ErbB Inhibitory Protein [EBIP]: A Modified Ectodomain of EGFR Synergizes with Dasatinib to Inhibit Growth of Breast Cancer Cells

Abstract

Many solid tumors including breast cancer show increased activation of several growth factor receptors, specifically EGFR and its family members (EGFRs) as well as c-Src, a non-receptor tyrosine kinase that promote proliferation, inhibit apoptosis and induce metastasis. We hypothesize that inhibition of c-Src and EGFRs will be an effective therapeutic strategy for triple negative breast cancer. To test our hypothesis we used a c-Src specific inhibitor dasatinib (BMS-354825; Bristol-Myers Squibb) and our newly developed ErbB Inhibitory Protein (EBIP), a potential pan-erbB inhibitor in breast cancer cells. EBIP is composed of 1-448 amino acids of the ectodomain of human EGFR to which the 30 amino acids epitope (known as “U” region) of rat EGFR-Related Protein (ERRP) is fused at the C-terminal end. The combination of dasatinib and EBIP was found to be highly effective in inhibiting the growth of 4 different breast cancer cells (MDA-MB-468, SKBr-3, MDA-MB-453 and MDA-MB-231) that express different levels of EGFRs. In EGFR overexpressing MDA-MB-468 cells, the combination, but not monotherapy markedly stimulated apoptosis mediated by caspases -9 and 8 and attenuated activation of EGFR and Src as well as tyrosine kinase activity. EBIP also inhibited heregulin-induced activation of HER-2 and HER-3 in MDA-MB-453 breast cancer cells. The combination therapy was highly effective in suppressing tumor growth (∼90% inhibition) in MDA-MB-468 derived xenografts in SCID mice. The latter could be attributed to induction of apoptosis. We conclude that combining dasatinib and EBIP could be an effective therapeutic strategy for breast cancer by targeting EGFRs and Src signaling.

Introduction

Breast cancer is the second leading cause of cancer related deaths among females, next only to lung cancer (1). It is a complex disease. Based on transcriptional profiling, breast cancer is currently identified in five distinct subtypes: luminal A and B, normal–breast like, HER2 over-expressing and basal–like (2, 3). Basal-like breast cancer that show absence of hormone receptors (Estrogen receptor; ER and progesterone receptor; PR) without amplification of HER-2, are referred to as triple negative breast cancer. As a group, basal-like cancers comprise about 80% of triple negative cancers (3). At present there is controversy regarding the classification of basal and triple negative breast cancers. For the sake of simplicity, these two terms are frequently used interchangeably. Triple negative breast cancer is found to be more common among African–American and BRCA1-mutation carriers (4). It is associated with aggressive histology, poor prognosis, and unresponsiveness to usual endocrine therapies (2, 5-7), highlighting the need for new therapeutics/strategies.

Several targeted therapies for EGFR and its family members have been developed for treatment of many malignancies including breast cancers (8, 9). Although trastuzumab, monoclonal antibodies to HER2, is being used for treatment of HER2 overexpressing breast cancer, it is not an effective therapy for triple negative breast cancer (9). The fact that the extracellular or ectodomain of EGFR is essential for ligand-binding and subsequent homo/heterodimerization of the receptor, raises the possibility that this domain of EGFR could be utilized to inhibit EGFR functions and could, therefore, be developed into an anti-cancer agent. Indeed, EGFR Related Protein (ERRP), a 53-55 kDa protein, which we isolated from the rat gastro-duodenal mucosa targets multiple members of the EGFR family and inhibits growth of several epithelial cancers, including the gastric mucosa, colon and pancreas (10-16). ERRP is composed of 3 of the 4 extracellular subdomains of EGFR and a 30 amino acid unique epitope (termed “U’) at the carboxy-terminus (10, 14). Although the 30 amino acid “U” region of ERRP possesses no homology with any known protein, antibodies raised against this epitope strongly cross-react with proteins in the liver, pancreas, gastric muscosa and colon of humans (14). This suggests that the “U” region harbors an antigenic epitope that is present in humans. The fact that ERRP was isolated from the rat that showed about 85% homology to the ectodomain of human EGFR, raised the possibility of inducing antigenic response in humans. This had prompted us to generate an expression plasmid of truncated human EGFR ectodomain (hEGFR) containing the “U” region of ERRP, which we referred to as EBIP [ErbB Inhibitory Protein]. In the present investigation, we studied the growth inhibitory properties of EBIP in breast cancer cells that express varying levels of EGFR and its family members.

Furthermore, the fact that c-Src may also be involved in the development and progression of breast cancer led us to study the effectiveness of the c-Src inhibitor dasatinib (BMS-354825), alone or together with EBIP in inhibiting growth of breast cancer cells. Dasatinib (BMS-354825) was identified as a highly potent, ATP-competitive inhibitor of Src family kinases and Abl kinases (17) which is approved for imatinib resistant CML and (Ph+) ALL treatment (18). Dasatinib has been shown to exhibit anti-proliferative activity in both hematological and solid tumors and is currently in clinical trial for triple negative breast cancer. Dasatinib has also been shown to inhibit processes of metastasis such as migration and invasion (18-25).

Methods and Materials

Cell Lines and Cell Culture

Human breast cancer (HBC) MDA-MB-468, SKBR3, MDA-MB-453, and MDA-MB-231 cells, obtained from American Type Culture Collection (ATCC, Rockville, MD), were used to investigate the mechanisms of growth inhibition by dasatinib and /or EBIP. All cell lines were maintained in Dulbecco's modified Eagle medium (DMEM), as described previously (26).

Chemicals

DMEM, fetal bovine serum (FBS), and antibiotic/antimycotic were obtained from GIBCO BRL, Bethesda, MD. Dasatinib was obtained partially from Bristol Myers Squibb through MTA and purchased from LC laboratories (Woburn, MA). Protease inhibitor cocktail, 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and other chemicals were obtained from Sigma, St. Louis, MO. Acridine orange (AO) and ethidium bromide (EthBr) were purchased from BD Bioscience (Ontario, Canada). AO/EthBr mixture was prepared according to the manufacturer's instruction. Anti p-EGFR(Tyr-845), p-EGFR(Tyr-1173), pHER-2(Tyr-877), pHER-3(Tyr-1289), p-Akt (Ser-473), pERKs p44/42, c-Src and p-Src (Tyr-416), were purchased from Cell Signaling (Beverley, MA). Antibodies to β-actin antibody was purchase from Chemicon International Inc. (Temecula, CA). Recombinant TGF-α and heregulin were procured from Calbiochem (La Jolla, CA). Antibodies to α-tubulin were purchased from Oncogene (San Diego, CA). Antibodies to PARP and EGFR were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) and anti–V5 was purchased from Invitrogen (Carlsbad, CA). In situ cell death detection kit, POD was obtained from Roche Diagnostics GmbH (Penzberg, Germany) to perform TUNEL assay.

Generation of EBIP Expression Constructs

The following expression constructs were generated.

Rat EGFR ectodomain [ERRP without “U” region; referred to as ERRP-447]

Rat EGFR sequences corresponding to ERRP [amino acid 1-447] were PCR [Polymerase Chain Reaction] amplified using the following primers: 5′-ATGCGACCCTCAGGGACCGCGAG-3′ (forward) and 5′-CCGCTCGAGGATGTTATGTTCAGGCCGAC-3′ (reverse) primers. The PCR product was cut with XhoI restriction enzymes and subcloned into EcoRV+XhoI cut pMT/His-V-5B vector [Invitrogen] to obtain a recombinant plasmid for expression of V-5-His-tagged rat EGFR ectodomain sequences.

Human EGFR ectodomain (referred to as hEGFR-501)

Human EGFR sequences from amino acids 1 to 501 were PCR amplified using the following 5′-CGCAAGCTTCGGGAGAGCCGGAGCGAGC-3′ (forward) and 5′-CCGCTCGAGGCCTTGCAGCTGTTTTCAC-3′ (reverse) primers. The reason for selecting position 501 for truncation was that this truncated ectodomain of human EGFR (hEGFR) was shown by Elleman et al (27) to bind EGFR ligands (e.g. EGF and TGF-α) with 13-14-fold higher affinity than the full-length EGFR ectodomain. The PCR product was cut with XhoI restriction enzyme and subcloned into EcoRV+XhoI cut pMT/His-V-5B vector to obtain a plasmid for expression of His-V5-tagged hEGFR-501 ectodomain sequences.

Human EGFR ectodomain fused with “U” region [referred to as hEGFR-448+U or EBIP]

EBIP was synthesized by fusing “U” region from ERRP to human EGFR ectodomain [referred to as hEGFR-448+U or EBIP]. Following steps were taken to construct the expression vector.

Step-i: Human EGFR sequences from amino acids 1 to 448 were first PCR amplified using the following 5′-CGCAAGCTTCGGGAGAGCCGGAGCGAGC-3′ (forward) and 5′-CGCGTTAACGATGTTATGTTCAGGCT-3′ (reverse) primers. This PCR product was digested with HindIII and HpaI, and gel purified for subsequent 3-way ligation.

Step-ii: The “U” region epitope from ERRP was synthesized as oligonucleotides with codons optimized for human expression. The following oligonucleotides were used:

• Oligo-1: 5′- AGCGCGGCGCCGTGGCAGGTTCCGTCTCTTTCTTGGCAGGCCGTTACCAGGCCG-3′;

• Oligo-2: 5′-CTGGTAACGGCCTGCCAAGAAAGAGACGGAACCTGCCACGGCGCCGCG-3′;

• Oligo-3: 5′- CTTCATCCGCTAGCCCAAAACCGCGTCAGCTGGGACACAGGCCCCTCTAGACGC-3′

• Oligo-4: 5′CCGCGTCTAGAGGGGCCTGTGTCCCAGCTGACGCGGTTTTGGGCTAGCGGATGAAGCGGC-3′

The oligonucleotides were phosphorylated at the respective 5′ ends using T4 polynucleotide kinase, and annealed as follows: oligos 1+2; and 3+4. The annealed products were ligated to obtain a contiguous “U” region sequence. This double stranded “U” region sequence was then utilized as template in a PCR reaction using the following primers: 5′-AGCGCGGCGCCGTGGCAG-3′ (forward); and 5′-CCGCGTCTAGAGGGGCCT-3′ (reverse). The PCR product was cut with a combination of SfoI and XbaI restriction enzymes and the product gel purified.

Step-iii: The PCR amplified products from Steps i and ii were ligated into HindIII plus XbaI cut vector plasmid pcDNA-3/myc-His-A to obtain a recombinant plasmid for expression of Myc-His-tagged hEGFR+U protein.

Step-iv: The cDNA insert of the recombinant plasmid from Step-iii above was PCR amplified using the forward primer from Step-i and the reverse primer from Step-ii. The PCR product then cut with XbaI and ligated into EcoRV plus XbaI cut pMT/V5-HisA vector (Invitrogen, Carlsbad, CA) to obtain a construct for expression of V5/His-tagged hEGFR+U protein. The V5 and 6xHis tags are located at the C-terminal end of the plasmid (just after the U-region).

Rat ERRP (EGFR Related Protein)

As has been described previously and detailed in the US Patent # # 6,399,743 & 6,582,934 ( GenBank \accession # AF187818). It is composed of 478 amino acids.

All the constructs were sequenced to confirm the validity of the inserts.

Generation of Recombinant EBIP

Recombinant EBIP was generated using the Drosophila expression system as described earlier for ERRP by Marciniak et al. (11). In brief, expression vector pMT/V5-HisA (Invitrogen) containing the entire reading frame of ERRP, rEGFR-447, hEGFR-501 or EBIP cDNA was transfected into Drosophila S2 cells with pCoHygro plasmid (Invitrogen), which confers hygromycin resistance. The stable cell line was induced with 0.5mM CuSO4 to express respective fusion protein. Proteins were purified from the crude cell lysate using poly-histidine antibodies (Invitrogen Inc.) conjugated to sepharose 4B (Pharmacia) as described by Marciniak et al. (11). The activity of ERRP/EBIP was determined by MTT assay as reported earlier (11). ERRP/EBIP with at least 80% growth inhibitory effect was selected for all experiments.

Growth Inhibition Assay

Cell growth was determined by 3-(4,5-dimethyl-thiazol-2yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay (26). Briefly, 5,000 cells/well were treated in 96-well culture plates for 24 or 48 h in absence (control) or presence of affinity-purified EBIP and /or dasatinib; as described in the figure legends, with six replicates. At the end of the treatment period, cells were incubated with 10% of 5 mg/ml stock of MTT and incubated for 3 h at 37 °C as described previously (26).

Analysis of Interaction Between Two Drugs

Combination Indices (CI) method adapted for in vitro anti-cancer drug testing was employed to determine the nature of interaction between the two agents as described previously (28). Based on CI values extent of synergism/ antagonism may be determined. In general, CI values below 1 suggest synergy, whereas CI above 1 indicates antagonism between the drugs. CI values in the range of 0.9 - 1.10 suggest mainly additive effects of the drugs, those between 0.9 and 0.85 would suggest slight synergy, and values in the range of 0.7 - 0.3 are indicative of moderate synergy. Any value less than 0.3 will suggest strong synergistic interactions between the drugs.

Western-blot Analysis

Western blot analysis was performed as described previously l (26). Briefly, aliquots of cell lysates containing 80 μg of protein were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Electrophoresed proteins were transferred onto nitrocellulose membranes and detected using specific primary and secondary antibodies. The protein bands were visualized by enhanced chemiluminescence (ECL) detection kit (Amersham Biosciences/Amersham Pharmacia Biotech Piscataway, NJ). The membranes were reprobed for β-actin as loading control. All Western blots were performed at least three times for each experiment.

Assessment of Apoptosis

(A) DNA-histone fragmentation ELISA: ∼ 1 × 10⁵ cells/well were plated and treated the same way as described above. After 24 h, the cells were lysed, and apoptosis was determined using the Cell Death Detection ELISA^PLUS kit from Roche Diagnostics GmbH (Penzberg, Germany). (B) Acridine orange staining: The cells were treated and collected as described for DNA-fragmentation assay. They were washed once with cold 1× PBS and resuspended in 1× PBS (05.-1×10⁶ cells/ml). Fifty μl of cell suspension was stained with 50 μl of AO/EthBr mixture which was obtained from BD Bioscience (Ontario, Canada) according to the manufacturer's instructions. Within five minutes of addition of the AO/EthBr mixture 10μl aliquots containing 300-500 cells were counted under a fluorescent microscope. Cells, that stained positive for acridine orange fluoresced green (live cells), while cells staining positive for ethidium bromide fluoresced red, were considered as dead. Results were calculated as (EthBr-stained cells/ EthBr or AO-stained cells) X100.

Tyrosine Kinase Assay

EGFR kinase activity was determined using the Chemicon Assay kit essentially according to the manufacturer's instructions. Briefly, MDA-MB-468 cells were treated for 24 hours with dasatinib and/ or EBIP. At the end of the treatment period, cells were collected, lysed and aliquots of 500 μg protein were subjected to immunoprecipitation with Anti-EGFR antibody (Santa Cruz Biotechnology) as described previously (11). After overnight incubation at 4°C, the lysates were centrifuged and the sepharose beads were washed three times with lysis buffer. Subsequently, the immuno-beads were assayed for kinase activity. The samples were read at 450nm and the results were presented as relative to untreated control.

SCID Mice Xenografts of MDA-MB-468 Cells

Four-week-old female ICR/severe combined immunodeficient mice (SCID), obtained from Taconic Laboratory (Germantown, NY) were subcutaneously (s.c.) injected with ∼ 10 × 10⁶ MDA-MB-468 breast cancer cells(11). When tumor burden reached 1500-2000 mg, mice were euthanized. The tumors were removed, cut into 20-30 mg fragment, subsequently transplanted (s.c.) bilaterally into similarly conditioned 28 animals(11). Once palpable tumors were formed, animals were randomly divided into four groups: control (vehicle); dasatinib group (10mg/kg every other day (qod) gavage); EBIP (s.c.; 25 μg/mouse qod every other day) and dasatinib + EBIP group was given both agents. Treatment was started on day-7 and continued till day 23. Animals and tumor burden were followed for up to 55 days. Tumor measurements were carried out at multiple time points during the experimental period. Mice were weighed and monitored for signs of toxicity. Tumor weights in SCID mice were estimated as Tumor weight (mg) = (A × B²) / 2, where A and B are the tumor length and width (in mm), respectively. At the end of the experiments the mice were sacrificed and the residual tumors were harvested for Western Blot analysis and fixed in buffered-formalin and processed for immunohistochemistry as described previously (11, 29)

Immunohistochemical analysis

For immunohistochemical staining, an immunoperoxidase method was used with a streptavidin biotinylated horseradish peroxidase complex (Dako, Carpinteria, California, USA) as described previously (11, 29). Briefly, sections of formalin fixed paraffin embedded tissue blocks were deparaffinized and were rehydrated in 0.1 M phosphate-buffered saline (PBS), pH 7.4, treated for 15 min with blocking serum (Vector Laboratories, Burlingame, California, USA), and subsequently incubated overnight in a refrigerated humidity chamber with antibodies to either Anti-V5 or phosphor-EGFR (Tyr-1173). Next day, the slides were washed three times in PBS, incubated with a biotin conjugated secondary antibody at room temperature for 30 minutes and finally with peroxidase conjugated streptavidin at room temperature for 30 minutes. Peroxidase activity was detected with the enzyme substrate 3-amino-9-ethyl carbazole. For negative controls, sections were treated in the same way except that they were incubated with Tris buffered saline instead of the primary antibody. All slides were cover-slipped and examined under 10× objective.

Determination of Apoptosis by TUNEL Assay

Paraffin-embedded tissues were sections as described above, and the TUNEL assay was performed to detect apoptotic cells using the in situ cell Death Detection kit from Roche Applied Science (Indianapolis, IN) according to the manufacturer's instructions as described previously (11, 16). 3-amino-9-ethylcarbazole was used as chromagen, and the sections were counterstained with hematoxylin. Apoptotic cell nuclei appeared as red stained structures against a blue-violet background. The apoptotic cells within the each section were counted with a 10× objective.

Statistical Analysis

Unless otherwise stated, data were expressed as mean ± SD. Where applicable, the results were compared by using the unpaired, two-tailed Student t-test, as implemented by Excel 2000 (Microsoft Corp., Redmond, WA). P values smaller than 0.05 were considered statistically significant. One way-ANOVA, SPSS 10.0, was applied for analysis of in vivo data.

Results

Generation and characterization of ErbB Inhibitory Protein (EBIP)

Fig. 1A depicts a schematic representation of four different plasmid constructs that we generated. They are (i) Full-length rat ERRP (EGFR-Related Peptide) that we generated earlier composed of 478 amino acids plus the “U” region. (ii) rat ERRP 1-447 amino acids that lacked “U” region (referred to as rEGFR-447) (14), (iii) human EGFR ectodomain that contained 1-501 amino acids (referred to as hEGFR-1-501) and (iv) Human EGFR ectodomain that contained 1-448 amino acids plus “U” region (hEGFR448+U; also referred to as EBIP). A schematic representation of human EGFR is also depicted in Fig. 1A.

Fig 1.

(A) Schematic representation of full length human EGFR and four different plamid constructs of (i) Rat ERRP 1-478, (ii) Rat EGFR ectodomain [ERRP without “U” region; referred to as ERRP-447], (iii) Human EGFR ectodomain (referred to as hEGFR-501), and (iv) Human EGFR ectodomain fused with “U” region [referred to as hEGFR-448+U or EBIP]. (B) Synthesis of recombinant proteins by drosophila S2 cells in the absence (-) or presence (+) of CuSO4 as determined by western-blot analysis of the cell lysates. Recombinant proteins containing both His- and V5- tags, were purified using His-tag and immuno-blotted with V5- anti-body. (C) Western blot analysis of EBIP localization in response to TGF-α induction of breast cancer cells. After 8 hours of incubation with EBIP, MDA-MB-468 cells, which were serum-starved, were induced with TGF- α. The cell lysates were immunoprecipitated with EGFR antibodies overnight and the immunoprecipitates were subsequently subjected to Western blot analysis with V5 antibody for EBIP detection. (D) Inhibition of growth of MDA-MB-468 cells in response to immuno-affinity purified EBIP and ERRP.

Western-blot analysis of drosophila S2 cells lysates using anti-histidine antibodies revealed a marked stimulation in synthesis of the respective recombinant protein following incubation with 0.5 mM CuS0₄ for 24 h (Fig. 1B). In the absence of 0.5 mM CuS0₄ no expression of EBIP was detected (Fig. 1B). Since EBIP contains the ligand binding ectodomain of human EGFR, we postulated that it will sequester the ligand leading to heterodimerization with members of the EGFRs. However, such heterodimers, as has been reported for ERRP and EGFR, would likely to be inactive since ERRP is devoid of the cytoplasmic domain (11). Indeed, when MDA-MB-468 cells containing high levels of EGFR were pre-incubated with EBIP, followed by induction with TGF-α, we found EBIP to co-immunoprecipitate with EGFR, whereas in the absence of TGF- α (control) no EBIP band could be detected (Fig. 1C). Additionally, growth inhibitory activity of EBIP was compared with ERRP in human breast cancer cells. Both ERRP and EBIP were found to be equally effective in inhibiting the growth of MDA-MB-468 cells (Fig. 1D). We also compared the growth inhibitory properties of hEGFR-501, hEGFR-448+U, ERRP and rEGFR-447 (lacked “U” region) in colon cancer HCT-116 cells (Supplemental Fig 1). We observed that whereas ERRP or EBIP at a dose of 20 μg/ml caused a marked 70% inhibition of growth of HCT-116 cells, the same dose of hEGFR-501 or rEGFR-447 produced only a small 20-25% inhibition in cellular growth, when compared with the corresponding controls (Supplemental Fig. 1). The results suggest that U-region is important for the growth inhibitory properties of ERRP and EBIP.

Earlier, we reported that ERRP is a pan-erbB inhibitor that targets multiple members of the EGFR family (13). As will be shown below, EBIP also inhibited the growth of different breast cancer cells that express varying levels of EGFR and its family members indicating potential pan-erbB nature of this protein. In support of this inference, we observed that whereas both ERRP and EBIP were able to inhibit heregulin-induced activation of HER-2 and HER-3 in MDA-MB-453 breast cancer cells, neither rEGFR-447 nor hEGFR-501 was effective in this matter (Supplemental Fig. 2). Taken together, the results suggest a role for the “U” region of ERRP in eliciting the growth inhibitory properties of ERRP and EBIP.

EBIP synergizes with dasatinib to inhibit the growth of human breast cancer cells

In the first set of experiments, we examined the effects of EBIP and dasatinib, each alone or in combination on the growth of four different breast cancer cells expressing varying levels of EGFRs (Fig 2A). Both dasatinib and EBIP were effective in inhibiting the growth of all four breast cancer cells (Figs. 2 B & C); whereas dasatinib caused a 20-40% growth inhibition among different cell lines, EBIP produced a 40-90% of the same. When dasatinib (1 μM) and EBIP (2.5μg/ml) were combined, the magnitude of inhibition of growth was greater than either of the agent alone (Fig. 2 D), indicating a greater effectiveness of the combination therapy than monotherapy.

Fig 2.

Western-blot showing the levels of EGFR, HER2 and HER3 in four different human breast cancer cells (A). Effects of EBIP and /or dasatinib on growth of human breast cancer cells expressing varying levels of EGFR members. Growth was determined by MTT assay after 48 hours of exposure to increasing doses of (B) dasatinib and (C) EBIP (D) Combined therapy of dasatinib (1.0 μM) and EBIP (2.5μg/ml purified protein) in HBCs. (*p<0.05, compared to individual drugs). Each value represents mean ± SD of 6 observations.

To determine the nature of interactions between EBIP and dasatinib, synergy analysis was performed with two triple negative breast cancer cell lines: MDA-MB-231 and MDA-MB-468. The results of the dose response were analysed using Calcusyn software (Biosoft, Ferguson, MO). They show that the combination therapy is superior to monotherapy in both breast cancer cell lines (Figs. 3 A & C). The fraction of cells affected in response to each treatment was further utilized to perform synergy analysis with Calcusyn. The Combination Index (CI), <1.0, which suggests a synergistic interaction between the two agents, was noted for all the combination doses for both breast cancer cell lines (Figs 3 B & D). Taken together, the results suggest that EBIP act synergistically with dasatinib. In all subsequent experiments dasatinib at a dose of 1 μM and EBIP at a concentration of 2.5μg/ml, were used in MDA-MB-468 cells. The rationale for using MDA-MB-468 cells is that they express only EGFR which will result in the formation of homodimers in response to ligand induction.

Fig 3.

Typical dose-response curves for EBIP and/or dasatinib in (A) MDA-MB-231 and (C) MDA-MB-468 cells produced by fixed-ratio method. Fraction of breast cancer cells affected by different combination of dasatinib and EBIP (fixed ratio) is higher than either agent alone. Fa represents the fraction of cells that is growth inhibited in response to dasatinib and /or EBIP. This is calculated as 1 – fraction of surviving cells. Fa values for each treatment were utilized to conduct synergy analysis by Calcusyn software as described in Methods and Materials. Combination indices for dasatinib and EBIP combination therapy, as computed by “Calcusyn” for (B) MDA-MB-231 and (D) MDA-MB-468 cells are given as inserts in the figure.

EBIP and/or dasatinib induce apoptosis and inhibit tyrosine kinase activity

The combined therapy was further tested for its efficacy for induction of apoptosis which was found to be more effective in MDA-MB-468 cells than either agent alone (Fig 4A). To further identify the apoptotic pathways, we utilized specific inhibitors of capase-8 (Z-IETD-FMK) and -9 (Z-LEHD-FMK). The cells were pre-incubated with specific inhibitors of caspases -8 or -9 for 3 h, subsequently exposed to the combination of EBIP and dasatinib. In the absence of the inhibitors, the combined therapy caused significant apoptosis. However, the addition of specific caspase inhibitor(s) blocked apoptosis induction by the combined therapy, indicating the activation of respective caspase(s) in response to the treatment. This suggests the involvement of both intrinsic (caspase-9) and extrinsic (caspase -8) pathways of apoptosis (Fig. 4B).

Fig 4.

Effects of EBIP and/or dasatinib on different aspects of growth of MDA-MB-468 breast cancer cells on (A) induction of apoptosis as determined by DNA fragmentation ELISA assay in response to EBIP and/ or dasatinib. (†p<0.05, compared to control). (B) induction of early apoptosis as determined by Acridine orange staining method. Cells were co-incubated with combination of dasatinib (1μM) and EBIP (2.5 μg/ml) and specific inhibitors of caspases-8 or -9. (*p<0.05, compared to combination therapy without caspase inhibitors). (C) EGFR signaling and the levels of tyrosine-phosphorylated forms of EGFR and c-Src and their downstream signaling molecules in response to EBIP and /or dasatinib, as determined by Western blot analysis. The experiment was repeated at least three times. (D) tyrosine kinase activity of EGFR. Lysates from cells treated with respective drugs were immuno-precipitated with EGFR. Protein-sepharose beads complexes were assayed for kinase activity using ELISA based assay. (*p<0.05 compared to EBIP and ¶p<0.05, compared to dasatinib alone). Each value represents mean ± SD of 4 observations. Data in panel (A) and (C) for control and dasatinib are similar to those recently published by our laboratory (25).

EBIP and dasatinib, each alone inhibited the phosphorylation of EGFR and c-Src respectively in MDA-MB-468 cells (Fig. 4C). Again, the combination therapy was much more effective than either agent alone in inhibiting activation of EGFR, c-Src as well as downstream targets Akt and MAPK (Fig. 4C). Dasatinib and /or EBIP inhibited EGFR phosphorylation/activation at both trans- (Tyr 845, mediated by c-Src) and auto- (Tyr 1173) phosphorylation sites. Though dasatinb and EBIP inhibit signaling differentially, the combination therapy, as expected provided a better therapeutic benefit in achieving a greater inhibition of downstream signaling events (Fig. 4C). Likewise, EGFR tyrosine kinase activity was greatly inhibited by the combined therapy (Fig. 4D). At this time, the slight increase in tyrosine kinase activity in response to the combined therapy is not properly understood. This may be due to the involvement of compensatory mechanisms as reported for STAT-3 in response to dasatinib in head and neck cancer and mesothelioma (22, 30).

Combined therapy is more effective in inhibiting the growth of breast cancer cell derived xenografts in SCID mice

The objective of this experiment was to examine the effectiveness of mono vs combination therapy on tumor growth. None of the treatments caused any significant change in body weight indicating no apparent toxicity (data not shown). With respect to tumor growth, dasatinib produced no significant inhibition, while EBIP and the combination therapy significantly reduced tumor growth, suggesting effectiveness of the combination therapy (p < 0.05) (Figs. 5 A & B). Our results show that whereas dasatininb and EBIP each lone caused ∼27% and 59 % inhibition, combination therapy produced a marked ∼ 90% suppression of tumor growth, when compared with the vehicle treated controls (Figs 5 A & B). ANOVA analysis shows that the differences among the groups are significant and the possibility of the results assuming null hypothesis is 0.003 (p < 0.05) (Fig. 5C). More importantly, our data show that growth of the tumor in the combination treatment group was minimal 32 days post-treatment. At this time the tumor volume was only ∼12 % of the vehicle treated control (Fig 5 A).

Fig 5.

Preclinical efficacy trial of EBIP and /or dasatinib in MDA-MB-468 xenografts of SCID mice. Once palpable tumors developed (Day-7), the treatment was initiated with EBIP and /or dasatinib. EBIP (25μg/ animal) was administered subcutaneously (away from tumor), whereas dasatinib (10mg/kg) was given orally (gavage), every other day for 16 days. Changes in tumor weight (A) were recorded during the 55-days experimental period. The results were expressed as mean ± SEM. (B) Breast cancer xenografts weight in mg, among different groups at the end of in vivo investigations, day-55. N= no. of mice per group; SD= standard deviation; CI= confidence interval (C) Results of one-way ANOVA statistical test for the in vivo study. The probability of this result, assuming the null hypothesis, is 0.003

The animals were sacrificed at the end of the 55-day experimental period. To determine whether EBIP reaches the tumor, we analyzed the tissues for the presence of EBIP. Indeed, we saw significant expression of EBIP in the tumors of EBIP-treated mice (Fig. 6A). To determine whether inhibition of tumor growth in SCID mice could be the result of increased apoptosis, we conducted TUNEL assay and examined PARP cleavage in the tumors. As expected, the combined therapy caused a marked induction of apoptosis as as evidenced by the increased number of apoptotic cells and PARP (Figs. 6 B and C). We also analyzed the tumors for relative abundance of phospho-EGFR by immunohistochemistry using anti-phospho-EGFR (Y¹¹⁷³) antibodies. Tumor remnants from mice treated with EBIP or EBIP + dasatinib showed no detectable immunoreactivity for phospho-EGFR, whereas those from the controls and dasatinib-treated mice showed the presence of phospho-EGFR (Supplemental Fig. 3). However, the intensity of phospho-EGFR immunoreactivity in tumors from dasatinib treated mice was weaker than those from the controls (Supplemental Fig. 3).

Fig 6.

Immunohistochemical demonstration of EBIP in the tumor remnants from mice sacrificed at the end of the experimental period. EBIP was detected in the tumor remnants by V5-antibody staining. The photomicrograph on the left is from a vehicle-treated animal while the one on the right is from an EBIP-treated animal (A), changes in number of apoptotic cells (B) as determined by TUNEL staining and levels of uncleaved PARP (C) as determined by Western blot analysis. Protein extracts were made from the tumor remnants.

Discussion

Interference with activation of EGFR and/or its family members represents a promising strategy for the development of targeted therapies against a wide variety of epithelial cancers because of their preponderance in a variety of neoplastic cells. Indeed, several inhibitors of EGFRs have been developed to interrupt the intracellular signaling induced by activation of EGFR (8, 31, 32). Small molecule inhibitors of EGFR, gefitinib (Iressa™) and erlotinib (Tarceva™), approved by the FDA, have now been used for treatment of many epithelial cancers including breast cancer, but with limited success (8, 31). Although monoclonal antibodies against EGFR (cetuximab) and HER-2 (trastuzumab) showed signs of success in a limited number of patients with tumors that expressed high levels of EGFR or HER-2, failure in others may partly be due to the fact that most solid tumors express more than one member of the EGFR family, and co-expression of multiple EGFR family members leads to an enhanced transforming potential and worsened prognosis (33). Therefore, identification of inhibitor(s), targeting multiple members of the EGFR family, is likely to provide a therapeutic benefit to a broad range of patient population.

Our current data suggest that EBIP, as has been reported for ERRP (13), is a potential pan-ErbB inhibitor targeting multiple members of the EGFR family. This inference is supported by the observation that EBIP inhibits the growth of several breast cancer cells that express varying levels of different EGFRs. We further show that EBIP forms hetero-dimer with EGFR in MDA-MB-468 cells resulting in decreased EGFR signaling. The fact that daily administration of EBIP leads to a significant reduction in the growth of SCID mice xenografts of breast cancer MDA-MB-468 cells, that express very high levels of EGFR and little or no other ErbBs, further corroborates our postulation that EBIP could be used to inhibit growth of EGFR expressing tumors. This and the fact that EBIP also inhibits growth of several other breast cancer cells that express other members of the EGFR family and also inhibits heregulin-induced activation of HER-2 and HER-3 in breast cancer cells suggest that EBIP, as has been reported for ERRP (8) could potentially be a pan-ErbB inhibitor.

Although the precise mechanisms by which EBIP inhibits activation of EGFR and its family members and in turn cellular growth are not fully understood, earlier studies with ERRP suggests that this peptide, which is structurally and functionally similar to EBIP, inhibits EGFRs function by sequestering EGFRs ligand(s) leading to heterodimerization with one of the EGFR family members, which is functionally inactive (12). We believe that the similar phenomenon is responsible for the growth inhibitory properties of EBIP, since EBIP contains the ligand binding domain of EGFR. The possibility that ectodomains of EGFR inhibit EGFRs signaling by sequestering their ligands comes from the observation by Garrett et al that a truncated EGFR with only 3 of the 4 extracellular subdomains binds EGF and TGF-α with at least ten-fold higher affinity than the full-length extracellular domain of EGFR rendering them unavailable for binding to and activation of receptors (34). Since EBIP, like ERRP, lacks most of the extracellular domain IV, it is reasonable to predict that EBIP will also be effective in preferentially binding/sequestering ligands of EGFR. Our current data support this contention in that EBIP co-immunoprecipitated with EGFR after induction with TGF-α.

In addition to EGFRs, aberrant activation of c-Src has been observed in many solid tumors including breast cancers (35-42). Furthermore, co-overexpression of EGFRs and c-Src has been shown to be associated with higher incidence of metastasis and poor survival (30, 43-47). Because of Src's involvement in the development and progression of many solid tumors, several Src inhibitors including dasatinib, have been tested in solid tumors, but with limited success (21, 23, 47). This could partly be due to the presence and dominance of compensatory pathways in the cancer cells. For instance, STAT-3 pathway is inhibited by dasatinib transiently and through a compensatory pathway (30), and is re-activated as early as 24h (22). It has been suggested that STAT-3 inhibitors show synergistic interactions with dasatinib in HNSCC (22). Therefore, in order to achieve a better therapeutic efficacy, targeting multiple pathways simultaneously is warranted. Our observation that dasatinib together with EBIP causes greater inhibition of growth of breast cancer cells in vitro and in vivo supports our postulation that simultaneous targeting of multiple signaling pathways is an effective therapeutic strategy. We do believe this is first of a kind study that demonstrates the effectiveness of a combination therapy of EGFR and Src inhibitors in breast cancer.

In conclusion, our data show that (a) EBIP is a potential pan-ErbB inhibitor with anti-tumor activity, (b) EBIP synergizes with dasatinib to suppress growth of several breast cancer cells expressing varying levels of EGFRs, and (c) the combination therapy is much more effective in inhibiting of the growth of breast cancer cell derived xenografts than monotherapy. We suggest that the combination therapy of EBIP and dasatinib is a potential strategy for the treatment of triple negative breast cancer.