Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2010 Apr 7;48(6):2116–2121. doi: 10.1128/JCM.02530-09

Development of a Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Subgroup J Avian Leukosis Virus ▿

Xiaotao Zhang 1, Ming Liao 1, Peirong Jiao 1, Kaijian Luo 1, Henan Zhang 1, Tao Ren 1, Guihong Zhang 1, Chenggang Xu 1, Chaoan Xin 1,*, Weisheng Cao 1,*
PMCID: PMC2884476  PMID: 20375232

Abstract

Infection of breeder flocks in China with subgroup J avian leukosis virus (ALV-J) has increased recently. In this study, we have developed a loop-mediated isothermal amplification (LAMP) assay for rapid detection of ALV-J from culture isolates and clinical samples. The ALV-J-specific LAMP assay efficiently amplified the target gene within 45 min at 63°C using only a simple laboratory water bath. To determine the specificity of the LAMP assay, various subgroup ALVs and other related viruses were detected. A ladder pattern on gel electrophoresis was observed for ALV-J isolates but not for other viruses. To evaluate the sensitivities of the LAMP assay and conventional PCR, the NX0101 isolate plasmid DNA was amplified by them. The detection limit of the LAMP assay was 5 target gene copies/reaction, which was up to 20 times higher than that of conventional PCR. To evaluate the application of the LAMP assay for detection of ALV-J in clinical samples, 49 samples suspected of ALV infection from breeder flocks were tested by the LAMP assay and PCR. Moreover, virus isolation from these samples was also performed using cell culture. The positive-sample ratios were 21/49 (43%) by conventional PCR, 26/49 (53%) by the LAMP assay, and 19/46 (41%) by virus isolation. Additionally, a positive LAMP reaction can be visually ascertained by the observation of turbidity or a color change after addition of SYBR green I dye. Consequently, the LAMP assay is a simple, rapid, and sensitive diagnostic method and can potentially be developed for rapid detection of ALV-J infection in the field.


Avian leukosis viruses (ALVs), which belong to the Alpharetrovirus genus of the family Retroviridae, can induce transmissible benign and malignant neoplasms in poultry (13, 24). ALVs are divided into subgroups based primarily on virus neutralization, their host range, and viral interference patterns (4, 5, 13). The envelope glycoprotein (gp85) is responsible for subgroup specificity. In general, the endogenous nonpathogenic subgroup E viruses are present in nearly all chicken lines (13, 26). Subgroup C and D viruses are rarely seen in the field. The exogenous viruses (subgroups A, B, and J) mainly induce lymphoid leukosis (LL) and myeloid leukosis (ML) in field flocks (13). In the late 1980s, the prototype strain of subgroup J avian leukosis virus (ALV-J), HPRS-103, was first isolated from commercial meat-type chickens in the United Kingdom (22). ALV-J infection subsequently caused heavy losses worldwide in broiler breeder stocks. Many strains of ALV-J have been reported worldwide in the past 20 years (2, 11, 30). Sequence analysis has demonstrated that the gp85 genes of subgroups A to E are closely related, sharing around 85% nucleotide sequence identity with each other. However, the HPRS-103 gp85 gene shares only 40% identity with members of other subgroups. The gp85 genes of endogenous avian retroviral sequence (EAV-HP) elements share over 97% identity with that of ALV-J; thus, it was hypothesized that the new avian pathogen may be a result of recombination between exogenous and endogenous retroviruses (1, 4, 5, 25).

ALV-A, ALV-B, and ALV-J are the subgroups most dangerous to the poultry industry (13). No treatment exists for the exogenous viral infection. Furthermore, no commercial vaccine is available, so eradication measures are carried out by frequent detection of exogenous ALVs (27). The emergence of ALV-J forced some poultry breeders to formulate new plans to control ALV-J (7, 14, 15). Since ALV-J is spread by both vertical and horizontal transmission. The only method for blocking the vertical transmission of ALV-J is the early elimination of infected chickens (6, 9). China has the second largest broiler industry in the world at present. However, ALV-J-induced ML in China was not officially documented until 1999 (11). ALV-J isolates have subsequently been obtained from broiler breeders and layer chickens in most parts of China (11, 30).

PCR and real-time quantitative PCR methods were developed for detection of ALV-J (16, 17, 26, 27). However, PCR requires considerable operator skills and expensive equipment; thus, its application is limited in the field. Virus isolation using CEF or DF-1 cell culture takes more than 7 days for an accurate final result to be obtained, as does the immunofluorescence assay (IFA) specific for ALV-J. An enzyme-linked immunosorbent assay (ELISA) kit designed to detect the viral group-specific antigen (gsa; p27) is available. In China, a few large poultry breeders are trying to establish exogenous ALV-free poultry flocks, which were evaluated by ELISA detection. However, ELISA may lead to a high rate of false-positive results due to the p27 expression of some endogenous retroviruses. Thus, ELISA is not reliable for the detection of purely exogenous ALVs (10). A simple, rapid, and sensitive diagnostic method for detecting ALV-J needs to be developed.

The loop-mediated isothermal amplification (LAMP) method was developed by Notomi et al. (20). This novel technique generally requires isothermal conditions and four different primers for DNA amplification (19, 20) and has been applied to the detection of several pathogens (3, 8, 12, 21, 23). The LAMP reaction requires 30 to 60 min and can be performed at a single temperature ranging from 60 to 65°C. LAMP does not require the DNA denaturation, annealing, and extension PCR cycles (19, 20). In addition, the results can be ascertained easily by the naked eye (3, 19). In this study, we developed a LAMP assay for simple, rapid, and sensitive detection of ALV-J and compared the sensitivity of the LAMP assay with those of conventional PCR and virus isolation.

MATERIALS AND METHODS

Clinical sample treatment and virus isolation.

Forty-nine samples containing livers and spleens suspected of ALV infection were obtained from broiler breeder flocks from farms in the Guangdong and Shandong provinces. In a sterile environment, tissue samples were ground with cold phosphate-buffered saline (PBS) and centrifuged at 6,000 rpm for 5 min at 4°C. Tissue pellets were used to extract genomic DNAs as a template for the LAMP assay and PCR. Supernatant was passed through 0.22-μm filters and inoculated onto a DF-1 cell monolayer grown in Dulbecco's modified Eagle's medium (GIBCO, NY) containing 10% fetal bovine serum. After 2 h, the cells were overlaid with 2% calf serum and incubated at 37°C in a 5% CO2 atmosphere for 7 days. The DF-1 supernatants were harvested and used to determine p27 by use of a commercial ELISA kit (IDEXX, Inc., Westbrook, MA). Then, DF-1 cells were washed three times with PBS. The cellular DNAs were extracted from the cultured DF-1 cells and then treated with RNase A. The DNAs were used for PCR. Samples positive for the virus were verified by PCR and ELISA.

Proviral DNA extraction.

Proviral DNAs were extracted from clinical tissue samples and DF-1 cells infected with eight different ALVs using an EZNA SQ tissue DNA kit (Omega Bio-Tek, GA) according to the manufacturer's instructions. The DNAs were stored at −20°C until used.

Viruses.

Four ALV-J isolates (NX0101, Js-nt, SCAU-0901, and SCAU-CHN), two ALV-A isolates (RAV-1 and GD-08), two ALV-B isolates (RAV-2 and CD-08), and two tissue DNA samples (subgroup E) from specific-pathogen-free (SPF) chickens were used to determine the specificity of the LAMP assay in this study. The Js-nt isolate and the DF-1 cell line were obtained from Aijian Qin at Yangzhou University. The NX0101 isolate was a gift from Zhizhong Cui at Shandong Agricultural University. The proviral DNA of RAV-1 strain (ALV-A) was obtained from Fuyong Chen at China Agricultural University. The RAV-2 strain was purchased from the China Institute of Veterinary Drug Control. The SCAU-0901, SCAU-CHN, GD08, and CD08 isolates were identified and maintained in our laboratory. To prepare subgroup E proviral DNA, tissue genomic DNA samples were extracted from livers and spleens of two white leghorn SPF layer chickens (Beijing Merial Vital laboratory Animal Technology Co., Ltd., Beijing, China) and designated E1 and E2. The two tissue DNA samples of ALV-E were confirmed by PCR.

LAMP reaction.

Primers specific for ALV-J were designed using Primer Explorer V3 software (Eiken Chemical Co., Ltd., Tokyo, Japan) and synthesized by Shanghai Invitrogen Co., Ltd. The four primers consisted of one pair each of forward and backward outer primers (F3 and B3) and forward and backward inner primers (FIP and BIP) (Fig. 1A). The 25-μl LAMP reaction was carried out with a set of specific primers containing 1.0 μM (each) FIP and BIP, 0.25 μM (each) F3 and B3, 0.8 mM each deoxynucleoside triphosphate (dNTP), 0.4 M betaine (Sigma-Aldrich, Inc., MO), 20 mM Tris-HCl, 10 mM KCl, 10 mM (NH4)2SO4, 6 mM MgSO4, 0.1% Tween 20, 8 U of Bst DNA polymerase (New England Biolabs), and 1 μl of DNA template. The mixture was incubated at 63°C for 45 min in a water bath and terminated by incubation at 84°C for 5 min. The LAMP products were detected by several methods: 2% agarose gel electrophoresis with UV light transillumination, observation of turbidity, and naked-eye determination of color change after addition of SYBR green I dye (2 μl per reaction tube) under normal light conditions (Cambrex BioSciences, Inc., ME). The amplification products were digested with the restriction enzyme DdeI (Fermentas, Lithuania). The digested products would produce 200-, 267-, or 314-bp fragments by electrophoresis on 3% agarose gel.

FIG. 1.

FIG. 1.

Loop-mediated isothermal amplification (LAMP) and PCR primer design for detection of ALV-J. (A) Locations of LAMP primers in relation to the defined regions of the target sequence. The forward outer primer (F3) and the forward inner primer (FIP) are complementary to the indicated region of the pol gene (arrows). The reverse outer primer (B3) and the reverse inner primer (BIP) are complementary to the indicated region of the gp85 gene (arrows). FIP and BIP contain two distinct sequences (F1c plus F2 and B1c plus B2, respectively). (B) The LAMP and PCR primer positions are shown relative to prototype ALV-J clone HPRS-103 (GenBank accession number Z46390). The DdeI restriction site is indicated in bold type (R = G/A and Y = C/T).

Standard plasmid preparation.

To compare the sensitivities of the ALV-J LAMP assay and conventional PCR, a 545-bp fragment comprising positions 5258 to 5802 of the genome sequence of the NX0101 isolate was amplified by PCR with primers described previously (27). The purified PCR product was then cloned into a pGEM-T Easy vector according to the manufacturer's instructions (Promega, WI). The recombinant Escherichia coli strain carrying the recombinant plasmids was inoculated into LB broth (10 ml) and inoculated at 37°C overnight with horizontal shaking. The recombinant plasmid DNA was extracted with a QIAprep spin miniprep kit (Qiagen, CA) and verified by sequencing. The positive plasmid DNA was quantitated by UV spectrophotometry at 260 nm (ND-1000; Thermo Fisher Scientific, Inc., MA) and then diluted to serve as a standard for determining the sensitivities of the two methods.

PCR.

PCR amplification of ALV-J was performed with the subgroup-specific primers described by Smith et al. (27). The primers designed to detect ALV-E were as follows: forward, 5′GGATGAGGTGACTAAGAAAG3′, and reverse, 5′AGCTTCGTCTACGCCCATAT3′. An approximately 2.2-kb band was observed in gel electrophoresis with the specific primers. The 50-μl PCR mixture contained 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 50 mM KCl, 0.001% gelatin, 25 mM each dNTP, 25 pmol of each primer, 1.25 U Taq polymerase (TaKaRa BioMedicals, Tokyo, Japan), and approximately 100 ng of template DNA. The PCR conditions used to amplify subgroups J and E were as follows: an initial template melting step at 95°C for 3 min; 30 cycles at 95°C for 30 s, 53°C for 30 s, and 72°C for 30 s (ALV-J) or 2.5 min (ALV-E); and a final extension at 72°C for 10 min. The PCRs were carried out by using a model 9700 Gene Amp PCR system (Applied Biosystems, Inc., CA). PCR products were confirmed by 1.5% agarose gel electrophoresis.

RESULTS

Assay design.

Based on envelope glycoprotein (gp85), ALVs of chickens are classified into six subgroups (A to E and J), which share various degrees of identity among their gp85 genes. To enhance the specificity of the primers, the LAMP primers were selected from a conserved region of the gp85 gene of the HPRS-103 genome after comparison with that of other ALV-J strains, which is a variable region for other subgroups (A to E). The EAV-HP family lacks pol gene regions encoding the reverse transcriptase enzyme, which are very conserved for all subgroup ALVs. The pol gene region was chosen to design the LAMP primers for avoiding the amplification of the EAV-HP family. The locations and sequences of the four primers are shown in Fig. 1. The LAMP reaction was optimized by varying the ratio of inner and outer primers, the concentrations of MgSO4 and dNTP, the amplification temperature, and the reaction time (data not shown), in which the recombinant plasmid containing the 545-bp NX0101 gene fragment was used as the template. After optimization, the LAMP reaction was carried out at 63°C and was generally positive after a 45-min incubation.

LAMP sensitivity for ALV-J.

The recombinant plasmid containing the 545-bp gene fragment of the NX0101 genome was used to compare the sensitivity of the LAMP assay with that of conventional PCR. The plasmid DNA was serially diluted, and each dilution was used as the template for both LAMP and PCR methods. The results are shown in Fig. 2. The detection limit of the LAMP assay was 5 copies (approximately 0.02 fg) per reaction during a 45-min reaction, whereas that of conventional PCR was 100 copies per tube. Thus, the sensitivity of the LAMP assay was at least 20-fold higher than that of conventional PCR.

FIG. 2.

FIG. 2.

Comparative sensitivities of the LAMP assay and PCR for detection of ALV-J by agarose gel electrophoresis. The plasmid containing the NX0101 gene fragment was serially diluted. Each plasmid concentration was subjected to the LAMP assay and conventional PCR. (A) ALV-J-specific LAMP reaction. (B) PCR revealing a 545-bp specific amplicon for ALV-J. Lane M, DNA marker DL-2000 (TaKaRa, Japan); NC, negative control.

Specificity of the LAMP assay.

A positive LAMP reaction reveals a ladder pattern with many bands of different sizes upon 2% agarose gel electrophoresis. All four ALV-J isolates gave a positive LAMP reaction, while no ladder pattern was seen with the samples of subgroups A, B, and E (Fig. 3A). To confirm the amplification of the appropriate sequence, the LAMP product of the NX0101 isolate was digested with DdeI, and restriction fragments of the predicted sizes were obtained (200, 267, and 314 bp) (Fig. 3B). cDNAs from other clinically related viruses (the M41 strain of infectious bronchitis virus, the T strain of reticuloendotheliosis virus, and the A/Goose/Guangdong/1/1996 strain of H5N1 avian influenza virus) were also used as a control template for the LAMP assay. All these LAMP reactions were negative by ALV-J LAMP (data not shown).

FIG. 3.

FIG. 3.

Specificity of the LAMP assay. (A) Agarose gel electrophoresis analysis of different subgroup ALVs. Lanes 1 through 8, LAMP of DNA from the Js-nt, SCAU-0901, SCAU-CHN, NX0101, GD08, RAV-1, RAV-2, and CD08 isolates, respectively; lanes 9 through 10, LAMP of DNA from subgroup E (E1 and E2). (B) Restriction enzyme analysis of LAMP products on a 3% agarose gel. Lane 1, undigested LAMP product of the NX0101 isolate; lane 2, LAMP product after digestion with DdeI. Lane M, DNA marker DL-2000 (TaKaRa, Japan); NC, negative control.

Detection of LAMP products by alternate methods.

Besides gel electrophoresis, we also used visual inspection to determine a positive reaction. The high amplification efficiency of the LAMP reaction yields large amounts of pyrophosphate ion, which leads to a white precipitate of magnesium pyrophosphate in the reaction mixture; thus, a positive reaction can be clearly identified by the presence of turbidity in normal light (Fig. 4A). Alternatively, after addition of SYBR green I dye to the terminated reaction, the color indicating the positive reaction changed to yellowish green, whereas indicators of negative reactions remained reddish orange (Fig. 4B). Color changes occurred earlier with increased DNA template copies. These results showed that LAMP detection of ALV-J is very simple and rapid.

FIG. 4.

FIG. 4.

Visual detection of LAMP products. (A) Turbidity observation. Turbidity increases in the positive reaction due to the generation of magnesium pyrophosphate. (B) ALV-J LAMP products were detected after addition of SYBR green I dye. The positive reaction shows a color change to yellowish green, which can be easily distinguished from the reddish orange color indicating a negative reaction.

Detection of ALV-J from clinical samples.

Detection of ALV-J proviral DNA by LAMP was done with 49 tissue samples suspected of ALV infection. Conventional PCR and virus isolation were also done with the same samples for comparison. The results of virus isolation, LAMP, and PCR methods are summarized in Table 1. ALV-Js were isolated from 19 samples and detected in 21 samples by PCR, while ALV-J positive signals were found in 26 samples by LAMP. ALV-J was not detected in 6 LAMP-positive tissue samples by PCR. Among the 27 samples negative by virus isolation, we detected ALV-J in 7 samples by use of the LAMP assay but in only 3 samples by use of PCR, also suggesting that the sensitivity of the LAMP assay was higher than those of conventional PCR and virus isolation.

TABLE 1.

Comparison of results for PCR, LAMP assay, and virus isolation obtained from 49 clinical samplesa

No. detected Result for indicated method
PCR LAMP Virus isolation
16 + + +
3 + + −
1 + − +
1 + + ND
2 − + +
4 − + −
2 − − ND
20 − − −
Total 21 26 19
a

+, positive; −, negative; ND, not done.

DISCUSSION

At the present, ALV-J infection causes significant economic losses in China (11, 30). In the field, the presence of ALV-J infection is associated with variable tumor types, including myelocytoma, renal tumors, hemangioma, and others (9, 29, 29a, 30). The high incidence of tumors decreases production, and virus eradication increases production costs (7, 22, 28). Simple, rapid, and sensitive diagnostic methods for detection of ALV-J need to be developed to address the need for the rapid diagnosis (16, 17, 26, 27). Routine PCR, an important method for detection of ALV-J, requires high-precision instruments, considerable operator skill, and 3 to 4 h for amplification, making it rather difficult to adapt for rapid detection of ALV-J in the field. Virus isolation is a standard method, but it requires complex procedures for cell culture and takes more than a week to obtain results. The LAMP assay reported in this study is advantageous due to its simple operation, rapid reaction, and easy detection compared with what was observed for conventional PCR and virus isolation (20). The LAMP assay efficiently amplifies target DNA, requiring only a regular laboratory water bath for incubation under isothermal conditions and less than 1 h after extraction of the proviral DNA. This is the first report on the use of the LAMP assay for rapid detection of ALV-J.

In the process of developing a successful LAMP assay, we found that primer design was crucial (20). The LAMP assay makes use of four primers to recognize six distinct regions on the target DNA sequence, which makes the LAMP assay more specific than conventional PCR using two primers. Before designing the subgroup-specific primers, we compared the sequence identities of different ALV-J strains available in GenBank and found conserved regions with more than 95% identity. Specific primers may be not effective when the identity is lower than 90%. The LAMP primers for ALV-J were designed based on the pol and gp85 regions of the prototype strain of ALV-J, HPRS-103, which effectively avoid amplification of other subgroups and the EAV-HP family.

The specificity of the LAMP assay was evaluated with different subgroup ALVs and other related viruses. We extracted DNAs from SPF chickens as subgroup E proviral DNA, which was confirmed by specific PCR amplification. Both specimens (E1 and E2) from SPF chickens were negative for the ALV-J LAMP assay. Besides ALV-E, the LAMP products of other subgroups were not seen in ladder pattern bands upon 2% agarose gel electrophoresis. Further, the conventional PCR was performed with these primers (F3 and B3), and a 209-bp DNA band was visualized for all four different ALV-J isolates by agarose gel electrophoresis, whereas no DNA band was observed for subgroups A, B, and E (data not shown).

We also compared the sensitivities of the LAMP assay and conventional PCR using serial dilution of the plasmid template. The detection limit of the LAMP assay was 5 copies/reaction (approximately 0.02 fg), whereas that of PCR was 100 copies/reaction, which was similar to what was described in a previous report (27). Detection of positive samples by use of the LAMP assay (26/49) demonstrated the higher sensitivity of this assay in comparison to conventional PCR (21/49) and virus isolation (19/46). As shown in Table 1, two positive samples obtained by virus isolation were not detected by PCR, whereas only one positive sample was not detected by LAMP. The reason may be related to the reaction mechanisms of the two different detection methods.

Genome amplification carries the possibility of false positives due to cross-contamination. Since the LAMP assay has the advantage of simple procedure, cross-contamination is less likely to occur in the LAMP assay. To prevent the volatilization of LAMP reaction solution, it was recommended that paraffin oil be added to the LAMP mixture. If not for the addition of paraffin oil, the LAMP method may present the possibility of cross-contamination. As indicated by Kuboki et al. (18), we also recommend precautions and careful manipulation to avoid cross-contamination, such as a clean environment for preparation of the reaction mixture.

One of the most important features of LAMP is its high amplification efficiency, which produces large amounts of pyrophosphate ions in the reaction mixture (19). After optimization of the LAMP reaction, the DNA concentration in the finished reaction mixture would be greater than 1,000 ng/μl in this study (data not shown). The LAMP results were easily detected by naked-eye observation of increased turbidity caused by generation of magnesium pyrophosphate or by a red-to-yellow color change after addition of SYBR green I dye (3). Therefore, we advise that SYBR green I dye be added to the completed LAMP reaction mixture for easy handling.

This study had some limitations, including the limited number of clinical samples, the absence of the HPRS-103 strain, and the unavailability of the ALV-C and ALV-D isolates. The purpose of this study was to establish a simple, rapid, and sensitive method of LAMP for detection of ALV-J. We would further evaluate LAMP for the diagnosis of ALV-J infection in the field.

In conclusion, we describe a LAMP-based assay for detection of ALV-J, which is simple, rapid, sensitive, and specific. The LAMP assay may be used for rapid diagnosis of ALV-J infection not only in laboratories but also in routine clinical settings. Thus, the LAMP assay may potentially be a valuable tool for rapid detection of ALV-J due to its simple performance.

Acknowledgments

This study was funded by grants from the Guangdong Science and Technology Plan Project (no. 2008B02070009) and the Guangdong Natural Science Foundation (no. 8151064201000065) to Weisheng Cao and grants from the National Natural Science Foundation of China (no. 30771612) and the Joint Funded Project National Natural Science Foundation of China and Guangdong Province (no. U0831002) to Ming Liao.

Footnotes

▿

Published ahead of print on 7 April 2010.

REFERENCES

  • 1.Bai, J., L. N. Payne, and M. A. Skinner. 1995. HPRS-103 (exogenous avian leukosis virus, subgroup J) has an env gene related to those of endogenous elements EAV-0 and E51 and an E element found previously only in sarcoma viruses. J. Virol. 69:779-784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Benson, S. J., B. L. Ruis, A. L. Garbers, A. M. Fadly, and K. F. Conklin. 1998. Independent isolates of the emerging subgroup J avian leukosis virus derive from a common ancestor. J. Virol. 72:10301-10304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bista, B. R., C. Ishwad, A. Vats, P. Manna, G. Gupta, M. Adhikari, et al. 2007. Development of a loop-mediated isothermal amplification assay for rapid detection of BK virus. J. Clin. Microbiol. 45:1581-1587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bova, C. A., J. P. Manfredi, and R. Swanstrom. 1986. Env genes of avian retroviruses: nucleotide sequence and molecular recombinants define host range determinants. Virology 152:343-354. [DOI] [PubMed] [Google Scholar]
  • 5.Bova, C. A., J. C. Olsen, and R. Swanstrom. 1988. The avian retrovirus env gene family: molecular analysis of host range and antigenic variants. J. Virol. 62:75-83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chai, N., and P. Bates. 2006. Na+/H+ exchanger type 1 is a receptor for pathogenic subgroup J avian leukosis virus. Proc. Natl. Acad. Sci. U. S. A. 103:5531-5536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chase, W. B. 1991. Eradication of avian leukosis virus by breeder companies: results, pitfalls and cost benefit analysis, p. 5-7. In D. Swayne and D. Zander (ed.), Proceedings of the Avian Tumor Virus Symposium. American Association of Avian Pathologists, Kennett Square, PA.
  • 8.Chen, H., J. Zhang, D. Sun, L. Ma, X. Liu, X. Cai, and Y. Liu. 2008. Development of reverse transcription loop-mediated isothermal amplification for rapid detection of H9 avian influenza virus. J. Virol. Methods 151:200-203. [DOI] [PubMed] [Google Scholar]
  • 9.Chesters, P. M., L. P. Smith, and V. Nair. 2006. E (XSR) element contributes to the oncogenicity of avian leukosis virus (subgroup J). J. Gen. Virol. 87:2685-2692. [DOI] [PubMed] [Google Scholar]
  • 10.Crittenden, L. B., and E. J. Smith. 1984. A comparison of test materials for differentiating avian leukosis virus subgroup specific antigens of exogenous and endogenous origin. Avian Dis. 28:1057-1062. [PubMed] [Google Scholar]
  • 11.Cui, Z., Y. Du, Z. Zhang, and R. F. Silva. 2003. Comparison of Chinese field strains of avian leukosis subgroup J. viruses with prototype strain HPRS-103 and United States strains. Avian Dis. 47:1321-1330. [DOI] [PubMed] [Google Scholar]
  • 12.Curtis, K. A., D. L. Rudolph, and S. M. Owen. 2008. Rapid detection of HIV-1 by reverse-transcription, loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 151:264-270. [DOI] [PubMed] [Google Scholar]
  • 13.Fadly, A. M., and L. N. Payne. 2002. Leukosis/sarcoma group, p. 465-516. In Y. M. Saif, H. J. Barnes, A. M. Fadly, L. R. McDougald, D. E. Swayne, and J. R. Glisson (ed.), Diseases of poultry, 11th ed. Iowa State University Press, Ames, IA.
  • 14.Gavora, J. S. 1987. Influences of avian leukosis virus infection on production and mortality and the role of genetic selection in the control of lymphoid leukosis, p. 241-260. In G. F. de Boer (ed.), Avian leukosis. Martinus Nijhoff, Boston, MA.
  • 15.Gavora, J., J. Spencer, and J. Chambers. 1982. Performance of meat-type chickens test-positive and -negative for lymphoid leukosis virus infection. Avian Pathol. 11:29-38. [DOI] [PubMed] [Google Scholar]
  • 16.Hatai, H., K. Ochiai, Y. Tomioka, T. Toyoda, K. Hayashi, M. Anada, et al. 2005. Nested polymerase chain reaction for detection of the avian leukosis virus causing so-called fowl glima. Avian Pathol. 34:473-479. [DOI] [PubMed] [Google Scholar]
  • 17.Hauptli, D., L. Bruckner, and H. P. Ottiger. 1997. Use of reverse transcriptase polymerase chain reaction for detection of vaccine contamination by avian leukosis virus. J. Virol. Methods 66:71-81. [DOI] [PubMed] [Google Scholar]
  • 18.Kuboki, N., N. Inoue, T. Sakurai, F. D. Cello, D. J. Grab, H. Suzuki, C. Sugimoto, and I. Igarashi. 2003. Loop-mediated isothermal amplification for detection of African trypanosomes. J. Clin. Microbiol. 41:5517-5524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mori, Y., K. Nagamine, N. Tomita, and T. Notomi. 2001. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res. Commun. 289:150-154. [DOI] [PubMed] [Google Scholar]
  • 20.Notomi, T., H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino, and T. Hase. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:E63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Okafuji, T., N. Yoshida, M. Fujino, Y. Motegi, T. Ihara, Y. Ota, T. Notomi, and T. Nakayama. 2005. Rapid diagnostic method for detection of mumps virus genome by loop-mediated isothermal amplification. J. Clin. Microbiol. 43:1625-1631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Payne, L. N., S. R. Brown, N. Bumstead, K. Howes, J. A. Frazier, and M. E. Thouless. 1991. A novel subgroup of exogenous avian leukosis virus in chickens. J. Gen. Virol. 72:801-807. [DOI] [PubMed] [Google Scholar]
  • 23.Pham, H. M., C. Nakajima, K. Ohashi, and M. Onuma. 2005. Loop-mediated isothermal amplification for rapid detection of Newcastle disease virus. J. Clin. Microbiol. 43:1646-1650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Regenmortel, M. H. V., C. M. Fauquent, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGreock, C. R. Pringle, and R. B. Wickner (ed.). 2000. Virus taxonomy classification and nomenclature of viruses, p. 1162. Academic Press, New York, NY.
  • 25.Sacco, M. A., K. Howes, L. P. Smith, and V. K. Nair. 2004. Assessing the roles of endogenous retrovirus EAV-HP in avian leukosis virus subgroup J. emergence and tolerance. J. Virol. 78:10525-10535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Silva, R. F., A. M. Fadly, and S. P. Taylor. 2007. Development of a polymerase chain reaction to differentiate avian leukosis virus (ALV) subgroups: detection of an ALV contaminant in commercial Marek's disease vaccines. Avian Dis. 51:663-667. [DOI] [PubMed] [Google Scholar]
  • 27.Smith, L. M., S. R. Brown, K. Howes, S. McLeod, S. S. Arshad, G. S. Barron, K. Venugopal, J. C. McKay, and L. N. Payne. 1998. Development and application of polymerase chain reaction (PCR) tests for the detection of subgroup J avian leukosis virus. Virus Res. 54:87-98. [DOI] [PubMed] [Google Scholar]
  • 28.Spencer, J. L., M. Chan, and S. Nadin-Davis. 2000. Relationship between egg size and subgroup J avian leukosis virus in eggs from broiler breeders. Avian Pathol. 29:617-622. [DOI] [PubMed] [Google Scholar]
  • 29.Venugopal, K., L. M. Smith, K. Howes, and L. N. Payne. 1998. Antigenic variants of subgroup J. avian leukosis virus: sequence analysis reveals multiple changes in the env gene. J. Gen. Virol. 79:757-766. [DOI] [PubMed] [Google Scholar]
  • 29a.Xin, C., W. Cao, K. Luo, G. Zhang, T. Ren, C. Xu, and M. Liao. 2006. Preliminary report on diagnosis of hemangioma avian leukosis. Chin. Poult. Husbandry Dis. Control 11:2. [Google Scholar]
  • 30.Zhang, X., H. Lai, H. Zhang, C. Xu, M. Liao, C. Xin, and W. Cao. 2009. Isolation and identification of CD08 strain of avian leukosis virus associated with hemangioma. Chin. J. Vet. Med. 45:8-10. [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES