Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Jul 1.
Published in final edited form as: Diagn Microbiol Infect Dis. 2010 Jul;67(3):220–227. doi: 10.1016/j.diagmicrobio.2010.02.025

Campylobacter jejuni and Campylobacter coli in children from communities in Northeastern Brazil: molecular detection and relation to nutritional status

JOSIANE DA SILVA QUETZ 1, ILA FERNANDA NUNES LIMA 1, ALEXANDRE HAVT 1, EUNICE BOBO DE CARVALHO 1, NOÉLIA LEAL LIMA 1, ALBERTO MELO SOARES 1, ROSA MARIA SALANI MOTA 2, RICHARD LITTLETON GUERRANT 1,3, ALDO ANGELO MOREIRA LIMA 1,3
PMCID: PMC2886016  NIHMSID: NIHMS186394  PMID: 20542202

INTRODUCTION

Campylobacter is a leading bacterial cause of food-born disease worldwide (Center for Disease Control – CDC/USA, 2009; Vaillant et al, 2005), representing a huge health challenge. This mainly zoonotic genus includes at least 18 species (Humphrey et al, 2007; On, 2001) of which Campylobacter jejuni and Campylobacter coli are the most common pathogens and account for the majority of diagnosed human Campylobacter infections (Tam et al, 2003; World Health Organization – WHO, 2001). Young children remain most susceptible both in the developing and the developed world (Amieva, 2005; Coker et al, 2002; Huilan et al, 1991; Podewils et al, 2004). Rarely, some infections due to specific C. jejuni serotypes result in serious post-infectious complications like bacteremia, arthritis, Reiter's syndrome and Guillain-Barré syndrome (GBS) (Hannu et al, 2002; Kaira et al, 2009; Nielsen et al, 2010). Campylobacteriosis is also the commonest risk factor for post-infectious irritable bowel disease (IBD), which occurs in approximately 20–30% patients following infection (Marshall et al, 2006).

C. jejuni can disrupt the integrity of the intestinal barrier by targeting epithelial tight junctions (MacCallum et al, 2005; Chen et al, 2006). Recently, it was demonstrated that Campylobacter infection promotes translocation of non-invasive bacteria via a lipid raft-mediated transcellular process, an event that may be associated with intestinal inflammation and even the onset of IBD in susceptible individuals (Kalischuk et al, 2009). Campylobacter can also present as an opportunistic infection, perhaps related to immunosupression seen with malnutrition (Kakai et al, 1995; Fernández et al, 2008). Other virulence factors can also be involved in the pathogenesis of Campylobacter infections. (Al-Mahmeed et al, 2006, Zilbauer et al, 2008). However, the association of Campylobacter infection with malnutrition remains unclear and is the focus of this report.

Routine detection of Campylobacter species in clinical laboratories is based on culture of stool specimen on selective media followed by phenotypic identification. Campylobacter species appear to possess uniquely fastidious growth requirements and culture methods are also biased toward the detection of C. jejuni and C. coli (Moore et al, 2005). Molecular methods based on Polymerase Chain Reaction (PCR) amplification have several advantages over classical bacteriology (concerning to detection limits, species identification level, speed and automation possibility) and may provide an alternative to culture methods for the detection of Campylobacter, particularly for epidemiological studies, where many samples are examined and diagnosis can be expensive and laborious (Abubakar et al, 2007; Ajjampur et al, 2008; Amar et al, 2004). The application of PCR-based assays to the detection of Campylobacter species in clinical and food samples has been previously reported by several research groups since 1992 (Kulkarni et al, 2002; Lawson et al, 1999; Linton et al, 1997; Lübeck et al, 2003; Oyofo et al, 1992; Samie et al, 2007; Waegel and Nachamkin, 1996; Vanniasinkam et al, 1999).

In the present study we determined the prevalence of C. jejuni and C. coli using molecular biology probes and its association with nutritional status in children from urban communities in Northeastern Brazil. In addition, we explored the occurrence and variability of cytolethal distending toxin (CDT) encoding genes from C. jejuni positive samples, evaluated here as a virulence factor.

MATERIAL AND METHODS

Ethical clearance, study site and population

This study was approved by the local and national Ethical Committee in Brazil and by the University of Virginia Institutional Review Board. A consent form was read and signed by the parents or guardians of each child. The study site was at urban communities located close by to the Institute of Biomedicine for Brazilian Semi-Arid & Clinical Research Unit/Center for Global Health (IBSAB&UPC/CGH), Federal University of Ceara, in the city of Fortaleza, state of Ceara, Brazil.

A survey was done from March to July 2007, during the rainy season, to screen for enteric pathogens in children 2-36 months old. A total of 325 children were screening and they were divided in two groups, diarrhea (83 children) and non-diarrhea, the controls (242 children). Diarrhea was defined as three or more unformed or watery stools, in a 24 hour period, as noted by the mother or caretaker. The diarrhea group was defined as children with history of diarrhea in the last two weeks as reported by their parents or guardian. Age matched controls were randomly selected using a list of sequential random numbers in ascending order supplied by a computer program. In total, 166 children (2-36 months old; 83 cases and 83 controls) were enrolled in this study.

Demographic data and anthropometric measures

An experienced field team, composed of one nurse coordinator and three healthcare workers, participated in the field activities of this study. The demographic and clinical data were accessed in a case report form applied by the healthcare workers, followed and revised by the field nurse coordinator.

Anthropometric measures, including weight, height, arm circumference and skin fold thickness were collected. The arm mid-upper circumference was obtained using a tape made from a flexible material for pediatric use. The measurement of skin fold thickness was measured from the midpoint of the posterior non-dominant arm, using a caliper. Also, each child wore light clothing to measure the weight. The weight of each child was measured using a calibrated weighing scale with 100 grams (g) precision (Tanita Solar Scale, Tanita Corporation of American Inc., Arlington, IL, USA). The length or height was measured in the supine position for children under 24 months old and standing for children aged 24 months or older. An anthropometric rod was used for this measurement with intervals of 0.1 centimeter (cm). We also calculated the body mass index (BMI) and z-scores for height-for-age (HAZ), weight-for-age (WAZ) and weight-for-height (WHZ).

Stool sample collection and transport

Stool samples were collected from all children participating in this study. The samples were collected at each household and transported in iced boxes within 4 hours to the laboratory at UPC/IBIMED. All the samples were further aliquoted without dilution. These aliquots were kept in the freezer at -80°C until all the molecular tests were performed.

Bacterial culture and maintenance

We used as controls C. jejuni ATCC 33291 and C. coli INCQS/FIOCRUZ 00263. C. coli control was provided by the Reference Microorganisms Laboratory of the National Institute of Quality Control in Health – Oswaldo Cruz Foundation (INCQS/FIOCRUZ, Rio de Janeiro, RJ, Brazil). Both agents were incubated separately, in a microaerobic atmosphere at 37°C using culture medium Difco ™ Columbia Blood Agar base (Difco BD ® 279240, DIFCO-BD - Sparks, MD, USA) with addition of 5% of sheep blood, Campylobacter Growth Supplement (Oxoid SR0232E) and Campylobacter Blaser-Wang Selective Supplement (Oxoid SR0098E, OXOID - Cambridge, GB), according to manufacturer's instructions. Briefly, the lyophilized agents were reconstituted with sterile saline solution and an aliquot of solution was added to the culture plates. After the period of growth (48 hours), the microorganisms were analyzed for their morphological characteristics using Gram staining and cytochrome oxidase test. Campylobacter sp. is a Gram-negative rod with a typical morphology in stained smears in the form of “S” gull wings or in large spirals.

Genomic DNA

QIAamp DNA stool Mini kit (QIAGEN, Valencia, USA) was performed for genomic DNA extraction from stool samples in accordance with the manufacturer's instructions. We used an incubation of the specimen in a lysis buffer at 95 °C instead of 70 °C, option given for enhancing pathogens DNA extraction. DNA extraction from cultured C. jejuni was made with boiling water method. Briefly, colonies of C. jejuni ATCC 33291 were suspended in 100 μL of sterile deionized water and boiled for 10 minutes. After centrifugation (956 × g for 10 minutes), the supernatant was used as template for PCR.

DNA from cultured C. coli was extracted with a modified protocol using QIAamp DNA stool Mini kit, since boiling water is not appropriate for C. coli's DNA extraction (Mohan et al, 1998). The modified procedure involved an incubation of 100μL of a water suspension of the cultured C. coli INCQS/FIOCRUZ 00263 with the same volume of a lysis buffer for 5 minutes at 95 °C instead of incubation with Inhibitex resin provided by the kit.

All genomic DNA extracted were controlled using the 230, 260, 280 and 320 nm wave lengths in a spectrophotometer (Eppendorf BioPhotometer Plus, Hamburg, Germany). The 260nm absorbance reading provides the total amount of nucleic acid yield, and the 320nm absorbance reading reduces the background influence on total amount of nucleic acid yield. The 260/280 nm and 260/230 nm were used to ensure DNA quality. Samples with ration between 1.8 and 2.0 were presumed to be free of contamination, such as ribonucleic acid, protein, and reagents (Sambrook and Russel, 2001).

Oligonucleotides and PCR amplifications

PCR primers are listed in Table 1 and they were synthesized by Invitrogen Life Technologies (INVITROGEN, Sao Paulo, SP, Brazil).

Table 1.

Oligonucleotide sequence of primersa used in PCR and Multiplex PCR assays.

Oligo Primer name Oligonucleotide Sequence (5′ - 3′) Nucleotide Position Target gene GenBank accession no. PCR conditions (35 cycles)g Product Lengths (bp)
hipOb hipO-F ATGATGGCTTCTTCGGATAG 685-704 hipO FJ655194.1 30" at 95°C, 30" at 51°C, 45" at 72°C 176
hipO-R GCTCCTATGCTTACAACTGC 548-529
askc ask-F GGTATGATTTCTACAAGCGAG 18-38 ask AF017758.1 502
ask-R ATAAAAGACTATCGTCGCGTG 519-499
cdtAd cdtA-F TTGGCGATGCTAGAGTTTGG 443-462 cdtA 175
cdtA-R ACCGCTGTATTGCTCATAGGG 617-597
cdtBe cdtB-F CTCGCGTTGATGTAGGAGCTA 1111-1131 cdtB AY445094.1 30" at 95°C, 30" at 56°C, 45" at 72°C 418
cdtB-R GCAGCTAAAAGCGGTGGAGTA 1528-1508
cdtCf cdtC-F AGCCTTTGCAACTCCTACTGG 1653-1673 cdtC 270
cdtC-R GCTCCAAAGGTTCCATCTTC 1922-1903
Open in a new tab

NOTES:

a

All primers were designed by our group.

b

hipO: primer pair for detection of C. jejuni's hippuricase hydrolase (hipO) encoding gene, chromossomal gene, single PCR detection.

c

ask: primer pair for detection of C. coli's aspartate kinase (ask) encoding gene; chromosomal gene, single PCR detection.

d, e, fprimers pairs for detection of C. jejuni's cytolethal distending toxin (cdtA, B and C) encoding operon genes, chromosomal genes, multiplex PCR detection.

g

For all PCR conditions, an initial denaturation step (10 minutes for single PCR and 15 minutes for multiplex PCR at 95°C) and a final extension (10 minutes at 72°C) were performed. F = Foward primer; R = Reverse primer.

Two sets of PCR reactions were performed separately; one for hipO and another set for ask detection using a final volume of 25 μl. Each reaction contained 12.5 μL of GoTaq Green Master Mix 2X (PROMEGA, Madison, WI, USA) which contains Taq polymerase, deoxynucleotide triphosphates, and MgCl2; 200 nM of forward and reverse primers (hipO primer pair for C. jejuni detection, and ask primer pair for C. coli detection), 2.5 μl of template DNA, and made up to a final volume of 25 μl with nuclease-free water (PROMEGA, Madison, USA). Thermocycling in a MyCycler™ (BIO-RAD, San Diego, USA) consisted of 1 cycle of initial denaturation at 95 °C for 10 min; 35 cycles of denaturation at 95 °C for 30 s, annealing at 51 °C for 30 s, and extension at 72 °C for 45 s; followed by one cycle for a final extension at 72 °C for 10 min. Samples were held at 4°C until analysis. A water-template negative control and a positive control of purified Campylobacter DNA - C. jejuni ATCC 33291 and C. coli INCQS/FIOCRUZ 00263 - were included in each PCR run.

Multiplex PCR amplification

Multiplex PCR reactions were performed for detection of cdtABC operon in a final volume of 25 μl. Each reaction contained 12.5μL of Multiplex Master Mix 2X (QIAGEN, Valencia, USA) which contains HotStarTaq polymerase, deoxynucleotide triphosphates, and MgCl2; 200 nM of forward and reverse primers, all together (cdtA, cdtB and cdtC pair primers), 2.5 μl of template DNA, and made up to a final volume of 25 μl with nuclease-free water (PROMEGA, Madison, USA). Thermocycling in a MyCycler™ (BIO-RAD, San Diego, USA) consisted of 1 cycle of initial denaturation and enzyme activation at 95 °C for 15 min; 30 cycles of denaturation at 95 °C for 30 s, annealing at 56° C for 30 s, and extension at 72° C for 45 s; followed by one cycle for final extension at 72° C for 10 min. Samples were held at 4° C until analysis. A water-template negative control and a positive control of purified C. jejuni ATCC 33291 DNA were included in each PCR run. PCR and Multiplex PCR setup were performed using dedicated pipettes and aerosol barrier tips to minimize the risk of PCR contamination. A total of 10 μl of each PCR or Multiplex PCR product was run on a 1.2% agarose gel in Tris acetate-EDTA buffer. Gels were stained with ethidium bromide and photographed using an UV transilluminator ChemiDoc XRS™ (BIO-RAD, San Diego, USA).

ELISA for Campylobacter sp.

Stool specimens were evaluated for the presence of Campylobacter with an ELISA assay, the Campylobacter ProSpect Microplate Assay from REMEL™ (Lenexa, KS, USA), according to manufacturer's guidelines. The plate readings were done spectrophotometrically at 450 nm wavelength (ELISA Microplate Reader 230S - ORGANON TEKNIKA®, Durham, NC, USA). The results were interpreted according to the instruction's guide after validation of each test, based on expected absorbance readings in positive and negative control wells.

Statistical analysis

Data were entered twice by two independent persons and validated using Excel and Access softwares (Microsoft Corp., Cupertino, CA) and analyzed using SPSS version 11.0 (SPSS Inc™, Chicago, IL, USA). The graphics were performed using the GraphPad Prism version 4.0 (GraphPad™ Software, San Diego, CA, USA). We used the EpiInfo software version 6.0 (Center for Disease Control, Atlanta, GA, USA) for the calculation of z-scores. Shapiro-Wilk test was used to verify data normality and Levene's test to check the variances equality. Student's t, Chi-Square, Fisher's Exact or Anova tests were used depending on data requirements. The differences were considered significant when the P value was less than 0.05.

RESULTS

Age, sex and nutritional parameters

The diarrhea and non-diarrhea groups were similar regarding age, gender, height, weight, arm circumference, and BMI (p >0.05, Student's t test). Skinfold thickness was significantly less in the children with diarrhea (mean ± sd; 7.072 cm ± 1.849, 7.763 cm ± 2.065; p = 0.0374, Student's t test). Children with diarrhea also had lower WAZ (-0.296 ± 1.343) and WHZ (0.306 ± 1.300) compared to non-diarrhea group (0.156 ± 1.318 for WAZ and 0.769 ± 1.093 for WHZ; p = 0.044 and p = 0.022 for WAZ and WHZ, respectively; Student's t test). HAZ was similar in both groups (p>0.05).

C. jejuni/coli detection by PCR and relation to nutritional status

We performed PCR amplification for hipO and ask genes in duplicate for each sample in all 166 samples (83 cases and 83 controls). The results are summarized in Table 2. Figure 1 (A and B) shows the PCR products on agarose gel for C. jejuni and C. coli. There were no significant differences between case and control groups regarding to C. jejuni/coli prevalences. In the diarrhea group, 7.2% (6/83) of samples had amplification for hipO gene and 3.6% (3/83) of samples were positive for C. coli. Co-infection (C. jejuni and C. coli detection) was found in 2.4% (2/83) of cases. In the control group, 6.0% of samples were positive for C. jejuni. Only one sample from control group presented ask gene amplification and represented also a co-infected sample (1.2% of controls, 1/83).

Table 2.

Prevalence of Campylobacter sp., C. jejuni, C. coli, and co-infection in the population studied.

Assay Results Groups Total % of positive samples (positive/n)
Diarrhea % of positive samples (positive/n) Non-diarrhea % of positive samples (positive/n)
ELISA ELISA ProSpect (Campylobacter sp.) 23.7 (19/80) 31.7 (26/82) 27.8 (45/162)
PCR hipO+ (C. jejuni) 7.2 (6/83) 6.0 (5/83) 6.63 (11/166)
ask+ (C. coli) 3.6 (3/83) 0.0 (0/83) 1.81 (3/166)
hipO+ /ask+ (C. jejuni and C. coli) 2.4 (2/83) 1.2 (1/83) 1.81 (3/166)
hipO+ and/or ask+ (C. jejuni and/or C. coli) 13.25 (11/83) 7.2 (6/83) 10.24 (17/166)
cdtABC+ (C. jejuni) 50.0 (4/8) 66.7 (4/6) 57.1 (8/14)
Open in a new tab

NOTE: ELISA: ELISA ProSpect Campylobacter Microplate Assay (Remel, KS, USA); hipO+: C. jejuni's hippuricase hydrolase encoding gene amplified; ask+: C. coli's aspartate kinase encoding gene amplified; cdtABC+: C. jejuni's cytolethal distending toxin encoding operon genes amplified. Non significant differences related to Campylobacter detection (ELISA or PCR) were found between diarrhea and non-diarrhea groups (Student's T, Chi-Square or Fisher's Exact tests).

Figure 1.

Figure 1

Open in a new tab

Photos of the PCR results for (A): C. jejuni's hipO gene amplification, 176bp; (B): C. coli's ask gene amplification, 502bp; and (C): Multiplex PCR result for cdtA (175pb), cdtB (418pb) and cdtC (270bp) genes amplification. All three figures: Columns M = molecular marker, 100bp. (A): Columns 1,2,3,4 e 9: negative samples; Columns 5-8 and 10: positive samples; Column 11: sterile deionized H2O (negative control); Column 12: positive control (DNA extracted from C. jejuni ATCC® 33291 - boiling water extraction). (B): Columns 1-3, 5, 8, 9, 11 and 12: negative samples; Columns 4, 6, 7 and 10: positive samples; Column 13: sterile deionized H2O (negative control); Column 14: positive control (DNA extracted from C. coli INCQS/FIOCRUZ 00263 – QIAamp Stool Mini Kit extraction, modified protocol). (C): Columns 1-4, 9 and 10: negative samples; Columns 5-8 and 11: positive samples; Column 12: sterile deionized H2O (negative control); Column 13: positive control (DNA extracted from C. jejuni ATCC 33291 - boiling water extraction). NOTE: PCR = Polymerase Chain Reaction; hipO = hippurate hydrolase encoding gene of C. jejuni; ask = aspartate kinase encoding gene of C. coli; cdt = cytolethal distending toxin encoding genes.

Stool samples with hipO positive gene (positive molecular detection of C. jejuni), showed a correlation with malnutrition in children as shown in Figure 2. Children with C. jejuni (hipO+) positive stool samples had significantly lower mean of WAZ (mean ± sd, -1.039 ± 1.293, n=14) than children with hipO- stool samples (0.037 ± 1.313; n=130, p=0.0073, Anova test). The mean of WHZ for children in C. jejuni positive samples (mean ± sd, -0.476 ± 1.246, n=14) was also significantly lower than that in children with C. jejuni negative samples (0.651 ± 1.167, n=130; p = 0.0022, Anova test). These observed differences were not related to occurrence of diarrhea, suggesting that the infection/carriage of C. jejuni may be associated with “subclinical” injury resulting in a significant negative impact on nutritional status. In fact, diarrhea cases with hipO+ had lower WHZ than to diarrhea cases without C. jejuni (ie hipO-; p< 0.05).

Figure 2.

Figure 2

Open in a new tab

Graphic representation of the correlation between the mean values of WAZ and WHZ z-scores for hipO+ positive (PCR C. jejuni detection) and hipO- samples. The WAZ and WHZ z-scores were obtained from calculations performed with the height, weight and age data. Children with hipO + samples presented poorer mean WAZ (-1.033 ± 1.29, n=14) and WHZ (-0.476 ± 1.25, n=14) values than children with hipO- samples (0.037 ± 1.31, n=130 for WAZ and 0.65 ± 1.17, n=130 for WHZ) as noted with Anova test (p=0.0073 and p= 0.0022 for WAZ and WHZ mean values, respectively). NOTE: Z-scores = Nutritional parameters for assessment of malnutrition; WAZ= weight-for-age z-score; WHZ= weight-for-height z-score; hipO+= positive samples for molecular detection of C. jejuni; hipO-= negative samples for molecular detection of C. jejuni; hipO= C. jejuni's hippurate hydrolase encoding gene, PCR= Polymerase Chain Reaction; *= statistically significant difference.

The cdtABC Operon

We performed Multiplex PCR amplification for cdtABC operon for all samples which showed positive or indeterminate results for ELISA ProSpect (20 cases and 31 controls), but only the hipO+ samples presented cdtABC amplification. For this reason, the results were presented as percentage of hipO+ samples (Table 2). In diarrhea group, 50.0% (4/8) of samples had amplification of cdtABC operon. In the non-diarrhea group, 66.7% (4/6) of hipO+ samples presented cdtABC operon amplification. There was no significant difference between groups. The multiplex PCR products for the cdtABC genes are shown in Figure 1C.

DISCUSSION

This was a case-control study where both groups had similar age and sex. However, the diarrhea group showed significantly lower WAZ and WHZ compared to the control group without diarrhea. Several reports including this group of research have shown before that diarrheal diseases were cause of malnutrition as well as malnutrition contributed to increase the risk for more diarrheal diseases (Black et al, 1984; Checkley et al, 2008; Guerrant et al, 2008). The extensive etiology study of diarrhea, from this same area, has been done before, including association or risk factor for malnutrition (Lima et al, 2000; Moore et al, 2000). Although we cannot distinguish cause from effect of infection on malnutrition in this study, the results are consistent with the literature, recognizing association and, furthermore, it adds C. jejuni to this list of specific pathogens associated with malnutrition.

The innovation of this study is the molecular detection of C. jejuni/coli direct from frozen fecal samples and therefore samples unavailable for detection by standard microbiological methods. The traditional methods for identification of Campylobacter genus involves the use of proper culture media followed by biochemical tests, which require approximately 72-96 hours to complete phenotypic identification. Molecular detection of Campylobacter has been described as credible and reliable tool (Kulkarni et al, 2002; Lawson et al, 1999; Linton et al, 1997; Lübeck et al, 2003; Oyofo et al, 1992; Samie et al, 2007; Waegel and Nachamkin, 1996; Vanniasinkam et al, 1999).

In pilot studies (data not published) we tested sensitivity and specificity of our PCR assays, and the efficiency of our DNA extraction technique. Comparing to the microbiologic diagnostic, our PCR tests have 88% of sensibility and 95% of specificity. The samples used were tested at similar conditions as the ones used in this presented work.

We also tested our DNA extraction and pre-treatment methods, which supposedly could improve the extraction and decrease the interference of PCR inhibitory substances present in fecal material. The commercial kit used for DNA extraction directly from stool (QIAmp DNA Stool Mini kit - Qiagen, USA) contains a resin capable of adsorbing the DNA-damaging substances and PCR inhibitors present in fecal material. Also, in our tests, extractions without prior treatment showed better results in PCR reactions performance. Those preliminary tests let us to conclude that the direct use of untreated fecal samples (as target for pathogen DNA extraction) is efficient and reduces time and labor work.

In order to provide more support to these molecular probes used for diagnosis, we conducted an enzyme-immunosorbent assay (ELISA Prospect® Campylobacter Microplate Assay; called ProSpect ELISA). This immune-enzymatic tool provided some clue to these biology molecular probes, since all positive samples for PCR (hipO+ and/or ask+ samples) were also positive for ProSpect ELISA. Comparing to the microbiologic diagnostic, we tested ProSpect ELISA's sensitivity and specificity, and we found 92% of sensitivity and 95% of specificity.

Although molecular tools do not replace conventional methods, these techniques can be useful in assessing fastidious pathogens that can be difficult to culture in some settings (Foxman and Riley, 2001). The advantages of methods based on nucleic acids molecular detection include: a) speed and specificity; b) possibility of directly detection without culture; and c) greater sensitivity for pathogens that may cause subclinical but important infections. The disadvantages are: a) cost; b) difficulty in achieving standardization of molecular methods (Abubakar et al, 2007; WHO, 2001); c) inability to obtain an isolate for further phenotypic investigations (Wright and Wynford-Thomas, 1990). Nevertheless, genetic studies are extremely helpful in the elucidation of pathogens and their virulence genes.

The prevalence rate found in this study for C. jejuni (9.6% for diarrhea group and 7.2% for non-diarrhea group) are quite similar to the prevalence rates seen in previous Brazilian studies using traditional method of microbiologic culture and biochemical tests: (i) 7.5% Campylobacter isolation rate from a prospective (over 30 months) study of diarrhea diseases in a village closeby to Fortaleza in Northeastern Brazil (Guerrant et al, 1983), and (ii), in a case-control study in southeastern Brazil, Campylobacter sp. was isolated in 11.2% of cases of diarrhea and 6.6% of controls (Mendes et al, 1987). In a recent African study, however, Campylobacter was not found in control group (Samuel et al, 2006). Two earlier African studies also encountered 6% prevalence rates of C. jejuni/coli in control groups (Aboderin et al, 2002; Bhadra et al, 1992).

C. coli detection showed a trend toward increased numbers of ask gene detection in children with diarrhea compared to those without diarrhea, but the difference did not reach statistical significance. Since the prevalence found in this study was low, we will need a better sample size to clarify if C. coli is a significant enteropathogen associated or not with diarrheal diseases.

The isolation of Campylobacter from children without diarrhea is well-documented in developing countries (Coker et al, 2002; Hassan et al, 2006; Huilan et al, 1991; Molback et al, 1994) and this common occurrence of asymptomatic Campylobacter carriers provides evidence of development of immune protection against clinical disease but not against colonization (Havelaar et al, 2009).

We have detected a low prevalence rate of co-infections, C. jejuni and C. coli, in only 1.8% and this finding was also seen in another pediatric campylobacteriosis study reported from India (Bhadra et al, 1992).

The present study showed an association of C. jejuni molecular detection with worsened nutritional parameters in children. Similar findings have also been reported in African and South American studies. In Africa, two studies have demonstrated that the isolation rate of Campylobacter is higher among malnourished children with diarrhea (Kakai et al, 1995; Lloyde-Evans et al, 1983). In Chile, it was determined that the occurrence of Campylobacter species is significantly most frequent among healthy malnourished children than among healthy well-nourished children (Fernández et al, 2008).

The mechanisms by which Campylobacter induces disease are not clearly understood (Poly and Guerry, 2008). However, two mechanisms for gastrointestinal illness are postulated based on clinical syndromes found in patients: (i) intestinal adherence and toxin production which may impair the fluid absorption by the intestine, thus causing secretory diarrhea (Wassenaar, 1997); and (ii) bacterial invasion and proliferation within the intestinal mucosa resulting in inflammatory or bloody diarrhea (Janssen et al, 2008). C. jejuni produces CDT (Guerrant et al, 1987; Johnsson and Lior, 1988) that causes cytodistention of affected epithelial cells and arrest of cell cycle resulting in apoptosis. CDT comprised three subunits - cdtA, cdtB, and cdtC - which are all necessary for cytolethal distending toxin activity (Lara-Tejero and Gálan, 2001). Although the genes encoding this protein seem to be universally present in C. jejuni, the efficiency of strains invading cultured human cells varies greatly, implying that different strains may have important genetic differences (Al-Mahmeed et al, 2006).

In order to explore this possibility, we performed a multiplex PCR assay to identify the presence of these CDT enconding genes in stool samples positive for C. jejuni. We found cdtABC operon genes in 57.1% of all hipO+ samples, with no significant differences between diarrhea and non-diarrhea groups. These data did not answer why a child presented diarrhea or not, but gave us a clue about the existence of genetic diversity of the circulating strains of C. jejuni in this study site.

In conclusion, these findings suggest that PCR is a potential diagnostic tool for detecting C. jejuni/coli direct from frozen stool samples. The influence of malnutrition as a risk for harboring Campylobacter must still be determined. This report suggests that further studies are warranted to evaluate the prevalence, heterogeneity and combinations of virulence-related genes in Campylobacter infections in children as well as their association with malnutrition.

ACKNOWLEDGEMENTS

We would like to thanks to the field workers headed by Sayonara B. Alencar; the Microbiology Laboratory staff headed by Maria do Carmo Pinho, the ethic and data management team and many others from Clinical Research Unit and Institute of Biomedicine, School of Medicine, Federal University of Ceará. We acknowledge also Leah J. Barrett at the University of Virginia for her help on this study. We are indebted with all children and their families for their participation in this study.

Financial support: Fogarty Clinical Research Training Scholars and Fellows Program (grants 3D43TW006578-04S1, 3D43TW006578-05S1, and 5R24TW007988) and National Institute of Allergy and Infectious Diseases – NIAID (grant 2U01AI026512-17) from U. S. National Institutes of Health; Conselho Nacional de Desenvolvimento Científico e Tecnológico – CNPq (grants 141663/2005-7, 484747/2007-0 and 140242/2009-0) and Fundação Cearense de Apoio ao Desenvolvimento Científico e Tecnológico – FUNCAP (grant 2911/06) from Brazil.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

CITED REFERENCES

  1. Aboderin AO, Smith SI, Ovelese AO, Oniped AO, Zailani SB, Coker AO. Role of Campylobacter jejuni/coli in diarrhoea in Ile-Ife, Nigeria. East Afri Med J. 2002;79(8):423–426. [PubMed] [Google Scholar]
  2. Abubakar I, Irvine L, Aldus CF, Wyatt GM, Fordham R, Schelenz S, Shepstone L, Howe A, Peck M, Hunter PRA. A systematic review of the clinical public health and cost-effectiveness of rapid diagnostic tests for the detection and identification of bacterial intestinal pathogens in faeces and food. Health Technol Assess. 2007;11(36):26–33. doi: 10.3310/hta11360. [DOI] [PubMed] [Google Scholar]
  3. Ajjampur SS, Rajendran P, Ramani S, Banerjee I, Monica B, Sankaran P, Rosario V, Arumugan R, Sarkar R, Ward H, Kang G. Closing the diarrhoea diagnostic gap in Indian children by the application of molecular techniques. J Med Microbiol. 2008;57(11):1364–1368. doi: 10.1099/jmm.0.2008/003319-0. [DOI] [PubMed] [Google Scholar]
  4. Al-Mahmeed A, Senok AC, Ismaael AY, Bindayna KM, Tabbara KS, Botta GA. Clinical relevance of virulence genes in Campylobacter isolates in Bahrain. J Med Microbiol. 2006;55(7):839–843. doi: 10.1099/jmm.0.46500-0. [DOI] [PubMed] [Google Scholar]
  5. Amar CF, East C, Maclure J, Jenkins C, Duncanson P, Wareing DR. Blinded application of microscopy, bacteriological culture, immunoassays and PCR to detect gastrointestinal pathogens from faecal samples of patients with community-acquired diarrhoea. Eur J Clin Microbiol Infect Dis. 2004;23(7):529–534. doi: 10.1007/s10096-004-1149-x. [DOI] [PubMed] [Google Scholar]
  6. Amieva MR. Important bacterial gastrointestinal pathogens in children: a pathogenesis perspective. Pediatr Clin North Am. 2005;52(3):749–777. doi: 10.1016/j.pcl.2005.03.002. [DOI] [PubMed] [Google Scholar]
  7. Bhadra RK, Dutta P, Bhattacharya SK, Dutta SK, Pal SC, Balakrish Nair G. Campylobacter species as a cause of diarrhea in children in Calcutta. J Infect. 1992;24(1):55–62. doi: 10.1016/0163-4453(92)90982-c. [DOI] [PubMed] [Google Scholar]
  8. Black RE, Brown KH, Becker S. Malnutrition is a determining factor in diarrheal duration, but not incidence, among young children in a longitudinal study in rural Bangladesh. Am J Clin Nutr. 1984;39(1):87–94. doi: 10.1093/ajcn/39.1.87. [DOI] [PubMed] [Google Scholar]
  9. Caner V, Cokal Y, Cetin C, Sen A, Karagenc N. The detection of hipO gene by real-time PCR in thermophilic Campylobacter spp. with very weak and negative reaction of hippurate hydrolysis. Antonie Van Leeuwenhoek. 2008;94(4):527–532. doi: 10.1007/s10482-008-9269-4. [DOI] [PubMed] [Google Scholar]
  10. Centers for Disease Control and Prevention – CDC / USA Preliminary FoodNet data on the incidence of infection with pathogens transmitted commonly through food – 10 States, 2008. MMWR Morb Mortal Wkly Rep. 2009;58(13):333–7. [PubMed] [Google Scholar]
  11. Checkley W, Buckley G, Gilman RH, Assis AM, Guerrant RL, Morris SS, Molbak K, Valentiner-Branth P, Lanata CF, Black RE, Childhood Malnutrition and Infection Network Multi-country analysis of the effects of diarrhea on childhood stuntin. Int J Epidemiol. 2008;37(4):816–830. doi: 10.1093/ije/dyn099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chen ML, Ge Z, Fox JG, Schauer DB. Disruption of tight junctions and induction of proinflammatory cytokine responses in colonic epithelial cells by Campylobacter jejuni. Infect Immun. 2006;74(12):6581–6589. doi: 10.1128/IAI.00958-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Coker AO, Isokpehi RD, Thomas BN, Amisu KO, Obi CL. Human campylobacteriosis in developing countries. Emerg Infect Dis. 2002;8(3):237–244. doi: 10.3201/eid0803.010233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dediste A, Vandenberg O, Vlaes L, Ebraert A, Douat N, Bahwere P, Butzler JP. Evaluation of the ProSpecT microplate assay for detection of Campylobacter: A routine laboratory perspective. Clin Microbiol Infect. 2003;9:1085–1090. doi: 10.1046/j.1469-0691.2003.00705.x. [DOI] [PubMed] [Google Scholar]
  15. Fernández H, Vera F, Villanueva MP, García A. Occurrence of Campylobacter species in healthy well-nourished and malnourished children. Braz J Microbiol. 2008;39:56–58. doi: 10.1590/S1517-838220080001000013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Foxman B, Riley L. Molecular epidemiology: focus on infection. Am J Epidemiol. 2001;153(12):1135–1141. doi: 10.1093/aje/153.12.1135. [DOI] [PubMed] [Google Scholar]
  17. Guerrant RL, Kirchhoff LV, Nations MK, Leslie J, de Sousa MA, Araujo JG, Correia LL, Sauer KT, McClelland KE. Prospective study of diarrheal in northeastern Brazil: patterns of disease, nutritional impact, etiologies, and risk factors. J Infect Dis. 1983;146(6):986–997. doi: 10.1093/infdis/148.6.986. [DOI] [PubMed] [Google Scholar]
  18. Guerrant RL, Wanke CA, Pennie RA, Barret LJ, Lima AA, O'Brien AD. Production of a unique cytotoxin by Campylobacter jejuni. Infect Immun. 1987;55(1):2526–2530. doi: 10.1128/iai.55.10.2526-2530.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Guerrant RL, Oriá RB, Moore SR, Oriá MO, Lima AA. Malnutrition as an enteric infectious disease with long-term effects on child development. Nutr Rev. 2008;66(9):487–505. doi: 10.1111/j.1753-4887.2008.00082.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hani EK, Chan VL. Expression and characterization of Campylobacter jejuni benzoylglycine amidohydrolase (Hippuricase) gene in Escherichia coli. J Bacteriol. 1995;177(9):2396–2402. doi: 10.1128/jb.177.9.2396-2402.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hannu T, Mattila L, Rautelin H, Pelkonen P, Lahdenne P, Siitonen A, Leirisalo-Repo M. Campylobacter-triggered reactive arthritis: a population-based study. Rheumatol (Oxford) 2002;41:312–318. doi: 10.1093/rheumatology/41.3.312. [DOI] [PubMed] [Google Scholar]
  22. Hasan KZ, Pathela P, Alam K, Podder G, Faruque SM, Roy E, Haque AK, Haque R, Albert MJ, Siddique AK, Sack RB. Aetiology of diarrhoea in a birth cohort of children aged 0–2 year(s) in rural Mirzapur, Bangladesh. J Health Popul Nutr. 2006;24:25–35. [PubMed] [Google Scholar]
  23. Havelaar AH, van Pelt W, Ang W, Wagenaar JA, van Putten JPM, Gross U, Newell DG. Immunity to Campylobacter: its role in risk assessment and epidemiology. Crit Rev Microbiol. 2009;35(1):1–22. doi: 10.1080/10408410802636017. [DOI] [PubMed] [Google Scholar]
  24. Huilan S, Zhen LG, Mathan MM, Mathew MM, Olarte J, Espejo R, Khin MU, Ghafoor MA, Khan MA, Sami Z, Sutton RG. Etiology of acute diarrhea among children in developing countries: a multicentre study in five countries. Bull WHO. 1991;69(5):549–555. [PMC free article] [PubMed] [Google Scholar]
  25. Humphrey T, O'Brien S, Madsen M. Campylobacters as zoonotic pathogens: a food production perspective. Int J Food Microbiol. 2007;117:237–257. doi: 10.1016/j.ijfoodmicro.2007.01.006. [DOI] [PubMed] [Google Scholar]
  26. Janssen R, Krogfelt KA, Cawthraw SA, van Pelt W, Wagenaar JA, Owen RJ. Host-pathogen interactions in Campylobacter infections: the host perspective. Clin Microbiol Rev. 2008;21(3):505–518. doi: 10.1128/CMR.00055-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Johnson WM, Lior HA. A new heat-labile cytolethal distending toxin (CLDT) produced by Campylobacter spp. Microb Pathog. 1988;4(2):115–126. doi: 10.1016/0882-4010(88)90053-8. [DOI] [PubMed] [Google Scholar]
  28. Kaira V, Chaudhry R, Dua T, Dhawan B, Sahu JK, Mridula B. Association of Campylobacter jejuni infection with childhood Guillain-Barré syndrome: a case-control study. J Child Neurol. 2009;24(6):664–668. doi: 10.1177/0883073808325649. [DOI] [PubMed] [Google Scholar]
  29. Kakai R, Walmole IA, Bwayo JJ, Ndinya-Achola JO. Enteric pathogens in malnourished chidren with diarrhoea. East Afr Med. 1995;72(5):288–289. [PubMed] [Google Scholar]
  30. Kalischuk LD, Inglis GD, Buret AG. Campylobacter jejuni induces transcellular translocation of commensal bacteria via lipid rafts. Gut Pathog. 2009;1:2. doi: 10.1186/1757-4749-1-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kulkarni SP, Lever S, Logan JM, Lawson AJ, Stanley J, Shafi MS. Detection of Campylobacter species: a comparison of culture and polymerase chain reaction based methods. J Clin Pathol. 2002;55(10):749–753. doi: 10.1136/jcp.55.10.749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lara-Tejero M, Gálan JE. CdtA, CdtB and CdtC form a tripartide complex that is required for cytolethal distending toxin activity. Infect Immun. 2001;69(7):4358–4365. doi: 10.1128/IAI.69.7.4358-4365.2001. 2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lawson AJ, Logan JM, O'Neill GL, Desai M, Stanley J. Large-scale survey of Campylobacter species in human gastroenteritis by PCR and PCR-enzyme-linked immunosorbent assay. J Clin Microbiol. 1999;37:3860–3864. doi: 10.1128/jcm.37.12.3860-3864.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lima AA, Moore SR, Barboza MS, Jr, Soares AM, Scheulepner MA, Newman RD, Sears CL, Nataro JP, Fedorko DP, Wuhib T, Schorling JB, Guerrant RL. Persistent diarrhea signals a critical period of increased diarrhea burdens and nutritional shortfalls: a prospective cohort study among children in Northeastern Brazil. J Infect Dis. 2000;181:1643–1651. doi: 10.1086/315423. [DOI] [PubMed] [Google Scholar]
  35. Linton D, Lawson AJ, Owen RJ, Stanley J. PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. J Clin Microbiol. 1997;35(10):2568–2572. doi: 10.1128/jcm.35.10.2568-2572.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lloyde-Evans N, Drasar BS, Tomkins AM. A comparison of the prevalence of Campylobacter, Shigellae and Salmonella in faeces of malnourished and well nourished children in Gambia and Northern Nigeria. Trans R Soc Trop Me Hyg. 1983;77(2):245–247. doi: 10.1016/0035-9203(83)90082-2. [DOI] [PubMed] [Google Scholar]
  37. Lübeck PS, Cook N, Wagner M, Fach P, Hoorfar J. Toward an international standard for PCR-based detection of food-borne thermotolerant campylobacters: validation in a multicenter collaborative trial. Appl Environ Microbiol. 2003;69:5670–5672. doi: 10.1128/AEM.69.9.5670-5672.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. MacCallum A, Hardy SP, Everest PH. Campylobacter jejuni inhibits the absorptive transport functions of Caco-2 cells and disrupts cellular tight junctions. Microbiology. 2005;151(Pt 7):2451–2458. doi: 10.1099/mic.0.27950-0. [DOI] [PubMed] [Google Scholar]
  39. Marshall JK, Thabane M, Garg AX, Clark WF, Salvadori M, Collins SM. Incidence and epidemiology of irritable bowel syndrome after a large waterborne outbreak of bacterial dysentery. Gastroenterol. 2006;131(2):445–450. doi: 10.1053/j.gastro.2006.05.053. [DOI] [PubMed] [Google Scholar]
  40. Mendes EN, Queiroz DMM, Cisalpino EO, Peres JN, Penna F, Figueiredo-Filho PP. Occurrence of Campylobacter jejuni in children with and without diarrhea, in Belo Horizonte. Rev Microbiol Soc Bras Med. 1987;181(1):25–30. [Google Scholar]
  41. Mohran Z, Arthur RR, Oyofo BA, Peruski LF, Wasfy MO, Ismail TF, Murphy JR. Differentiation of Campylobacter isolates on the basis of sensitivity to boiling in water as measured by PCR-detectable DNA. Appl Environ Microbiol. 1998;64(1):363–365. doi: 10.1128/aem.64.1.363-365.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Molbak K, Wested N, Hojlyng N, Scheutz F, Gottschau A, Aaby P, da Silva AP. The etiology of early childhood diarrhea: a community study from Guinea-Bissau. J Infect Dis. 1994;169:581–587. doi: 10.1093/infdis/169.3.581. [DOI] [PubMed] [Google Scholar]
  43. Moore JE, Corcoran D, Dooley JSG, Fanning S, Lucey B, Matsuda M, McDowell DA, Mégraud F, Millar CB, O'Mahony R, O'Rordan L, O'Rourke M, Rao JR, Rooney PJ, Sails A, Whyte P. Campylobacter. Vet Res. 2005;36(3):351–382. doi: 10.1051/vetres:2005012. [DOI] [PubMed] [Google Scholar]
  44. Moore SR, Lima AA, Schorling JB, Barboza MS, Jr, Soares AM, Guerrant RL. Changes over ime in the epidemiology of diarrhea and malnutrition among children in an urban Brazilian shantytown, 1989 to 1996. Int J Infect Dis. 2000;4(4):179–186. doi: 10.1016/s1201-9712(00)90106-1. [DOI] [PubMed] [Google Scholar]
  45. Nielsen H, Hansen KK, Gradel KO, Kristensen B, Ejlertsen T, Ostergaard C, Schoneheyder HC. Bacteremia as a result of Campylobacter species: a population-based study of epidemiology and clinical risk factors. Clin Microbiol Infect. 2010;16(1):57–61. doi: 10.1111/j.1469-0691.2009.02900.x. [DOI] [PubMed] [Google Scholar]
  46. On SLW. Taxonomy of Campylobacter, Arcobacter, Helicobacter and related bacteria: current status, future prospects and immediate concerns. J Appl Microbiol. 2001;30:1S–15S. doi: 10.1046/j.1365-2672.2001.01349.x. [DOI] [PubMed] [Google Scholar]
  47. Oyofo BA, Thornton SA, Burr DH, Trust TJ, Pavlovskis OR, Guerry P. Especific detection of Campylobacter jejuni and Campylobacter coli by using polymerase chain reaction. J Clin Microbiol. 1992;30(10):2613–2619. doi: 10.1128/jcm.30.10.2613-2619.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Podewils LJ, Mintz ED, Nataro JP, Parashar UD. Acute, infectious diarrhea among children in developing countries. Semin Pediatr Infect Dis. 2004;15:155–168. doi: 10.1053/j.spid.2004.05.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Poly F, Guerry P. Pathogenesis of Campylobacter. Curr Opin Gastroenterol. 2008;24(1):27–31. doi: 10.1097/MOG.0b013e3282f1dcb1. [DOI] [PubMed] [Google Scholar]
  50. Sambrook J, Russel DW. Molecular cloning – a laboratory manual. 3 ed. Vol. 3. Cold Spring Harbor Laboratory Press; New York: 2001. The basic polymerase chain reaction. pp. 8.19–8.24. [Google Scholar]
  51. Samie A, Obi CL, Barret LJ, Powell SM, Guerrant RL. Prevalence of Campylobacter species, Helicobacter pylori and Arcobacter species in stool sample from the Venda region, Limpopo, South Africa: studies using molecular diagnostic methods. J Infect. 2007;54(6):558–566. doi: 10.1016/j.jinf.2006.10.047. [DOI] [PubMed] [Google Scholar]
  52. Samuel SO, Aboderin AO, Akanbi AA, 2nd, Adegboro B, Smith SI, Coker AO. Campylobacter enteritis in Ilorin, Nigeria. East Afri Med J. 2006;83(9):478–484. doi: 10.4314/eamj.v83i09.46770. [DOI] [PubMed] [Google Scholar]
  53. Slater ER, Owen RJ. Restriction fragment length polymorphism analysis shows that the hippuricase gene of Campylobacter jejuni is highly conserved. Lett Appl Microbiol. 1997;25(4):274–278. doi: 10.1046/j.1472-765x.1997.00218.x. [DOI] [PubMed] [Google Scholar]
  54. Steele M, Marcone M, Gyles C, Chan VL, Odumeru J. Enzymatic activity of Campylobacter jejuni hippurate hydrolase. Protein Eng Des Sel. 2006;19(1):17–25. doi: 10.1093/protein/gzi071. [DOI] [PubMed] [Google Scholar]
  55. Talukder KA, Aslam M, Islam Z, Azmi IJ, Dutta DK, Hossain S, Nur-e-Kamal A, Nair GB, Cravioto A, Sack DA, Endtz HP. Prevalence of virulence genes and cytolethal distending toxin production in Campylobacter jejuni isolates from diarrheal patients in Bangladesh. J Clin Microbiol. 2008;46(4):1485–1488. doi: 10.1128/JCM.01912-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Tam CC, O'Brien SJ, Adak GK, Meakins SM, Frost JA. Campylobacter coli - an important foodborne pathogen. J Infect. 2003;47(1):28–32. doi: 10.1016/s0163-4453(03)00042-2. [DOI] [PubMed] [Google Scholar]
  57. Vaillant V, De Valk H, Baron E, Ancelle T, Colin P, Delmas MC, Dufour B, Pouillot R, Le Strat Y, Weinbreck P, Jougla E, Desenclos JC. Foodborne Pathogens and Disease. Foodborne Pathog Dis. 2005;2(3):221–232. doi: 10.1089/fpd.2005.2.221. [DOI] [PubMed] [Google Scholar]
  58. Volokov D, Chizhikov V, Chumakov K, Rasooly A. Microarray-based identification of thermophilic Campylobacter jejuni, C. coli, C. lari and C. upsaliensis. J Clin Microbiol. 2003;41(9):4071–4080. doi: 10.1128/JCM.41.9.4071-4080.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Waegel A, Nachamkin I. Detection and molecular typing of Campylobacter jejuni in fecal samples by polymerase chain reaction. Mol Cell Probes. 1996;10(2):75–80. doi: 10.1006/mcpr.1996.0011. [DOI] [PubMed] [Google Scholar]
  60. Wassenaar TM. Toxin production by Campylobacter spp. Clin Microbiol Review. 1997;10(3):466–476. doi: 10.1128/cmr.10.3.466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. World Health Organization – WHO / Department of Communicable Disease Surveillance and Response The increasing incidence of human campylobacteriosis report and proceeding of a WHO consultation of experts. 2001 Available on line: < http://whqlibdoc.who.int/hq/2001/WHO_CDS_APH_2001.7_pdf>.
  62. Vanniasinkam TJ, Lanser A, Barton MD. PCR for the detection of Campylobacter spp. in clinical specimens. Lett Appl Microbiol. 1999;28:52–56. doi: 10.1046/j.1365-2672.1999.00474.x. [DOI] [PubMed] [Google Scholar]
  63. Wright PA, Wynford-Thomas D. The polymerase chain reaction: miracle or mirage? A critical review of its uses and limitations in diagnosis and research. J Pathol. 1990;162(2):99–117. doi: 10.1002/path.1711620203. [DOI] [PubMed] [Google Scholar]
  64. Zilbauer M, Dorrel N, Wren BW, Bajaj-Elliott M. Campylobacter jejuni-mediated disease pathogenesis: an update. Trans R Soc Trop Med Hyg. 2008;102(2):123–129. doi: 10.1016/j.trstmh.2007.09.019. [DOI] [PubMed] [Google Scholar]

RESOURCES