Clarified cell lysate was loaded onto a HisTrap HP column (Amersham Biosciences), washed with Ni-NTA washing buffer and eluted with Ni-NTA elution buffer. The fractions containing OspR, OspRC24S or OspRC134S were concentrated and loaded onto a Superdex-200 gel filtration column with a running condition of 10 mM Tris (pH 7.4), 300 mM NaCl and 2 mM DTT.

Electrophoretic mobility shift assays

The electrophoretic mobility shift experiments were performed by using [γ-32P]-ATP labelled method. Duplex DNA (5′–3′ annealed to its complementary strand) containing various promoter regions was used for the assay. DNA fragments were labelled using [γ-32P]-ATP (Perkin Elmer) and a T4 polynucleotide kinase. Unincorporated dATP were removed using illustra MicroSpin™ G-50 Columns (GE Healthcare). The electrophoretic mobility shift experiments were performed by adding 0.04 pmol of P32-labelled duplex DNA to 24 µl of reaction buffer (10 mM HEPES at pH 8.0, 1 mM EDTA, 50 mM KCl, 0.05% Triton X-100, 10% glycerol, 10 µg ml−1 salmon sperm DNA). Reactions were placed on ice for 30 min before loading. Designated amounts of H2O2 or CHP were used as appropriate. Gels were run in 0.5× TBE at 85 V at room temperature. The gels were dried and subjected to autoradiography using the storage phosphor screen (Image Screen-K, Kodak) and the Molecular Imager PharosFX Plus System (Bio-Rad).

Oxidative and drug stress plates

LB agar plates were made with designated amounts of paraquat, H2O2 and cefotaximine. The overnight culture was diluted 100-fold in fresh LB medium. P. aeruginosa were grown to early stationary phase (OD600 = 2.0) in LB broth, and 10-fold dilutions were made. Aliquots (10 µl) of the diluted cultures for each strain were spotted onto the solid media and grown at 37°C.

Glutathione (GSH)/glutathione disulphide (GSSG) measurements

The overnight culture was diluted 100-fold in fresh LB media and incubated at 37°C for 6 h until the culture reached OD600 = 2.2–2.3. The pellet from 10 ml of a cell culture was stored at −80°C and re-suspended in 0.25 ml of double-distilled water before used. GSH/GSSG ratio was measured by using GSH/GSSG Cuvette Assay Kit (Catalog # GT35, Oxford Biomedical Research).

Analysis of OspR oxidation in vitro by SDS-PAGE and chemical characterization of sulphenic acid modification

Purified His6-tagged OspR proteins were washed with the thiol-assay buffer (100 mM KH2PO4/K2HPO4, 200 mM NaCl and 1 mM EDTA at pH 7.0) four times to remove extra DTT using Microcon YM-10 (Amicon) ultrafiltration device. Protein samples (50 µM, monomer) were treated with four equivalents of CHP (200 µM) at room temperature for 10 min followed by washing with the thiol-assay buffer three times to generate the oxidized OspR. Disulphide bond formation was monitored by non-reducing SDS-PAGE. The OspRC134S-SOH modification was confirmed by the NBD-Cl assay (Chen et al., 2006).

Mouse model of acute pneumonia

Mouse infections were carried out as described previously (Laskowski et al., 2004), using 8-week-old female C57BL/6 mice obtained from the National Cancer Institute and housed under specified pathogen-free conditions. All studies were approved by the Yale University Institutional Animal Care and Use Committee. Mice were lightly anaesthetized with isoflurane and intranasally infected with c. 2 × 107 cfu of each bacterial isolate; the actual inoculum titre for each group was determined by plating serial dilutions. Animals were sacrificed 18 h post infection. Lungs and spleens were aseptically removed and homogenized in PBS plus 0.1% Triton X-100 to obtain single-cell suspensions. Serial dilutions of each organ were plated on VBM (Vogel–Bonner minimal) agar plates. Bacterial burden per organ was calculated and is expressed as a ratio of the inoculum delivered per animal. Statistical analysis was performed using Prism software (GraphPad).

Supplementary Material

Arrays

Acknowledgements

We would like to thank Professor H.P. Schweizer (Colorado State University) for kindly providing us with plasmids pEX18Ap and pPS858, Ms S. Frank for editing the manuscript, and valuable suggestions from reviewers. This work was supported by National Institutes of Health (NIH/NIAID AI074658 to C.H.), a Burroughs Wellcome Fund Investigator in the Pathogenesis of Infectious Disease Award (C.H.).

Footnotes

Supporting information

Additional supporting information may be found in the online version of this article.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

References

  1. Arias-Barrau E, Olivera ER, Luengo JM, Fernández C, Galán B, García JL, et al. The homogentisate pathway: a central catabolic pathway involved in the degradation of l-phenylalanine, l-tyrosine, and 3-hydroxyphenylacetate in Pseudomonas putida. J Bacteriol. 2004;186:5062–5077. doi: 10.1128/JB.186.15.5062-5077.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Chen PR, Bae T, Williams WA, Duguid EM, Rice PA, Schneewind O, He C. An oxidation-sensing mechanism is used by the global regulator MgrA in Staphylococcus aureus. Nat Chem Biol. 2006;2:591–595. doi: 10.1038/nchembio820. [DOI] [PubMed] [Google Scholar]
  3. Chen PR, Nishida S, Poor CB, Cheng A, Bae T, Kuechenmeister L, et al. A new oxidative sensing and regulation pathway mediated by the MgrA homologue SarZ in Staphylococcus aureus. Mol Microbiol. 2008a;71:198–211. doi: 10.1111/j.1365-2958.2008.06518.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chen H, Hu J, Chen PR, Lan L, Li Z, Hicks LM, et al. The Pseudomonas aeruginosa multidrug efflux regulator MexR uses an oxidation-sensing mechanism. Proc Natl Acad Sci USA. 2008b;105:13586–13591. doi: 10.1073/pnas.0803391105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chuchue T, Tanboon W, Prapagdee B, Dubbs JM, Vattanaviboon P, Mongkolsuk S. ohrR and ohr are the primary sensor/regulator and protective genes against organic hydroperoxide stress in Agrobacterium tumefaciens. J Bacteriol. 2006;188:842–851. doi: 10.1128/JB.188.3.842-851.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chugani SA, Whiteley M, Lee KM, D’Argenio D, Manoil C, Greenberg EP. QscR, a modulator of quorum-sensing signal synthesis and virulence in Pseudomonas aeruginosa. Proc Natl Acad Sci USA. 2001;98:2752–2757. doi: 10.1073/pnas.051624298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cross A, Allen JR, Burke J, Ducel G, Harris A, John J, et al. Nosocomial infections due to Pseudomonas aeruginosa: review of recent trends. Rev Infect Dis. 1983;5:S837–S845. doi: 10.1093/clinids/5.supplement_5.s837. [DOI] [PubMed] [Google Scholar]
  8. Dietrich LE, Price-Whelan A, Petersen A, Whiteley M, Newman DK. The phenazine pyocyanin is a terminal signalling factor in the quorum sensing network of Pseudomonas aeruginosa. Mol Microbiol. 2006;61:1308–1321. doi: 10.1111/j.1365-2958.2006.05306.x. [DOI] [PubMed] [Google Scholar]
  9. Dietrich LE, Teal TK, Price-Whelan A, Newman DK. Redox-active antibiotics control gene expression and community behavior in divergent bacteria. Science. 2009;321:1203–1206. doi: 10.1126/science.1160619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fuangthong M, Atichartpongkul S, Mongkolsuk S, Helmann JD. OhrR is a repressor of ohrA, a key organic hydroperoxide resistance determinant in Bacillus subtilis. J Bacteriol. 2001;183:4134–4141. doi: 10.1128/JB.183.14.4134-4141.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gibson J, Sood A, Hogan DA. Pseudomonas aeruginosa–Candida albicans interactions: localization and fungal toxicity of a phenazine derivative. Appl Environ Microbiol. 2009;75:504–513. doi: 10.1128/AEM.01037-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Govan JRW, Harris GS. Pseudomonas aeruginosa and cystic fibrosis: unusual bacterial adaptation and pathogenesis. Microbiol Sci. 1986;3:302–308. [PubMed] [Google Scholar]
  13. Hassett DJ, Cohen MS. Bacterial adaptation to oxidative stress: implications for pathogenesis and interaction with phagocytic cells. FASEB J. 1989;3:2574–2582. doi: 10.1096/fasebj.3.14.2556311. [DOI] [PubMed] [Google Scholar]
  14. Hassett DJ, Ma JF, Elkins JG, McDermott TR, Ochsner UA, West SE, et al. Quorum sensing in Pseudomonas aeruginosa controls expression of catalase and superoxide dismutase genes and mediates biofilm susceptibility to hydrogen peroxide. Mol Microbiol. 1999;34:1082–1093. doi: 10.1046/j.1365-2958.1999.01672.x. [DOI] [PubMed] [Google Scholar]
  15. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. A broad-host-range Flp–FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene. 1998;212:77–86. doi: 10.1016/s0378-1119(98)00130-9. [DOI] [PubMed] [Google Scholar]
  16. Hoiby N. Pseudomonas in Cystic Fibrosis: Past, Present, and Future. London: Cystic Fibrosis Trust; 1998. [Google Scholar]
  17. Imlay JA. Cellular defenses against superoxide and hydrogen peroxide. Annu Rev Biochem. 2008;77:755–776. doi: 10.1146/annurev.biochem.77.061606.161055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jacobs MA, Alwood A, Thaipisuttikul I, Spencer D, Haugen E, Ernst S, et al. Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc Natl Acad Sci USA. 2003;100:14339–14344. doi: 10.1073/pnas.2036282100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jansons I, Touchie G, Sharp R, Almquist K, Farina M, Lam JS, Kropinski AM. Deletion and transposon mutagenesis and sequence analysis of the pRO1600 OriR region found in the broad-host range plasmids of the pQF series. Plasmid. 1994;31:265–274. doi: 10.1006/plas.1994.1028. [DOI] [PubMed] [Google Scholar]
  20. Kang BR, Han SH, Cho SM, Anderson AJ, Kim IS, Park SK, Kim YC. Characterization of a homogentisate dioxygenase mutant in Pseudomonas chlororaphis O6. Curr Microbiol. 2008;56:145–149. doi: 10.1007/s00284-007-9075-7. [DOI] [PubMed] [Google Scholar]
  21. Klomsiri C, Panmanee W, Dharmsthiti S, Vattanaviboon P, Mongkolsuk S. Novel roles of ohrR-ohr in Xanthomonas sensing, metabolism, and physiological adaptive response to lipid hydroperoxide. J Bacteriol. 2005;187:3277–3281. doi: 10.1128/JB.187.9.3277-3281.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kobayashi K, Tagawa S. Activation of SoxR-dependent transcription in Pseudomonas aeruginosa. J Biochem. 2004;136:607–615. doi: 10.1093/jb/mvh168. [DOI] [PubMed] [Google Scholar]
  23. Lagrange-Puget M, Durieu I, Ecochard R, Abbas-Chorfa F, Drai J, Steghens JP, et al. Longitudinal study of oxidative status in 312 cystic fibrosis patients in stable state and during bronchial exacerbation. Pediatr Pulmonol. 2004;38:43–49. doi: 10.1002/ppul.20041. [DOI] [PubMed] [Google Scholar]
  24. Laskowski MA, Osborn E, Kazmierczak BI. A novel sensor kinase-response regulator hybrid regulates type III secretion and is required for virulence in Pseudomonas aeruginosa. Mol Microbiol. 2004;54:1090–1103. doi: 10.1111/j.1365-2958.2004.04331.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lau GW, Ran H, Kong F, Hassett DJ, Mavrodi D. Pseudomonas aeruginosa pyocyanin is critical for lung infection in mice. Infect Immun. 2004a;72:4275–4278. doi: 10.1128/IAI.72.7.4275-4278.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lau GW, Hassett DJ, Ran H, Kong F. The role of pyocyanin in Pseudomonas aeruginosa infection. Trends Mol Med. 2004b;10:599–606. doi: 10.1016/j.molmed.2004.10.002. [DOI] [PubMed] [Google Scholar]
  27. Lau GW, Britigan BE, Hassett DJ. Pseudomonas aeruginosa OxyR is required for full virulence in rodent and insect models of infection and for resistance to human neutrophils. Infect Immun. 2005;73:2550–2553. doi: 10.1128/IAI.73.4.2550-2553.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lee JH, Lequette Y, Greenberg EP. Activity of purified QscR, a Pseudomonas aeruginosa orphan quorum-sensing transcription factor. Mol Microbiol. 2006;59:602–609. doi: 10.1111/j.1365-2958.2005.04960.x. [DOI] [PubMed] [Google Scholar]
  29. Ma JF, Hager PW, Howell ML, Phibbs PV, Hassett DJ. Cloning and characterization of the Pseudomonas aeruginosa zwf gene encoding glucose-6-phosphate dehydrogenase, an enzyme important in resistance to methyl viologen (paraquat) J Bacteriol. 1998;180:1741–1749. doi: 10.1128/jb.180.7.1741-1749.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mahajan-Miklos S, Tan MW, Rahme LG, Ausubel FM. Molecular mechanisms of bacterial virulence elucidated using a Pseudomonas aeruginosa–Caenorhabditis elegans pathogenesis model. Cell. 1999;96:47–56. doi: 10.1016/s0092-8674(00)80958-7. [DOI] [PubMed] [Google Scholar]
  31. Mavrodi DV, Bonsall RF, Delaney SM, Soule MJ, Phillips G, Thomashow LS. Functional analysis of genes for biosynthesis of pyocyanin and phenazine-1-carboxamide from Pseudomonas aeruginosa PAO1. J Bacteriol. 2001;183:6454–6465. doi: 10.1128/JB.183.21.6454-6465.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Melstrom KA, Jr, Kozlowski R, Hassett DJ, Suzuki H, Bates DM, Gamelli RL, Shankar R. Cytotoxicity of Pseudomonas secreted exotoxins requires OxyR expression. J Surg Res. 2007;143:50–57. doi: 10.1016/j.jss.2007.02.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Miller RA, Britigan BE. Role of oxidants in microbial pathophysiology. Clin Microbiol Rev. 1997;10:1–18. doi: 10.1128/cmr.10.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mongkolsuk S, Helmann JD. Regulation of inducible peroxide stress responses. Mol Microbiol. 2002;45:9–15. doi: 10.1046/j.1365-2958.2002.03015.x. [DOI] [PubMed] [Google Scholar]
  35. Newberry KJ, Fuangthong M, Panmanee W, Mongkolsuk S, Brennan RG. Structural mechanism of organic hydroperoxide induction of the transcription regulator OhrR. Mol Cell. 2007;28:652–664. doi: 10.1016/j.molcel.2007.09.016. [DOI] [PubMed] [Google Scholar]
  36. Ochsner UA, Vasil ML, Alsabbagh E, Parvatiyar K, Hassett DJ. Role of the Pseudomonas aeruginosa oxyR-recG operon in oxidative stress defense and DNA repair: OxyR-dependent regulation of katB-ankB, ahpB, and ahpC-ahpF. J Bacteriol. 2000;182:4533–4544. doi: 10.1128/jb.182.16.4533-4544.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Palma M, DeLuca D, Worgall S, Quadri LE. Transcriptome analysis of the response of Pseudomonas aeruginosa to hydrogen peroxide. J Bacteriol. 2004;186:248–252. doi: 10.1128/JB.186.1.248-252.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Palma M, Zurita J, Ferreras JA, Worgall S, Larone DH, Shi L, et al. Pseudomonas aeruginosa SoxR does not conform to the archetypal paradigm for SoxR-dependent regulation of the bacterial oxidative stress adaptive response. Infect Immun. 2005;73:2958–2966. doi: 10.1128/IAI.73.5.2958-2966.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Panmanee W, Vattanaviboon P, Eiamphungporn W, Whangsuk W, Sallabhan R, Mongkolsuk S. OhrR, a transcription repressor that senses and responds to changes in organic peroxide levels in Xanthomonas campestris pv. phaseoli. Mol Microbiol. 2002;45:1647–1654. doi: 10.1046/j.1365-2958.2002.03116.x. [DOI] [PubMed] [Google Scholar]
  40. Panmanee W, Vattanaviboon P, Poole LB, Mongkolsuk S. Novel organic hydroperoxide-sensing and responding mechanisms for OhrR, a major bacterial sensor and regulator of organic hydroperoxide stress. J Bacteriol. 2006;188:1389–1395. doi: 10.1128/JB.188.4.1389-1395.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Poole LB, Nelson KJ. Discovering mechanisms of signaling-mediated cysteine oxidation. Curr Opin Chem Biol. 2008;12:18–24. doi: 10.1016/j.cbpa.2008.01.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Price-Whelan A, Dietrich LE, Newman DK. Rethinking ‘secondary’ metabolism: physiological roles for phenazine antibiotics. Nat Chem Biol. 2006;2:71–78. doi: 10.1038/nchembio764. [DOI] [PubMed] [Google Scholar]
  43. Quandt J, Hynes MF. Versatile suicide vectors which allow direct selection for gene replacement in Gram-negative bacteria. Gene. 1993;127:15–21. doi: 10.1016/0378-1119(93)90611-6. [DOI] [PubMed] [Google Scholar]
  44. Ran H, Hassett DJ, Lau GW. Human targets of Pseudomonas aeruginosa pyocyanin. Proc Natl Acad Sci USA. 2003;100:14315–14320. doi: 10.1073/pnas.2332354100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Reynolds HY, Levine AS, Wood RE, Zierdt CH, Dale DC, Pennington JE. Pseudomonas aeruginosa infections: persisting problems and current research to find new therapies. Ann Intern Med. 1975;82:819–831. doi: 10.7326/0003-4819-82-6-819. [DOI] [PubMed] [Google Scholar]
  46. Rodríguez-Rojas A, Mena A, Martín S, Borrell N, Oliver A, Blázquez J. Inactivation of the hmgA gene of Pseudomonas aeruginosa leads to pyomelanin hyper-production, stress resistance and increased persistence in chronic lung infection. Microbiology. 2009;155:1050–1057. doi: 10.1099/mic.0.024745-0. [DOI] [PubMed] [Google Scholar]
  47. Scandalios JG. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. New York: Cold Spring Harbor Laboratory Press; 1997. [Google Scholar]
  48. Schweizer HP, Hoang T. An improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa. Gene. 1995;158:15–22. doi: 10.1016/0378-1119(95)00055-b. [DOI] [PubMed] [Google Scholar]
  49. Shatalin K, Gusarov I, Avetissova E, Shatalina Y, McQuade LE, Lippard SJ, Nudler E. Bacillus anthracis-derived nitric oxide is essential for pathogen virulence and survival in macrophages. Proc Natl Acad Sci USA. 2008;105:1009–1013. doi: 10.1073/pnas.0710950105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Soonsanga S, Lee JW, Helmann JD. Conversion of Bacillus subtilis OhrR from a 1-Cys to a 2-Cys peroxide sensor. J Bacteriol. 2008;190:5738–5745. doi: 10.1128/JB.00576-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Storz G, Imlay JA. Oxidative stress. Curr Opin Microbiol. 1999;2:188–194. doi: 10.1016/s1369-5274(99)80033-2. [DOI] [PubMed] [Google Scholar]
  52. Sukchawalit R, Loprasert S, Atichartpongkul S, Mongkolsuk S. Complex regulation of the organic hydroperoxide resistance gene (ohr) from Xanthomonas involves OhrR, a novel organic peroxide-inducible negative regulator, and posttranscriptional modifications. J Bacteriol. 2001;183:4405–4412. doi: 10.1128/JB.183.15.4405-4412.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Wagner VE, Iglewski BH. P. aeruginosa Biofilms in CF Infection. Clin RevAllergy Immunol. 2008;35:124–134. doi: 10.1007/s12016-008-8079-9. [DOI] [PubMed] [Google Scholar]
  54. Wagner VE, Frelinger JG, Barth RK, Iglewski BH. Quorum sensing: dynamic response of Pseudomonas aeruginosa to external signals. Trends Microbiol. 2006;14:55–58. doi: 10.1016/j.tim.2005.12.002. [DOI] [PubMed] [Google Scholar]
  55. Wilkinson SP, Grove A. Ligand-responsive transcriptional regulation by members of the MarR family of winged helix proteins. Curr Issues Mol Biol. 2006;8:51–62. [PubMed] [Google Scholar]
  56. Willcox MD, Zhu H, Conibear TC, Hume EB, Givskov M, Kjelleberg S, Rice SA. Role of quorum sensing by Pseudomonas aeruginosa in microbial keratitis and cystic fibrosis. Microbiology. 2008;154:2184–2194. doi: 10.1099/mic.0.2008/019281-0. [DOI] [PubMed] [Google Scholar]
  57. Wilson R, Sykes DA, Watson D, Rutman A, Taylor GW, Cole PJ. Measurement of Pseudomonas aeruginosa phenazine pigments in sputum and assessment of their contribution to sputum sol toxicity for respiratory epithelium. Infect Immun. 1988;56:2515–2517. doi: 10.1128/iai.56.9.2515-2517.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Winstanley C, Fothergill JL. The role of quorum sensing in chronic cystic fibrosis Pseudomonas aeruginosa infections. FEMS Microbiol Lett. 2009;290:1–9. doi: 10.1111/j.1574-6968.2008.01394.x. [DOI] [PubMed] [Google Scholar]
  59. Wood LG, Fitzgerald DA, Gibson PG, Cooper DM, Collins CE, Garg ML. Oxidative stress in cystic fibrosis: dietary and metabolic factors. J Am Coll Nutr. 2001;20:157–165. doi: 10.1080/07315724.2001.10719028. [DOI] [PubMed] [Google Scholar]
  60. Zhang L, Mah TF. Involvement of a novel efflux system in biofilm-specific resistance to antibiotics. J Bacteriol. 2008;190:4447–4452. doi: 10.1128/JB.01655-07. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Arrays

RESOURCES