Skip to main content
NCBI home page
International Journal of Experimental Pathology logoLink to International Journal of Experimental Pathology
. 2010 Jun;91(3):210–223. doi: 10.1111/j.1365-2613.2009.00697.x

Potential role of CXCL10 in the induction of cell injury and mitochondrial dysfunction

Lipi Singh *, Sunil Kumar Arora †, Dapinder K Bakshi ‡, Siddarth Majumdar ‡, Jai Dev Wig *
PMCID: PMC2884089  PMID: 20041963

Abstract

Chemokines have been known to play a critical role in pathogenesis of chronic pancreatitis and acinar cell death. However, the role played by one of the CXC chemokines: CXCL10 in regulation of acinar cell death has remained unexplored. Hence, this study was designed to assess the role of CXCL10 promoting apoptosis in ex vivo cultured acinar cells. Primary human pancreatic acinar cell cultures were established and exposed to varying doses of CXCL10 for different time intervals. Apoptotic induction was evaluated by both qualitative as well as quantitative analyses. Various mediators of apoptosis were also studied by Western blotting, membrane potential (Ψm) and ATP depletion in acinar cells. Analysis of apoptosis via DNA ladder and cell death detection – ELISA demonstrated that CXCL10 induced 3.9-fold apoptosis when administrated at an optimal dose of 0.1 μg of recombinant CXCL10 for 8 h. Quantitative analysis using FACS and dual staining by PI-annexin showed increased apoptosis (48.98 and 53.78% respectively). The involvement of upstream apoptotic regulators like pJNK, p38 and Bax was established on the basis of their increased expression of CXCL10. The change of Ψm by 50% was observed in the presence of CXCL10 in treated acinar cells along with enhanced expression of Cytochrome C, apaf-1 and caspase 9/3 activation. In addition, ATP depletion was also noticed in CXCL10 stimulated acinar cells. CXCL10 induces cell death in human cultured pancreatic cells leading to apoptosis and DNA fragmentation via CXCR3 signalling. These signalling mechanisms may play an important role in parenchymal cell loss and injury in pancreatitis.

Keywords: acinar cells, apoptosis, chronic pancreatitis, CXCL10, pancreas

Chronic pancreatitis (CP) is an inflammatory process that is characterized by irreversible destruction of pancreas with progressive loss of both exocrine and endocrine leading to acinar cell death. Although apoptosis plays an important role in acinar cell loss (Walker et al. 1993; Bateman et al. 2002), the mechanism underlying cell death remains largely unexplored. Various factors responsible for triggering apoptosis have been reported viz signals mediating tissue involution, differentiation, or immune response critical for the removal of infected or transformed cells (Delaney et al. 1997). Furthermore, cytokines, especially CXC chemokines, have been demonstrated to play a crucial role in apoptotic signalling involving human hepatic and pancreatic islet cells (Fair & Olive 1995; Hoorens 1996; Jaeschke & ML 2004).

Recently, we reported overexpression of CXC chemokine CXCL10 and its receptor CXCR3 in patients suffering from CP (Singh et al. 2007). Although CXCL10 has been identified as a mediator of tumour necrosis in vivo (Sgadari et al. 1996) and HeLa cells apoptosis in vitro (Zhang et al. 2005), it is not known whether CXCL10 can directly induce apoptosis in pancreatic acinar cells and, if so, what signalling pathways are involved. Moreover, the expression of the various apoptotic and anti-apoptotic markers and their role in promoting or preventing apoptosis as well as their regulation by CXCL10 in CP need further delineation. This study was carried out to assess the role of CXCL10 in induction of apoptosis of pancreatic acinar cells in vitro.

Materials and methods

Chemicals

All the chemicals were of analytical and molecular grade. Recombinant CXCL10 was procured from BD Bioscience (San Jose, CA, USA). RNA extraction was carried out by RNA Extraction Kit (Qiagen, Germany). For apoptotic studies, various kits had been used such as apoptotic DNA Ladder Kit (Roche, Germany), cell death detection ELISA kit (Roche), fluorescent dUTP using APO-Direct Kit (BD Pharmingen, USA), caspase fluorescent assay kit (BD Biosciences). DiOC6(3): 3,3′-dihexyloxacarbocyanine iodide is obtained from Calbiochem (San Diego, CA, USA) for mitochondrial staining and ATP was measured by leuciferin-leuciferase bioluminescence kit (Promega Enliten, Madison, WI, USA). Antibodies used in this study were procured from Santa Cruz Biotechnology, Inc., CA, USA and BD Pharmingen (Table 1).

Table 1.

Antibodies used in the study

Antigen Antibody clone Western blot Source
pJNK Mab pJNK clone 41 1 μg/ml (1:250) BD Pharmingen
p38 Polyclonal C-20 0.2 μg/ml (1:1000) Santa Cruz Biotechnology, Inc.
ERK1/2 Polyclonal C-16 0.2 μg/ml (1:1000) Santa Cruz Biotechnology, Inc.
p53 Mab p53 clone 1801 0.5 μg/ml (1:400) Santa Cruz Biotechnology, Inc.
Bax Mab Bax clone B-9 0.4 μg/ml (1:500) Santa Cruz Biotechnology, Inc.
Bcl-2 MabBcl-2 clone 100 0.5 μg/ml (1:400) Santa Cruz Biotechnology, Inc.
cyt C Mab cyt C clone 7H8 0.8 μg/ml (1:250) Santa Cruz Biotechnology, Inc.
Apaf-1 Mab Apaf-1 clone 24 1 μg/ml (1:250) BD Pharmingen
Caspase 9 Polyclonal 0.25 μg/ml (1:1000) Santa Cruz Biotechnology, Inc.
Caspase 3 Mab Caspase 3 clone E-8 0.4 μg/ml (1:500) Santa Cruz Biotechnology, Inc.
Open in a new tab

Primary culture of pancreatic acinar cells

Human pancreatic acinar cells culture was established (Singh et al. 2008) by collagenase digestion method and cultured in optimized M199 media supplemented with antibiotics containing 10% foetal calf serum (FCS, heat inactivated) at 37 °C in humidified atmosphere of 5% CO2. The viability and purity of acinar cells were confirmed using 0.1% Trypan blue (Sigma, USA), Giemsa, H&E and PAS staining. About 60–70% confluent cell cultures were used in all experiments. For further studies, 5 × 106–1 × 106 cells were cultured in serum free M199 media for 6 h and incubated both in the absence and presence of different concentrations of the recCXCL10 (40, 80 and 100 ng) for different time intervals (0, 4, 8 and 12 h). The cultured acinar cells were used for further experiments. The morphology of the cells was observed using inverted microscope (40×).

cDNA synthesis and real-time quantitative RT-PCR

Cultured pancreatic acinar cells, 2 × 106 cells/2 ml 199 M/ml, were seeded onto six well culture plates incubated with 100 ng of recIP-10/CXCL10 for 8 h, and total RNA was extracted using RNA extraction kit (Qiagen). Cells were lysed in 500 μl of highly denaturing guanidine isothiocynate buffer as per manufacturer’s instructions, the proteins were salt precipitated and the nucleic acids in the supernatant were precipitated with isopropanol and centrifuged at 10,000 rpm/10 min. The pellet was re-suspended and loaded onto the Qiagen – tip. Residual protein was removed with a medium salt wash, and intact RNA was selectively eluted with an elution buffer and precipitated with isopropanol. RNA pellet was washed with 70% ethanol and was dissolved in DEPC-treated sterile water.

Total RNA (1 μg) was used for synthesis of cDNA using first strand cDNA synthesis kit (Roche). Briefly, RNA was incubated with 1.6 g of Oligo P (dT)15, 1 mM of deoxynucleotide (dNTP) mix, 5 mM MgCl2, 20 units of RNase free Avian Myeloblastosis Virus-reverse transcriptase and 50 units of RNase inhibitor at 42 °C for 1 h, followed by further incubation at 99 °C for 5 min and subsequent cooling at 4 °C for 5 min.

The relative expression of CXCR3-A and CXCR3-B was checked in culture pancreatic acinar cells by real-time quantitative RT-PCR (StratageneMX 3000p, USA) using 2× Brilliant SYBER Green QPCR master mix (Stratagene). Briefly, QPCR was performed in a total volume of 25 μl amplification mixture containing 1 μl cDNA, 0.5 pm each primer (Feldman et al. 2006), 12.5 μl 2× Brilliant SYBER Green QPCR master mix. Thermal cycling was initiated at 50 °C for 2 min, followed by a first denaturation step at 95 °C for 10 min and continued with 40 cycles for described condition (Table 2). Gene expression was then normalized to β-actin gene expression. Each sample was analysed in triplicates.

Table 2.

Oligonucleotide primers used for receptor gene detection

cDNA Primer sequence (5′–3′) Annealing temp (°C)
CXCR3-A CAGGTGCCCTCTTCAACATCA 53
ATGTTCAGGTAGCGG TCAAAGC
CXCR3-B TGCCAGGCCTTTACACAGC 55
TCGGCGTCATTTAGCACTTG
Open in a new tab

Apoptotic studies

DNA fragmentation assay

The cultured acinar cells were processed for DNA isolation and evaluated using apoptotic DNA Ladder Kit (Roche) according to the manufacturer’s instruction. The effect of inhibitors (caspase 9 and caspase 3 inhibitors, 50 μM each) was observed by adding them into the cultured acinar cells 45 min prior to the completion of incubation with CXCL10.

Cell death detection

ELISA The extent of CXCL10 induced apoptosis in pancreatic acinar cells was analysed by cell death detection ELISA kit (Roche) according to the manufacturer’s instruction. Cell death detection ELISA (CDD-ELISA) is based on the quantitative detection of histone-associated DNA fragments in mono and oligonucleosomes (a marker for apoptotic cells). The acinar cell suspension (prepared as described above) was centrifuged (1000 rpm, 5 min), subsequently washed with phosphate buffer saline (PBS) and suspended in 250 μl incubation buffer at room temperature for 30 min. The lysate was centrifuged (10,000 rpm, 15 min), followed by careful removal of 100 μl supernatant without disturbing the pellet containing high molecular weight unfragmented DNA. The supernatant was diluted 1:10 in incubation buffer and used for ELISA according to manufacturer’s instructions. The results were expressed as apoptotic index (ratio of the absorbance of recCXCL10 treated cells to control cells), which was directly related to the percentage of cell death.

Flow cytometric analysis of DNA end labelling

DNA strand breaks were measured in pancreatic acinar cells by fluorescent dUTP using APO-Direct Kit (BD Pharmingen). Briefly, the acinar cell suspension was washed thrice with PBS to which an equal amount of 1% paraformaldehyde (prepared in PBS) was added and incubated at 4 °C for 15 min. Subsequently, 6 ml of chilled 70% alcohol was added, properly mixed and FITC-dUTP staining was performed according to the manufacturer’s instructions. To analyse the effect of caspase 9 and 3 inhibitors, 50 μm of inhibitors were added 45 min prior to incubation. The cells were analysed by flow cytometery using cell Quest software program, and the percentage of gated cells (FITC positive) was compared in each of the treatments.

Monitoring the presence of phosphatidylserine (PS) on apoptotic cells

Pancreatic acinar cells were stained with propidium iodide (PI) (2 μl of 50 μg/ml PBS) both in the absence and in presence of annexin-V-Fluos (2 μl; Roche) followed by incubation for 15 min in dark at room temperature. Hundred microliters of diluted cell suspension was analysed by flow cytometery using 488 nm excitation and a 515 nm band pass filter for fluorescein detection and a filter >600 nm for PI detection, using cell Quest Software program.

Analysis of expression of regulatory proteins (pJNK, p38, ERK1/2, p53, Bax, Bcl-2, cytochrome C, Apaf-1) and effector molecules (caspase 9, caspase 3)

Western blotting

2 × 106 acinar cells/2 ml M 199 (199 Media) were incubated with recCXCL10 of two different doses (80 ng and 100 ng) for different time intervals (0, 4, 8 and 12 h). For MAP kinase expression study, more time points, i.e. 30 min and 1 h, were also included. The cells were washed twice with PBS and lysed with 270 μl of lysis buffer followed by incubation at 4 °C for 30 min (Bui et al. 1995). Cell lysate was centrifuged (10,000 rpm, 20 min) to remove debris, and protein estimation was performed by Bicinchoninic Acid method (Smith et al. 1985). A total of 60 μg protein was run on sodium dodecyl sulphate polyacrylamide gelelectrophoresis (SDS–PAGE, 10%), and Western blotting was performed by the method of Towbin et al. (Towbin et al. 1979). Blots were developed using 0.05%.

3,3′-diaminoBenzidine tetrahydrochloride in PBS containing H2O2 (1 μl/ml) for 30 min in dark at 37 °C. Reaction was stopped by washing the strips with water. The protein markers [β-galactosidase (118 kDa), bovine serum albumin (86 kDa), ovalbumin (47 kDa), carbonic anhydrase (34 kDa), β-lactoglobulin (26 kDa) and lysozyme (19 kDa), Biomol, Germany] were run in parallel. For studying the cytochrome C expression in acinar cells, mitochondrial and cytosolic fraction was prepared (Bossy-Wetzel et al. 1998), separated on 12% SDS–PAGE, electroblotted on to polyvinylidenedifluoride membrane and detected by antibodies as described in Table 1. JNK peptide inhibitor (100 μM), caspase 9 and caspase 3 inhibitors (50 μM each) were used in different experiments of cultured acinar cells. AntiCXCL10 antibody (1:2000, 0.125 μg/ml) was used as negative control in each experiment.

Measurement of caspases (3, 9) activation with fluorimetric assay

In recCXCL10 treated acinar cells, caspase 9 and caspase 3 activation were measured by caspase fluorescent assay kit (BD Biosciences) according to the manufacturer’s instructions. Briefly, acinar cells were lysed and 50 μl of supernatant was taken in new eppendorf. Fifty microliters of 2× reaction buffer/1,1,1,-trichloro-2,2-bis(p-chlorophenyl)ethane mix and 2 μl of caspase 9/caspase 3 inhibitors were added to it, followed by incubation in ice for 30 min. Five microliters of caspase 9/3 (5 mM) substrate was added to each tube and incubated for 1 h at 37 °C. Control reaction was also setup without conjugated substrate. The fluorescence was read in spectrofluorometer (Varian Inc., Australia) with 380 nm excitation and 460 nm emission for caspase 9 and 400 nm excitation and 505 nm emission for caspase 3. The fluorescence was calibrated using standard curve for 7-amino-4-methyl coumarin/7-amino-4- trifluoromethyl coumarin.

Assessment of mitochondrial energization (Ψm) and ATP measurement

Apoptosis-associated alterations in acinar cells were also evaluated by flow cytometry analysis of permeabilized cells stained with the potential-sensitive dye DiOC6(3), which is accumulated in mitochondria (Koning et al. 1993). Loss in DiOC6(3) staining indicates disruption of the mitochondrial inner transmembrane potential (Ψm) associated with apoptosis (Susin et al. 1997). 1 × 106cells/2 ml 199 M were cultured and 50 nM DiOC6(3) was added to the cells half an hour prior to the completion of incubation with recCXCL10. The cells were detached and washed with sterile PBS to remove excess flurochrome. The concentration of retained DiOC6(3) was read in flow cytometery at 488 nm excitation and 500 nm emission.

ATP was measured in cultured acinar cell lysate with a commercially available leuciferin-leuciferase bioluminescence kit (Promega Enliten) according to the manufacturer’s instruction. The readings were taken with 10 S integration on a monolight luminometer. Background luminescence was subtracted and amount of ATP in cultured cells was calculated from the standard curve drawn from series of ATP concentration.

Statistical analysis

Data were expressed as mean ± SD. Statistical analysis was carried out via one-way anova test followed by post hoc test with Bonferroni corrections and student’s t-test. Data were subjected to statistical analysis using the spss for window version 15, and the results were considered significant at P ≤ 0.05.

Results

Expression of CXCR3-A and CXCR3-B in acinar cells

The relative gene expression of CXCR3-A and CXCR3-B was assessed by real-time PCR. The expression of CXCR3-B was 20- to 22-fold higher than CXCR-A in acinar cells without or incubated with IP-10 (100 ng, 8 h), respectively, (Figure S1).

Analysis of morphology, DNA fragmentation and apoptotic Index

The morphological changes in the form of rounded cells and appearance of filamentous protrusions were observed under light microscopy when acinar cells were incubated in the presence of recCXCL10 at different dosages. Maximum morphological changes were observed when acinar cells were incubated with 100 ng of recCXCL10 for a period of 8 h (Figure 1a). The extent of CXCL10 induced apoptosis as analysed by CDD-ELISA showed variation in absorbance at 492 nm by cytoplasmic fraction of acinar cell when treated with different concentration of CXCL10 corresponding to various numbers of mono and oligonucleosomes within the cells (Figure 1b,c). The AI increased 4-fold at dose of 100 ng of recCXCL10 when incubated for 8 h compared with control.

Figure 1.

Figure 1

Open in a new tab

Apoptosis of pancreatic acinar cells treated with recCXCL10. (a) Altered morphology of treated acinar cells (100 ng, 8 h) as seen under the light microscope; (b,c) Detection of nucleosomes in cytoplasmic fractions of pancreatic acinar cells with Dose (b), Time (c) profile. (d) DNA fragmentation pattern of recCXCL10 treated pancreatic acinar cells with Dose profile [L1: 100 bp DNA ladder; L2: positive control; L3: Control (cells only); L4–L7: DNA treated with different recCXCL10 dosages (40, 60, 80 and 100 ng) for 8 h. L8: Caspase 9 inhibitor (50 mM); L9: Caspase 3 inhibitor (50 mM)]. (e) DNA fragmentation pattern of recCXCL10 treated pancreatic acinar cells with Time profile [L1: 100 bp DNA ladder; L2: positive control; L3: Control (cells only); L4–L5: DNA treated with 100 ng recCXCL10 for 4 and 8 h. L6: Caspase 9 inhibitor (50 mM); L7: Caspase 3 inhibitor (50 mM)]. (f) Apoptotic bodies in treated acinar cells as seen under fluorescent microscope. (o.m. 40×). (g) DNA end labelling in recCXCL10 treated acinar cells: %apoptosis represented as mean fluorescent intensity (MFI). (h) Annexin-V fluos and propidium iodide staining of recCXCL10 treated acinar cells: Percentage apoptosis represented as MFI. Data shown are expressed as mean ± SD. Statistical analysis was calculated via one way anova test followed by post hoc test with Bonferroni corrections. ***P < 0.001; **P < 0.01.

Although, internucleosomal DNA fragmentation was observed with all doses of recCXCL10 compared with untreated cells, however, DNA ladder was prominent at 100 ng recCXCL10 incubated for 8 h (Figure 1d,e). The caspase inhibitors 9/3 (LEHD-CHO/DEVD-CHO, each 50 μM) blocked CXCL10-induced DNA laddering in cultured acinar cells.

Flow Cytometeric analysis of DNA end libelling

Fluorescent microscopy revealed the altered morphology of acinar cells showing apoptotic nuclei (fragmented chromatin) on incubation with recCXCL10, with the most prominent morphology alteration in presence of 100 ng recCXCL10 for 8 h. Significant increase in FITC-dUTP DNA end libelling was seen in pancreatic acinar cells incubated with CXCL10 with maximum increase of 48% with 100 ng CXCL10 for 8 h compared with control (1%) (Figure 1f,g).

Quantification of phosphatidylserine on outer membrane of acinar cells

The present staining sorted three types of cells, i.e. live, apoptotic and necrotic cells and further demonstrated 51% apoptosis in acinar cells in presence of 100 ng CXCL10 at 8 h compared with control (8%) (Figure 1h).

Analysis of expression of regulatory and effector proteins

The expression of regulatory protein like MAP kinase cascades (pJNK, p38, ERK1/2), p53, Bax, Bcl-2, cytochrome C, Apaf-1 and effector protein like caspase 9 and caspase 3 were observed in acinar cells when incubated with CXCL10 as presented in Table 3. The expression of MAP kinase cascade such as activated JNK (pJNK) and p38 was increased in acinar cells to maximum at a dose of 100 ng of IP-10/CXCL10 compared with control (Figure 2a,d,b,e). Expression of pJNK/p38 in pancreatic acinar cells was also found to increase in a time-dependent manner (Figure 2a′,d′,b′,e′ and Figure S2a,b,d,e). Both pJNK/p38 were slightly activated at 30 min, reached maximum at 8 h, but no further significant increase at 12 h was observed. (Figure S2a,b,d,e), suggesting Map Kinase stimulation in cultured acinar cells might be the direct effect of CXCL10. Furthermore, JNK peptide inhibitor (100 μm) specifically downregulated the expression of pJNK in IP-10/CXCL10 treated acinar cells. The anti-IP-10/CXCL10 antibody (anti-IP-10/CXCL10 Mab) also showed inhibitory effects on the expression of pJNK/p38. The other member of MAP kinase family, ERK1/2, showed low activity and no significant increase was observed even with increased dose and prolonged incubation (Figure 2c,f,c′,f′ and Figure S2c,f).

Table 3.

Expression of regulatory and effector proteins

Regulatory/effector protein Molecular weight (kDa) Dose (ng)/time (h) Upregulation/downregulation Max increase/decrease
pJNK 46 100/8 Upregulation 4 ± 0.17; 4 ± 0.13
p38 38 100/8 Upregulation 4 ± 0.12; 4 ± 0.03
ERK1/2 42/44 100/8 No significant change
p53 53 100/8 Upregulation 4.11 ± 0.08; 4.2 ± 0.15
Bax 21 100/8 Upregulation 4.17 ± 0.18; 4.28 ± 0.15
Bcl-2 26 100/8 Downregulation 6-fold ↓
Cytochrome C 10 100/8 Upregulation 4-fold ↑
Apaf-1 130 100/8 Upregulation 4.2 ± 0.1; 4 ± 0.2
Caspase 9 48/37 100/8 Upregulation 8-fold
Caspase 3 32/20/17 100/8 Upregulation 9-fold
Open in a new tab

Figure 2.

Figure 2

Open in a new tab

Western blot analysis for pJNK (a,a′), p38 (b,b′), ERK1/2 (c,c′) expression in recCXCL10 treated acinar cells. (a) Dose profile for pJNK expression [L1: Protein molecular weight marker; L2: control; L3–L4: cells treated with 80 and 100 ng for 8 h; L5: cells with JNK peptide inhibitors (100 mM); L6: cells with antiCXCL10]. (a′) Time profile for pJNK expression [L1: Protein molecular weight marker; L2: control; L3–L6: cells treated with recCXCL10 for 4, 8 and 12 h; L6: cells with JNK peptide inhibitors (100 mM); L7: cells with antiCXCL10]. (b,c) Dose profile for p38 and ERK1/2 expression [L1: Protein molecular weight marker; L2: control; L3–L4: cells treated with 80 and 100 ng for 8 h; L5: cells with antiCXCL10]. (b′,c′) Time profile for p38 and ERK1/2 expression [L1: Protein molecular weight marker; L2: control; L3–L5: cells treated with recCXCL10 for 4, 8 and 12 h; L6: cells with antiCXCL10]. Histograms showing pJNK (d,d′), p38 (e,e′), ERK1/2 (f,f′) expression (d,f: dose profile & d′,f′: time profile) as % of β-actin. Data shown are expressed as mean ± SD. Statistical analysis was calculated via one way anova test followed by post hoc test with Bonferroni corrections. ***P < 0.001; **P < 0.01.

The acinar cells showed increased expression of regulatory proteins like p53, Bax and Apaf-1 in dose and time-dependent manner. Dose profile experiments revealed that the expression of these proteins were maximum in 100 ng recIP-10/CXCL10 treated acinar cells at 8 h (Figure 3a,b,d,e; Figure 4b,f). On the other hand, time profile experiment showed moderate p53, Bax and Apaf-1 activities at 4 h, which dramatically increased at 8 h. Furthermore, there were no significant increases observed in the expression of these proteins at >100 ng, 12 h, whereas the control acin did not reveal such expression at all (Figure 3 a′,b′,d′,e′ and Figure 4b′,f′). The confirmation of role being played by IP-10/CXCL10 in p53, Bax and Apaf-1 expression came with the use of anti-IP-10/CXCL10 antibody, which reduced their expression to a minimum.

Figure 3.

Figure 3

Open in a new tab

Western blot analysis for p53 (a,a′), Bax (b,b′), Bcl-2 (c,c′) in recCXCL10 treated acinar cells. (a,c) Dose profile for p53, Bax and Bcl-2 expression [Lane 1: Protein molecular weight marker; L2: control; L3–L4: cells treated with 80 and 100 ng for 8 h; L5: cells with antiCXCL10]. (a′–c′) Time profile for p53, Bax, and Bcl-2 expression [L1: Protein molecular weight marker; L2: control; L3–L5: cells treated with recCXCL10 for 4, 8 and 12 h; L6: cells with antiCXCL10]. Histograms showing p53 (d,d′), Bax (e,e′) and Bcl-2 (f,f′) expression. (d–f: dose profile & d′–f′: time profile) as % of β-actin. Data shown are expressed as mean ± SD. Statistical analysis was calculated via one way anova test followed by post hoc test with Bonferroni corrections. ***P < 0.001; **P < 0.01.

Figure 4.

Figure 4

Open in a new tab

Western blot analysis for cytochrome C (a,a′), Apaf-1 (b,b′), caspase 9 (c,c′) and caspase 3 (d,d′) in recCXCL10 treated acinar cells. Dose profile for cytochrome C expression in cytosolic/mitochondrial fraction [L1: Protein molecular weight marker; L2/3: control; L4–L7: cells treated with 80 and 100 ng for 8 h; L8/L9: cells with antiCXCL10]. (a′) Time profile for cytc C expression in cytosolic/mitochondrial fraction [L1: Protein molecular weight marker; L2/3: control; L4–L9 cells treated with recCXCL10 for 4, 8 and 12 h; L10/L11: cells with antiCXCL10]. (b) Dose profile for Apaf-1 expression [L1: Protein molecular weight marker; L2: control; L3–L4: cells treated with 80 and 100 ng for 8 h; L5: cells with antiCXCL10]. (b′) Time profile for Apaf-1 expression [L1: Protein molecular weight marker; L2: control; L3–L5: cells treated with recCXCL10 for 4, 8 and 12 h; L6: cells with antiCXCL10]. (c,d) Dose profile for caspase 9 and caspase 3 expression [L1: Protein molecular weight marker; L2: control; L3–L4: cells treated with 80 and 100 ng for 8 h; L5: cells with caspase 9/3 inhibitors (50 mM); L6: cells with antiCXCL10]. (c′,d′) Time profile for caspase 9 and caspase 3 [L1: Protein molecular weight marker; L2: control; L3–L5: cells treated with recCXCL10 for 4, 8 and 12 h; L6: Caspase 9/3 inhibitors (50 mM); L7: cells with antiCXCL10]. Histograms showing cytochrome C (e,e′) and Apaf-1 (f,f′) expression (e,f: dose profile; e′,f′: time profile) as % of β-actin. Data shown are expressed as mean ± SD. Statistical analysis by calculated via one way anova test followed by post hoc test with Bonferroni corrections. ***P < 0.001; **P < 0.01.

Cytochrome C was measured in cytosolic as well as in membrane fractions at different doses of IP-10/CXCL10 for different time intervals by immunoblot. The increased cytochrome C level in the cytosol with a concomitant decrease in mitochondrial cytochrome C content was observed in IP-10/CXCL10 treated cells in dose and time-dependent manner. The IP-10/CXCL10-induced cytochrome C release was evident at its concentration >80 ng, at 4 h, which was upregulated by 3-fold in both dose as well as time-dependent manner (Figure 4a,e,a′,e′).

The expression of anti-apoptotic Bcl-2 was found to be downregulated by 10-fold and 8-fold in acinar cells in dose as well as time-dependent manner, respectively, when cultured in the presence of 100 ng recIP-10/CXCL10 at 8 h (Figure 2c,c′,f,f′).

Activation of effectors’ proteins such as caspase 9 and caspase 3 in pancreatic acinar cells was detected as processing of their c. 48 kDa proforms and 32, 20 and 17 kDa, respectively, increased with dose and incubation time with the accumulation of 37 kDa subunit of caspase 9 and three forms (32, 20 and 17 kDa) of caspase 3 (Figure 4c,d,c′,d′).

IP-10/CXCL10 stimulated the proteolytic activity of caspase 9 and caspase 3, which increased in dose as well as time-dependent manner (8.6-fold and 9-fold) in cultured acinar cells (Figure 5a,b,a,b′). The caspase 3/9 inhibitors (LEHD-CHO/DEVD-CHO) and anti-IP-10/CXCL10 antibody blocked the IP-10/CXCL10 induced proteolytic process of both caspase 9 and caspase 3 in pancreatic acinar cells.

Figure 5.

Figure 5

Open in a new tab

Quantitative measurement of caspase enzyme activity in recCXCL10 treated cells: Histograms showing caspase 9 and caspase 3 activity (a,b) dose profile (nmol/h protein); (a′,b′) time profile (nmol/mg protein). Measurement of mitochondrial membrane potential (Ψm) in recCXCL10 treated cells by FACS analysis: Histograms showing Ψm (c) dose profile; (c′) time profile. ATP levels in recCXCL10 treated acinar cells: Histograms showing ATP levels (d) dose profile (nmol/h protein) (d′) time profile (nmol/mg protein). Data shown are expressed as mean ± SD. Statistical analysis was calculated by one way anova test followed by post hoc test with Bonferroni corrections. ***P < 0.001; **P < 0.01.

Assessment of mitochondria energization

CXCL10 induced pronounced mitochondrial depolarization in pancreatic acinar cells at concentration ≥80 ng at 4 h as shown in (Figure 5c,c′). The level of DIOC6(3) retained by untreated cells was considered to be 100%. Mean fluorescent intensity measured in control was 1680 ± 100, whereas in recCXCL10 treated cells in different doses: 40, 60, 80, 100 and 120 ng were 1511 ± 90, 1388 ± 102; 1057 ± 110; 958 ± 120; and 620 ± 50 respectively. The time profile showed mean fluorescent intensity: 1362 ± 100, 856 ± 90 and 630 ± 60 for 4, 8 and 12 h of incubation with 100 ng of recCXCL10, respectively, compared with control (1751 ± 130).

ATP measurement

Intracellular ATP was measured with ATP curve in cultured pancreatic acinar cells in presence and in the absence of recCXCL10 at different doses and time intervals. ATP was depleted in CXCL10 treated cells with increasing dose and time (Figure 5d,d′). Maximum depletion of ATP was observed (>80%) in acinar cells treated with 120 ng of recCXCL10 at 12 h.

Discussion

Cell death by apoptosis is a highly conserved evolutionary process for deleting senescent, damaged, redundant and deleterious cells from the organism. Looking at the role the apoptosis plays in physiology, dysregulation of apoptosis occurs frequently during pathophysiological disturbances, which trigger the cellular apoptotic machinery leading to rapid and extensive cell death and tissue dysfunction. Unfortunately, there is a lack of information regarding physiological mediators of pancreatic cell apoptosis either in health or disease. Acinar cell regulation in terms of growth, gene expression and translational control of protein synthesis is mediated by signalling cascade involving number of intracellular signalling pathways, which are activated by membrane receptors on pancreatic acinar cells. Cumulative efforts from various laboratories over the past decade have allowed the elucidation of one of the most prominent cascade – the mitogen activated protein kinase (MAPK) also called as extracellular signal regulated kinase (ERK) cascade (Post & Brown 1996), which is an information highway used by many growth factors and hormones responsible for triggering proliferation and cell differentiation.

Parallel to MAPK signalling cascades, two novel cascades, culminating in c-Jun amino-terminal kinases (JNKs) also known as stress-activated protein kinases (JNK/SAPK’s) and p38 MAPK (belong to MAPK cascade family) are activated by stressful stimuli leading to growth arrest and cell death (Cano & Mahadevan 1995). These mentioned MAPK signalling cascades have been evaluated in pancreatic acinar cells (Dabrowski et al. 1997; Williams et al. 1997). Reports postulate that JNK/SAPK and p38 MAPK pathways are predominantly activated by stressful stimuli including osmotic/heat shock, ionizing radiation, ROS and inflammatory cytokines leading to growth arrest and cell death (Post & Brown 1996), whereas ERK activity declines under such condition.

As our laboratory has already established the upregulated expression of CXCL10, both at mRNA and protein level in pancreatic tissues from CP patients (Singh et al. 2007) compared with normal, in this study, we wanted to evaluate the role of CXCL10 in regulation of acinar cell death in vitro. For this, we established the long-term primary culture of human foetal (≥35 weeks) acinar cells for the first time (Singh et al. 2008). The cultured acinar cells were incubated with different dosages for different time duration and analysed for expression of various apoptotic regulators, effector molecules. At the onset, morphology of acinar cells exposed to CXCL10 was checked, which confirmed the formation of apoptotic bodies. CDD-ELISA and DNA ladder assay also supported the initiation of apoptotic process in vitro and confirmed optimum apoptosis at 0.1 μg of CXCL10 for 8 h. Furthermore, quantitative analysis by DNA end labelling and annexin-V positivity assay revealed 48 and 51% apoptosis, respectively, in CXCL10 triggered acinar cells at the optimal concentration. Reports from literature have cited role of various chemokines like TNF-α, platelet activating factors in potentiating apoptosis in acinar cells both in vivo and in vitro (Gukovskaya et al. 1997), but the exact role of CXCL10 in initiating apoptosis in acinar cells has not been reported.

The evaluation of the expression of various apoptotic regulators, i.e. pJNK, p38, ERK1/2 in acinar cells exposed to CXCL10 in dose and time-dependent manner showed the low reactivity of ERK-1/2 and significant upregulation of JNK/p38 kinase in accordance with other studies (Cano & Mahadevan 1995; Dabrowski et al. 1997; Williams et al. 1997). p38 kinase plays a prominent role in stabilization of tumour suppressor p53 by regulating N-terminal phosphorylation, which further regulates p53-mediated apoptosis in response to external stimuli (Bulavin et al. 1999). The results are suggestive of specific interactions among ERK, p38 and JNK signalling pathways for initiating apoptosis by pancreatic acinar cells under stressful stimuli viz inflammatory cytokine, stress kinase, Jun-NH2 kinase (JNK), which have been linked up with p53 stability (Fuchs et al. 1998; Buschmann et al. 2001). Analysis of p53 in this study showed its overexpression in acinar cells treated with CXCL10. This was confirmed by the use of antiCXCL10 in vitro, which led to downregulation of p53 expression, which could either be directly attributable to DNA damage or via activation of JNK pathway. Furthermore, we wanted to evaluate the role of CXCl10 on expression of various pro- and anti-apoptotic markers in CXCl10 treated pancreatic acinar cells. The downregulation of the expression of anti-apoptotic Bcl-2 and upregulated expression of proapoptotic Bcl-2 family member: Bax was observed in presence of optimal 100 ng dose of CXCL10 at 8 h incubation, suggestive of regulatory role being played by CXCL10 in mediating the apoptosis. This observation also correlates very well with in vivo studies, where upregulation of BAX and downregulation of Bcl-2 have been reported in acinar cells of murine model of pancreatitis (Wada et al. 1997; Fadeel et al. 1999; Marko et al. 2000).

Bcl-2 family proteins located on mitochondrial membrane play a very important role in regulation of apoptosis. It is ratio between anti-apoptotic Bcl-2 and proapoptotic Bax, which regulates the opening of mitochondrial permeability transition (MPT) pore, which results in the release of soluble proteins: cytochrome C and Apoptosis-Inducing Factor (AIF) from the intermembrane space (Gross et al. 1999; Zamzami & Kroemer 2001). Recent report has suggested overexpression of Bcl-2 to cause increased retention of these apoptogenic factors by mitochondria (Yang & Zoeller 2002). Hence, to gain clarity on expression of cytochrome C, AIF and mitochondrial permeabilization in the presence of CXCL10, further in vitro assays on these molecules were carried out. The data indicated dose as well as time dependent increase in cytochrome C level in cytosol with concomitant decrease in mitochondrial cytochrome C content, upregulation of Apaf-1 expression, but lower mitochondrial potential. The findings are consistent with reports from other authors who have demonstrated overexpression of cytochrome C and Apaf-1 in pancreatitis and some neurodegenerative diseases (Gukovskaya et al. 2002; Scholz et al. 2005; Singh et al. 2008).

Efflux of cytochrome C from mitochondria drives the assembly of a high molecular weight caspase-activating complex in the cytoplasm termed as mitochondrial apoptosome (Gukovskaya et al. 2002). Once activated, caspases can cleave other caspases thereby generating an intracellular protease cascade leading to cellular demise (Budihardjo et al. 1999; Susina et al. 2000). Caspases also cleave a variety of substrates involved in activities that lead to dismantling of the cell such as disruption of organelle function and cytoskeletal and nuclear disassembly, resulting in the typical hallmark features of apoptotic cell death. Hence, in this investigation, the effect of CXCL10 on expression of caspases like caspase 9 and 3 was evaluated, which were found to increase in dose as well as time-dependent manner in stimulated pancreatic acinar cells. The application of antiCXCL10 antibody and caspase inhibitors resulted in downregulation of these caspases suggesting inhibition of caspase activation in vitro, which confirmed CXCL10 induced apoptosis in pancreatic acinar cells via caspase 3 dependent pathways in similar lines as reported by Mareninova et al. (Mareninova et al. 2006). Similar in vitro studies where expression of caspases 3, 8, 9 upregulated in the presence of agents such as hydrogen sulphate, crambene (1-cyno-2-hydroxy-3-butene), a plant nitrile induced apoptosis in murine cultured pancreatic acinar cells (Cao et al. 2006). This study also demonstrated inhibition of apoptotic process in CXCL10-triggered acinar cells in presence of caspase 9/3 inhibitors, which suggested caspase activation to be clearly the upstream event in progression of apoptosis in CP.

In cells, mitochondrial permeability transition can be triggered by a variety of stimuli acting on the mitochondria directly, or by yet unknown upstream controller, which may be further modulated by availability of ATP. The latter may be provided by glycolysis or in tissues with high metabolic demand, primarily by the mitochondria. The evaluation of ATP levels in the presence of CXCL10 treated acinar cells showed drastic depletion of ATP concentration with maximum loss of ATP at the highest dose of 120 ng of CXCL10 for 12 h. ATP depletion in apoptosis during pancreatitis has also been demonstrated by other authors (Ha & Snyder 1999; Cosen-Binker et al. 2006).

More recently, two different isoforms of chemokine receptor CXCR3, namely CXCR3-A (activating) and CXCR3-B (inhibitory), with two distinct effects have been cloned. CXCR3-A mediates the chemotactic, anti-apoptotic and pro-proliferative effects of CXCL10/IP-10, CXCL9/Mig and CXCL11/I-TAC, whereas CXCR3-B is responsible for the anti-proliferative and pro-apoptotic effects (Giuliani et al. 2006). It is interesting to note in our study that acinar cells have a predominance of CXCR3B, the inhibitory receptor and this may explain the selective effects of IP-10 on apoptosis in cultured acinar cells. This investigation reveals CXCL10 at its optimal level, although its receptor CXCR3 stimulates death signalling mechanisms in pancreatic acinar cells, including MAP kinase activation (pJNK, p38), upregulation of p53 and proapoptotic BAX, downregulation of anti-apoptotic Bcl-2. CXCL10 further causes the mitochondrial alteration through loss of mitochondrial transmembrane potential (Ψm) and cytochrome C release, which is being mediated by some upstream caspases, which in turn leads to activation of caspase 9 and caspase 3 causing DNA fragmentation and ultimately apoptosis in acinar cells. In addition, this study also suggested that MAP Kinase stimulation in cultured acinar cells could be attributable to the direct effect of CXCL10. Thus, it is conceivable that cross talk among several pathways may lead to CXCL10 induced apoptosis in cultured pancreatic acinar cells. In conclusion, the study is suggestive of role of CXCL10 and its receptor CXCR3 might be playing in parenchyma cell death and injury during the course of progression of CP.

Supporting Information

Additional Supporting Information may be found in the online version of this article:

Figure S1 Real-Time quantitative RT-PCR for CXCR3 variants in cultured acinar cells plated without and with 100 ng of recIP-10/CXCL10 for 8 h (**P < 0.01, Student's t-test).

iep0091-0210-SD1.tif (1.8MB, tif)

Figure S2 Western blot analysis for pJNK (a,a′), p38 (b,b′), ERK1/2 (c,c′) expression in recCXCL10 treated acinar cells.

iep0091-0210-SD2.tif (10.4MB, tif)

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

References

  1. Bateman AC, Turner SM, Thomas KS, et al. Apoptosis and proliferation of acinar and islet cells in chronic pancreatitis: evidence for differential cell loss mediating preservation of islet function. Gut. 2002;50:542–548. doi: 10.1136/gut.50.4.542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bossy-Wetzel E, Newmeyer DD, Green DR. Mitochondrial cytochrome c release in apoptosis occurs upstream of DEVD-specific caspase activation and independently of mitochondrial transmembrane depolarization. EMBO J. 1998;17:37–49. doi: 10.1093/emboj/17.1.37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Budihardjo I, Oliver H, Lutter M, Luo X, Wang X. Biochemical pathways of caspase activation during apoptosis. Annu. Rev. Cell. Dev. Biol. 1999;15:269–290. doi: 10.1146/annurev.cellbio.15.1.269. [DOI] [PubMed] [Google Scholar]
  4. Bui KC, Buckley S, Wu F, Uhal B, Joshi I, Liu J. Induction of A- and D type cyclins and cdc2 kinase activity during recovery from short-term hyperoxic lung injury. Am. J. Physiol. 1995;268:625–635. doi: 10.1152/ajplung.1995.268.4.L625. [DOI] [PubMed] [Google Scholar]
  5. Bulavin DV, Saito S, Hollander MC, et al. Phosphorylation of human p53 by p38 kinase coordinates N-terminal phosphorylation and apoptosis in response to UV radiation. EMBO J. 1999;18:6845–6854. doi: 10.1093/emboj/18.23.6845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Buschmann T, Potopova O, Bar-Shira A. Jun NH2-termainal kinase phsophorlyation of p53 and Thr-81 is important for p53 stabilization and transcriptional activities in response to stress. J. Biol. Chem. 2001;21:2743–2754. doi: 10.1128/MCB.21.8.2743-2754.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cano E, Mahadevan LC. Parallel signal processing among mammalian. MAPKs. Trends Biochem. Sci. 1995;20:117–122. doi: 10.1016/s0968-0004(00)88978-1. [DOI] [PubMed] [Google Scholar]
  8. Cao Y, Adhikari S, Ang AD, Moore PK, Bhatia M. Mechanism of induction of pancreatic acinar cell apoptosis by hydrogen sulfide. Am. J. Physiol. Cell Physiol. 2006;291:503–510. doi: 10.1152/ajpcell.00547.2005. [DOI] [PubMed] [Google Scholar]
  9. Cosen-Binker LI, Binker MG, Cosen R, Negri G, Tiscornia O. Relaxin prevents the development of severe acute pancreatitis. World J. Gastroenterol. 2006;12:1558–1568. doi: 10.3748/wjg.v12.i10.1558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dabrowski A, Groblewski GE, Schafer C. Cholecystokinin and EGF activate a MAPK cascade by different mechanisms in rat pancreatic acinar cells. Am. J. Physiol. 1997;273:1472–1479. doi: 10.1152/ajpcell.1997.273.5.C1472. [DOI] [PubMed] [Google Scholar]
  11. Delaney CA, Pavlovic D, Hoorens A. Cytokines induce deoxyribonucleic acid strand breaks and apoptosis in human pancreatic islet cells. Endocrinology. 1997;138:2610–2623. doi: 10.1210/endo.138.6.5204. [DOI] [PubMed] [Google Scholar]
  12. Fadeel B, Zhivotovsky B, Orrenius S. All along the watchtower: on the regulation of apoptosis regulators. FASEB J. 1999;13:1647–1654. doi: 10.1096/fasebj.13.13.1647. [DOI] [PubMed] [Google Scholar]
  13. Fair Brains DW, Olive PL. The commet assay: a comprehensive review. Mutat. Res. 1995;339:37–59. doi: 10.1016/0165-1110(94)00013-3. [DOI] [PubMed] [Google Scholar]
  14. Feldman ED, Weinreich DM, Carroll NM, et al. Interferon gamma-inducible protein 10 selectively inhibits proliferation and induces apoptosis in endothelial cells. Ann. Surg. Oncol. 2006;13:125–133. doi: 10.1245/ASO.2006.03.038. [DOI] [PubMed] [Google Scholar]
  15. Fuchs SY, Adler V, Pincus MR, Ronai Z. MEKK1/JNK signaling stabilizes and activates p53. Biol. Chem. 1998;95:10541–10546. doi: 10.1073/pnas.95.18.10541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Giuliani N, Bonomini S, Romagnani P, et al. CXCR3 and its binding chemokines in myeloma cells: expression of isoforms and potential relationships with myeloma cell proliferation and survival. Haematologica. 2006;91:1489–1497. [PubMed] [Google Scholar]
  17. Gross A, Mc DonnellJN, Korsmeyer SJ. Bcl-2 family members and the mitochondria in apoptosis. Genes Dev. 1999;13:1899–1911. doi: 10.1101/gad.13.15.1899. [DOI] [PubMed] [Google Scholar]
  18. Gukovskaya AS, Gukovsky I, Zaninovic V, et al. Pancreatic acinar cells produce, release, respond to tumor necrosis factor-alpha. Role in regulating cell death and pancreatitis. J. Clin. Invest. 1997;100:1853–1862. doi: 10.1172/JCI119714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gukovskaya AS, Gukovsky I, Jung Y, Mouria M, Pandol SJ. Cholecystokinin induces caspase activation and mitochondrial dysfunction in pancreatic acinar cells. J. Biol. Chem. 2002;277:22595–22604. doi: 10.1074/jbc.M202929200. [DOI] [PubMed] [Google Scholar]
  20. Ha HC, Snyder SH. Poly (ADP-ribose) polymerase is a mediator of necrotic cell death by ATP depletion. Proc. Natl Acad. Sci. U.S.A. 1999;96:13978–13982. doi: 10.1073/pnas.96.24.13978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hoorens A. Glucose promotes survival of rat pancreatic β cells by activating synthesis of proteins, which suppress a constitutive apoptotic programme. Am. J. Clin. Invest. 1996;98:1568–1574. doi: 10.1172/JCI118950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jaeschke H, Bajt ML. Critical role of CXC chemokines in endotoxemic liver injury in mice. J. Leukoc. Biol. 2004;76:1089–1090. doi: 10.1189/jlb.0504309. [DOI] [PubMed] [Google Scholar]
  23. Koning AJ, Lum PY, Williams JM, Wright R. DiOC6 staining reveals organelle structure and dynamics in living yeast cells. Cell Motil. Cytoskeleton. 1993;25:111–128. doi: 10.1002/cm.970250202. [DOI] [PubMed] [Google Scholar]
  24. Mareninova OA, Sung KF, Hong P, et al. Cell death in pancreatitis: caspases protect from necrotizing pancreatitis. J. Biol. Chem. 2006;281:3370–3381. doi: 10.1074/jbc.M511276200. [DOI] [PubMed] [Google Scholar]
  25. Marko K, Toshiyuki I, Haruhisa M, Hans BG, Murray K. Coexpression of FAS and FAS-Ligand in Chronic Pancreatitis: Correlation with Apoptosis. Pancreas. 2000;20:123–128. doi: 10.1097/00006676-200003000-00003. [DOI] [PubMed] [Google Scholar]
  26. Post GR, Brown JH. G protein-coupled receptors and signaling pathways regulating growth responses. FASEB J. 1996;10:741–749. doi: 10.1096/fasebj.10.7.8635691. [DOI] [PubMed] [Google Scholar]
  27. Scholz J, Broom DC, Youn D-H, et al. Blocking Caspase Activity Prevents Transsynaptic Neuronal Apoptosis and the Loss of Inhibition in Lamina II of the Dorsal Horn after Peripheral Nerve Injury. J. Neurosci. 2005;25:7317–7323. doi: 10.1523/JNEUROSCI.1526-05.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Sgadari C, Angiolillo AL, Cherney BW, et al. Interferon-inducible protein-10 identified as a mediator of tumor necrosis in vivo. Proc. Natl Acad. Sci. U.S.A. 1996;93:13791–13796. doi: 10.1073/pnas.93.24.13791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Singh L, Bakshi DK, Majumdar S, Vasishta RK, Arora SK, Wig JD. Expression of interferon-γ inducible protein-10 and its receptor CXCR3 in chronic pancreatitis. Pancreatology. 2007;7:479–490. doi: 10.1159/000108965. [DOI] [PubMed] [Google Scholar]
  30. Singh L, Bakshi DK, Majumdar S, Vasishta RK, Arora Sk, Wig JD. Primary culture of pancreatic (human) acinar cells. Dig. Dis. Sci. 2008a;53:2569–2575. doi: 10.1007/s10620-007-0162-1. [DOI] [PubMed] [Google Scholar]
  31. Singh L, Bakshi DK, Majumdar S, Arora SK, Vasishta RK, Wig JD. Mitochondrial dysfunction and apoptosis of acinar cells in chronic pancreatitis. J. Gastroenterol. 2008b;43:473–483. doi: 10.1007/s00535-008-2179-4. [DOI] [PubMed] [Google Scholar]
  32. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD. Measurement of protein using Bicinchoninic acid. Analyt. Biochem. 1985;150:76–85. doi: 10.1016/0003-2697(85)90442-7. [DOI] [PubMed] [Google Scholar]
  33. Susin SA, Zamzami N, Castedo M, et al. The central executioner of apoptosis–multiple connections between protease activation and mitochondria in Fas/Apo-1/CD95- and ceramide-induced apoptosis. J. Exp. Med. 1997;186:25–37. doi: 10.1084/jem.186.1.25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Susina SA, Daugasa E, Ravagnana L, et al. Two distinct pathways leading to nuclear apoptosis. J. Exp. Med. 2000;192:571–580. doi: 10.1084/jem.192.4.571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Towbin H, Stachelin T, Gordon J. Electrophoresis transfer of protein from polyacrylamide gels to nitrocellulose sheets procedure and same applications. Proc. Natl Acad. Sci. U.S.A. 1979;76:4350–4354. doi: 10.1073/pnas.76.9.4350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wada M, Doi R, Hosotani R, et al. Expression of Bcl-2 and PCNA in Duct cells after pancreatic duct ligation in Rats. Pancreas. 1997;15:176–182. doi: 10.1097/00006676-199708000-00010. [DOI] [PubMed] [Google Scholar]
  37. Walker NI, Winterford CM, Williamson RM, Kerr JFR. Ethionine-induced atrophy of rat pancreas involves apoptosis of acinar cells. Pancreas. 1993;8:443–449. doi: 10.1097/00006676-199307000-00007. [DOI] [PubMed] [Google Scholar]
  38. Williams JA, Dabrowski A, Logsdon CD. Novel kinase signaling cascades in pancreatic acinar cells. News Physiol. Sci. 1997;12:117–121. [Google Scholar]
  39. Yang J, Zoeller RT. Differential display identifies neuroendocrine-specific protein-A (NSP-A) and interferon-inducible protein 10 (IP-10) as ethanol-responsive genes in the fetal rat brain. Brain Res. Dev. Brain Res. 2002;138:117–133. doi: 10.1016/s0165-3806(02)00461-3. [DOI] [PubMed] [Google Scholar]
  40. Zamzami N, Kroemer G. The mitochondrion in apoptosis: how Pandora’s box opens. Nat. Rev. Mol. Cell Biol. 2001;2:67–71. doi: 10.1038/35048073. [DOI] [PubMed] [Google Scholar]
  41. Zhang HM, Yuan J, Cheung P, et al. Gamma interferon-inducible protein-10 induces HeLa cell apoptosis through a p53-dependent pathway initiated by suppression of human papillomavirus type 18 E6 and E7 expression. Mol. Cell. Biol. 2005;25:6247–6258. doi: 10.1128/MCB.25.14.6247-6258.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

iep0091-0210-SD1.tif (1.8MB, tif)
iep0091-0210-SD2.tif (10.4MB, tif)

Articles from International Journal of Experimental Pathology are provided here courtesy of Wiley

RESOURCES