Skip to main content
PMC home page
Journal of Neurophysiology logoLink to Journal of Neurophysiology
. 2010 Mar 31;103(6):3027–3033. doi: 10.1152/jn.01138.2009

Expression of Neuronal Nitric Oxide Synthase in Rabbit Carotid Body Glomus Cells Regulates Large-Conductance Ca2+-Activated Potassium Currents

Yu-Long Li 1, Hong Zheng 2, Yanfeng Ding 2, Harold D Schultz 2,✉
PMCID: PMC2888235  PMID: 20357072

Abstract

Our previous studies show that a decrease in endogenous nitric oxide (NO) is involved in the blunted outward K+ currents in carotid body (CB) glomus cells from chronic heart failure (CHF) rabbits. In the present study, we measured the effects of the neuronal nitric oxide synthase (nNOS) transgene on the K+ currents in CB glomus cells from pacing-induced CHF rabbits. Using single-cell real-time RT-PCR and immunofluorescent techniques, we found that nNOS mRNA and protein are expressed in the rabbit CB glomus cells and CHF decreased the expression of nNOS mRNA and protein in CB glomus cells. After 3 days of an adenoviral nNOS (Ad.nNOS) gene transfection, the expression of nNOS protein was increased to the level found in sham CB glomus cells. In whole cell patch-clamp experiments, Ad.nNOS markedly reversed the attenuated K+ currents in CB glomus cells from CHF rabbits. The specific nNOS inhibitor (S-methyl-l-thiocitrulline [SMTC]) and large-conductance Ca2+-activated K+ (BK) channel blocker (iberiotoxin) fully abolished the effect of Ad.nNOS on the K+ currents in the CB glomus cells from CHF rabbits. However, neither CHF nor Ad.nNOS altered the protein expression of BK channel α-subunit. These results suggest that a decrease of NO induced by an attenuated nNOS activity lowers the activation of the BK channels but not the protein expression of the BK channel α-subunit in the CB glomus cells during CHF.

INTRODUCTION

It is known that enhanced peripheral chemoreflex sensitivity occurs in pacing-induced chronic heart failure (CHF) rabbits (Sun et al. 1999a), which contributes to increased sympathetic outflow in the CHF state, given that inhibition of peripheral chemoreceptor activity is shown to reduce resting renal sympathetic nerve activity (RSNA) (Sun et al. 1999a). Our previous study has found that an augmented afferent signal from the carotid body (CB) chemoreceptors mediates the enhancement of peripheral chemoreflex sensitivity in CHF rabbits (Sun et al. 1999b).

As the primary sensor of the peripheral chemoreflex, the CB is composed of neurotransmitter-enriched glomus cells and glial-like sustentacular cells among other neuronal structures. Although many voltage-gated ion channels exist in the glomus cell membrane, the suppression of outward K+ channels is assumed to contribute to the initial depolarization of cells, release of neurotransmitter, and augmentation of afferent signal input in the carotid sinus nerve (Gonzalez et al. 1994; Prabhakar 1994). Nitric oxide (NO) is a gas molecule that functions as a modulator in both the peripheral and the central nervous systems and is synthesized by NO synthase (NOS) including neuronal (nNOS), endothelial (eNOS), and inducible (iNOS) (Snyder 1992). Our previous study documented that a decreased availability of NO reduced K+ currents in CB glomus cells from CHF rabbits. Further, we ascertained that down-regulation of NO synthesis in the CB from CHF rabbits contributed to the CB chemoreceptor hypersensitivity (Sun et al. 1999b) and transgene overexpression of nNOS (adenoviral nNOS [Ad.nNOS]) significantly reversed enhanced chemoreceptor function in CHF rabbits (Li et al. 2005). Therefore our first purpose in the present study was to test the effect of Ad.nNOS on the K+ currents in sham and CHF CB glomus cells.

Although our studies have found that NO plays an important role in regulating K+ channels of glomus cells, chemoreceptor discharge, and chemoreflex sensitivity in sham and CHF rabbits (Ding et al. 2008; Li et al. 2004, 2005; Sun et al. 1999b), it is unclear whether NOS is present in the rabbit CB glomus cell. In rats and cats, NOS was found to exist in the extensive plexus of nerve fibers and vessels surrounding glomus cells, but not within glomus cells (Dvorakova and Kummer 2005; Wang et al. 1993, 1994). Therefore our second purpose was to establish whether CB glomus cells from rabbits express nNOS mRNA and protein by single-cell real-time RT-PCR and immunofluorescent techniques and whether nNOS expression in glomus cells is altered in CHF.

METHODS

Pacemaker implant and production of CHF

All experiments were carried out on male New Zealand White rabbits weighing 2.5–3.5 kg (n = 51 rabbits). Experiments were approved by the University of Nebraska Medical Center Institutional Animal Care and Use Committee and were carried out in accordance with the National Institutes of Health (Publication No. 85-23, revised 1996) and the American Physiological Society's Guide for the Care and Use of Laboratory Animals. Rabbits were assigned to sham-operated and CHF groups. They were housed in individual cages under controlled temperature and humidity and a 12-h/12-h dark–light cycle and fed standard rabbit chow with water available without restriction.

Rabbits were anesthetized with a cocktail consisting of 5.8 mg/kg xylazine, 35 mg/kg ketamine, and 0.01 mg/kg atropine given as an intramuscular (im) injection, intubated, and connected to a small animal anesthesia respiration unit using 2.0–5.0% inhalation isoflurane with oxygen for the duration of the surgery. Using sterile technique, a left thoracotomy was performed as previously described (Sun et al. 1999a). Briefly, a pin electrode was attached to the left ventricle and a ground electrode was secured to the left atrium for pacing. All wires were tunneled beneath the skin and exited in the midscapular area. The chest was closed. Rabbits were placed on an antibiotic regimen consisting of 5 mg/kg Baytril, im, for 5 days. After 2 wk, the pacing was started at 340 beats/min (bpm), held for 7 days, after which the rate was gradually increased to 380 bpm, with an increment of 20 bpm each week. The progression of CHF was monitored by weekly echocardiograms (Acuson Sequoia 512C with a 4 MHz probe) with the pacemaker turned off for ≥30 min before the recordings were started. Sham-operated animals underwent a similar period of echocardiographic measurements. CHF was characterized by a >40% reduction in ejection fraction (EF) and fraction of shortening (FS) and dilation of the left ventricle in both systole and diastole.

Isolation and identification of CB glomus cells

The isolation and identification of CB glomus cells were performed as described in our previous study (Li et al. 2004). Briefly, the carotid bifurcations on both sides were removed surgically from sham or CHF rabbits anesthetized with the cocktail described earlier. The removed tissue was subjected to a two-step enzymatic digestion protocol. Each step lasted for 25 min at 37°C. The enzymatic solution for the first step of digestion contained trypsin (type II, 2 mg/ml) and collagenase (type IV, 2 mg/ml); that for the second step contained collagenase (4 mg/ml) and bovine serum albumin (BSA, 5 mg/ml). The isolated cells including glomus cells, other neural cells, and vascular cells were cocultured at 37°C in a humidified atmosphere of 95% air-5% CO2.

Culture cells were superfused with an extracellular solution containing Na+. Those cells that exhibited Na+ current were considered to be glomus cells (Overholt and Prabhakar 1997).

Gene transfer with Ad.EGFP or Ad.nNOS to the CB glomus cells

The Ad.nNOS originally described by Channon et al. (1996) was used in these experiments. This Ad.nNOS, containing a nNOS cDNA, expresses functional nNOS protein when perfused in carotid arteries of rabbits (Channon et al. 1998). After isolated CB cells were cultured about 6 h, Ad.EGFP (as control adenoviruses) or Ad.nNOS (1 × 107 pfu/ml, 10 μl) was slowly added into the culture dish containing isolated primary CB cells. All experiments were performed 3 days after gene transfer. Enhanced green fluorescent protein (EGFP) was directly measured under a Leica microscope at 510 nm with single excitation peak and at 490 nm of green light (Hajjar et al. 1998) to evaluate the infection efficiency of the adenovirus (Xia et al. 2002).

Single-cell real-time PCR for nNOS mRNA

After a glomus cell was identified by patch-clamp technique (see following text), the cell and the pipette's content were expelled into a 0.2 ml polymerase chain reaction (PCR) tube containing the following reagents: 5 μl volume consisting of 1 μl 5× lysis buffer (100 μl 5× lysis buffer consisting of 25 μl 1 M Tris-HCl, 27.5 μl 1 M KCl, 1.5 μl 1 M MgCl2, 2.5 μl NP-40, 33.5 μl DNase free water), 0.5 μl RNA Guard Mix (10 μl consisting of 2 μl 5× first strand cDNA synthesis buffer, 2 μl RNase inhibitor, 6 μl DNase free water), and 3.5 μl DNase free water, which was kept at −80°C until reverse transcription (RT) was performed.

For the RT reaction, after the content of each tube was thawed, 4 μl iScript Reaction Mix (Bio-Rad, Hercules, CA), 1 μl iScript Reverse Transcripase (Bio-Rad), and DNase free water were added to the total volume of 20 μl. RT was performed for 30 min at 42°C and then cDNA was kept at −80°C.

There were two rounds of amplification for PCR and three primers (Table 1) were used. The first round of amplification used two primers. The second round of amplification used one of the primers of the first round and a new internal primer. PCR reaction was performed in a 50 μl volume containing 25 μl IQ Syber Green Supermix (Bio-Rad), 40 nM (in the first round) or 300 nM (in the second round) of each primer. In the first round of amplification, a 2 μl aliquot of the RT product was used and then 5 μl of the first-round product was used in the second round of amplification. Negative control samples were taken from the aspiration buffer without cells. The cDNA was amplified by real-time quantitative PCR with the Bio-Rad iCycler IQ System. After 10 min of denaturation at 94°C, the amplification was performed with 30–35 thermal cycles of 94°C for 1 min, 56°C for 2 min, 72°C for 2 min, and a final extension at 72°C for 5 min. For quantification, the nNOS gene was normalized to the expressed housekeeping gene RB L18. The data were analyzed by the 2−ΔΔCt method (Livak and Schmittgen 2001).

Table 1.

Primer sequence

Gene Accession Number Primer Name Primer Sequence (5′–3′) Sequence Start
AF200350 nNOS-forward GAGACTGGAGGAGGTGAATAAGG 244
nNOS-backward GATCCAGTGGTCCAAGCTGC 380
nNOS-internal AGCACCAGCACCTACCAGCTCAAGG 272
AY764298 L18-forward TTCGCCACAACAAGGACAGG 2
L18-backward GTGGTGCTGAAGAGGCTGTT 143
L18-internal CGCAAGGAGCCCAAGAGCCAGGAC 31
Open in a new tab

Immunofluorescence for nNOS,BK-α channel and tyrosine hydroxylase

Isolated CB cells plated onto coverslips were fixed with 50/50 mixture of ethanol and methanol for 20 min at −20°C, washed with PBS–Triton solution (phosphate-buffered saline + 0.1% Triton X-100), and blocked with 10% of normal goat serum for 1 h at room temperature. Primary anti-nNOS (Santa Cruz Biotechnology, Santa Cruz, CA) or anti-BK-α (Alomone Labs, Jerusalem, Israel) and anti-tyrosine hydroxylase (TH) antibodies (a marker for CB glomus cells; Santa Cruz Biotechnology) were incubated with the CB cells overnight at 4°C. Then the CB cells were incubated with appropriate secondary antibodies (Santa Cruz Biotechnology) for 60 min at room temperature. After being washed in PBS, the coverslips were mounted on precleaned microscope slides. The CB cells were observed under a Leica fluorescent microscope with appropriate excitation/emission filters. Pictures were captured by a digital camera system. No staining was seen when the above-described procedure was used, but PBS was used instead of the primary antibody.

Expression of nNOS or BK channels was quantified using Adobe Photoshop CS3 (Photoshop Extended). The image (red color) of nNOS or BK channels in the cells colocalized with TH in each glomus cell cluster was selected using the lasso tool. After a measurement scale was set (1 pixel = 1 pixel), the integrated density (optical density [OD]) of the nNOS or BK channel image was automatically measured by clicking record measurements in the analysis menu. Similarly, the total pixels (area) of all glomus cells (TH-labeled) were measured in the same cell cluster. The quantitative data were calculated by the integrated density of the nNOS or BK channel image/total pixels of all glomus cells and presented as OD/pixel. Five clusters from each animal (n = 4 rabbits for each group) were scored.

Recording of whole cell currents

K+ currents were measured in the perforated whole cell configuration of the patch-clamp technique (Li et al. 2004) using a Warner PC-505B patch-clamp amplifier (Warner Instruments, Hamden, CT). Patch pipettes had resistances of 4–6 MΩ when filled with (in mM) 105 potassium aspartate, 20 KCl, 1 CaCl2, 10 EGTA, 5 Mg-ATP, 10 Hepes, and 25 glucose (pH 7.2). In the perforated whole cell configuration, nystatin was added to the patch-pipette solution at a final concentration of 300 μg ml−1 immediately before recording. The extracellular solution had the following composition (in mM): 140 NaCl, 5.4 KCl, 2.5 CaCl2, 0.5 MgCl2, 5.5 Hepes, 11 glucose, and 10 sucrose (pH 7.4). Na+ channels were blocked by tetrodotoxin (TTX, 0.5 μM). Current–voltage (I–V) relations were elicited by 400 ms test pulses from a holding potential of −80 to +70 mV applied in 10 mV increments (5 s between steps).

Ca2+ currents were recorded in a similar perforated whole cell configuration. The intracellular solution contained (in mM) 115 CsCl, 20 tetraethylammonium-Cl (TEA), 10 phosphocreatine, 5 EGTA, 5 Mg-ATP, 0.2 TrisGTP, and 5 Hepes (pH 7.2). The extracellular solution had the following composition (in mM): 140 NMG-Cl, 5.4 CsCl, 10 BaCl2, 10 Hepes, and 11 glucose (pH 7.4). Na+ channels were blocked by TTX (0.5 μM). The I–V relations were elicited by 25 ms test pulse steps (5 s between steps) from a holding potential of −80 mV to test pulses (−50 to +50 mV,10 mV increments).

Cell membrane capacitance (Cm) was determined by integrating the capacitive current evoked by a 5 mV voltage step and dividing the resulting charge by the voltage step. Mean series resistances, as determined from the decay of the capacitive transient, were 12.8 ± 0.4 MΩ in perforated whole cell mode and were compensated electronically by 80–90%. Current traces were sampled at 10 kHz and filtered at 5 kHz. Peak currents were measured for each test potential and were plotted against the corresponding test potential. pCLAMP 8.1 programs (Axon Instruments, Union City, CA) were used for data acquisition and analysis. All experiments were done at 22°C.

Statistical analysis

All data are expressed as means ± SE. Statistical significance was determined by Student's unpaired t-test for hemodynamics, mRNA, and Ca2+ currents and by a two-way ANOVA, followed by a Bonferroni procedure for post hoc analysis for multiple comparisons in protein and K+ currents. Statistical significance was accepted when P < 0.05. A power analysis was conducted to assess whether the sample size was sufficient to ensure P < 0.05.

RESULTS

Cardiac function in sham and CHF animals

The data for each parameter were collected from all sham and CHF rabbits. Measurements were made with the pacer turned off for ≥30 min. CHF was induced by 4 wk of rapid left ventricular pacing. CHF was characterized by an enlarged left ventricular weight-to-body weight ratio, left ventricular end-diastolic diameter, and left ventricular end-systolic diameter, and reduced shortening and ejection fractions (Table 2).

Table 2.

Body weight, ventricular weight, and echo data in sham and CHF rats

Factor Pretreatment Sham CHF
n 51 24 (4 wk) 27 (4 wk)
BW, kg 2.85 ± 0.12 3.66 ± 0.10 4.08 ± 0.12
LVW/BW, g/kg 1.62 ± 0.06 2.16 ± 0.07*
LVEDD, mm 13.10 ± 0.50 13.90 ± 0.40 16.80 ± 0.40*
LVESD, mm 8.20 ± 0.30 8.40 ± 0.30 12.70 ± 0.30*
FS, % 39.70 ± 1.70 40.40 ± 1.20 21.10 ± 1.60*
EF, % 75.80 ± 1.50 75.20 ± 1.40 48.10 ± 1.90*
Open in a new tab

Values are means ± SE, where n represents number of animals. CHF, chronic heart failure; LVW/BW, ratio of left ventricular weight to body weight; LVEDD, left ventricular end-diastolic diameter; LVESD, left ventricular end-systolic diameter; FS, fractional shortening; EF, ejection fraction.

*

P < 0.05 versus Sham.

nNOS expression in CB glomus cells

Using single-cell real-time RT-PCR, we found that rabbit CB glomus cells express the nNOS gene (Fig. 1). CHF induced a significant decrease in the nNOS mRNA, compared with sham (P < 0.05). Using immunofluorescent staining, we further confirmed that rabbit CB glomus cells express nNOS protein (Fig. 2). In addition, the immunofluorescent detection of nNOS was lower in the CB glomus cells from CHF rabbits than that from sham rabbits (Fig. 2).

Fig. 1.

Fig. 1.

Open in a new tab

Expression of neuronal nitric oxide synthase (nNOS) mRNA in carotid body (CB) glomus cells from sham and chronic heart failure (CHF) rabbits, measured by single cell real-time RT-PCR. Data are mean ± SE, n = 20 primary isolated glomus cells in each group. *P < 0.05 vs. sham.

Fig. 2.

Fig. 2.

Open in a new tab

Representative (A) and quantitative data (B) for expression of nNOS protein in glomus cells, noninfected or infected with Ad.nNOS (1 × 107 pfu/ml), from sham and CHF rabbits. Merged image (yellow) for overlap of tyrosine hydroxylase (TH, a marker for glomus cells) and nNOS. Data are mean ± SE. Image in 5 clusters from each rabbit (n = 4 rabbits for each group) were scored. *P < 0.05 vs. sham; #P < 0.05 vs. CHF.

Three days after incubation of CB glomus cells of sham and CHF rabbits with Ad.nNOS (10 μl, 1 × 107 pfu/ml), the expression of nNOS protein was significantly increased in the CHF CB glomus cells but not sham cells (Fig. 2). The expression of EGFP was used to confirm the efficacy of adenovirus infection. EGFP was visible in nearly all isolated primary glomus cells (n = 3 CHF rabbits) incubated with Ad.EGFP (Fig. 3B). No EGFP was observed in the glomus cells without exposure to Ad.EGFP from these same rabbits (Fig. 3D). Ad.EGFP did not affect the expression of nNOS in the CB glomus cells from sham or CHF rabbits (data not shown).

Fig. 3.

Fig. 3.

Open in a new tab

Adenoviral mediated transfer of enhanced green fluorescent protein (EGFP, 1 × 107 pfu/ml) to isolated glomus cells from a CHF rabbit. A: bright field monochrome image of the primary isolated glomus cells exposed to Ad.EGFP. B: the same field viewed in A as shown for EGFP (green immunofluorescent image). C: bright field monochrome image of the primary isolated glomus cells not exposed to Ad.EGFP. D: the same field viewed in C as shown for EGFP.

Effect of Ad.nNOS on K+ currents in sham and CHF CB glomus cells

Outward K+ currents were recorded in the perforated whole cell patch-clamp mode. K+ currents were significantly blunted in the CB glomus cells from CHF rabbits compared with those from sham rabbits, which is consistent with our previous study (Li et al. 2004). Ad.nNOS infection increased K+ currents in the CHF CB glomus cells, but did not affect K+ currents in the sham CB glomus cells (Fig. 4). Ad.EGFP had no effect on K+ currents in the CB glomus cells from both sham and CHF rabbits (Fig. 4D). In addition, S-methyl-l-thiocitrulline (SMTC, 1 μM, a specific nNOS inhibitor) markedly reduced the K+ currents of glomus cells in sham, sham + Ad.nNOS, and CHF + Ad.nNOS groups but not the CHF group (Fig. 5).

Fig. 4.

Fig. 4.

Open in a new tab

Effect of Ad.nNOS or Ad.EGFP (1 × 107 pfu/ml) on outward K+ currents in the primary isolated glomus cells from sham and CHF rabbits. K+ currents were evoked by 400 ms depolarizing pulses from holding potential −80 mV to test pulses (−80 to +70 mV, 10 mV steps). A and B: original recording of K+ currents in glomus cell with or without treatment of Ad.nNOS transgene from sham and CHF rabbits. C: current–voltage (I–V) curves in 8 cells from 4 rabbits in each group. Data are mean ± SE. *P < 0.05 vs. sham alone; #P < 0.05 vs. CHF alone. D: peak K+ currents of sham and CHF glomus cells with and without treatment of Ad.nNOS transgene or Ad.EGFP. Peak K+ currents in D measured in response to a test pulse from −80 to +70 mV. Data are mean ± SE, n = 8 cells from 5 rabbits in each group. *P < 0.05 vs. sham-control; #P < 0.05 vs. CHF-control.

Fig. 5.

Fig. 5.

Open in a new tab

Effect of S-methyl-l-thiocitrulline (SMTC, 1 μM) on outward K+ currents of glomus cells in sham, sham + Ad.nNOS, CHF, and CHF + Ad.nNOS groups. Peak K+ currents measured in response to a test pulse from −80 to +70 mV. Data are mean ± SE, n = 8 cells from 5 rabbits in each group. *P < 0.05 vs. before treated with SMTC in each group.

Effects of iberiotoxin on K+ currents in sham and CHF CB glomus cells

Large-conductance Ca2+-activated K+ (BK) channel currents are present in rabbit CB glomus cells (Lopez-Lopez et al. 1993) and are regulated by NO (Li et al. 2004). Therefore we investigated whether Ad.nNOS could modulate the activation of BK channels. Iberiotoxin (100 nM, a selective BK channel blocker) decreased the K+ currents of CB glomus cells in sham, sham + Ad.nNOS, and CHF + Ad.nNOS groups but not the CHF group (Fig. 6). There was no significant difference in the expression of BK channel protein among the sham, CHF, and CHF + Ad.nNOS groups (Fig. 7). Because the BK channel is Ca2+ sensitive, we assessed whether Ca2+ currents may be suppressed in CHF CB glomus cells. Quite the opposite, we found voltage-sensitive Ca2+ currents were elevated in CB glomus cells from CHF rabbits as compared with that from the sham group (Fig. 8).

Fig. 6.

Fig. 6.

Open in a new tab

Effect of iberiotoxin (100 nM, Ca2+-dependent K+ channel blocker) on outward K+ currents of glomus cells in sham, sham + Ad.nNOS, CHF, and CHF + Ad.nNOS groups. Peak K+ currents measured in response to a test pulse from −80 to +70 mV. Data are mean ± SE, n = 7 cells from 5 rabbits in each group. *P < 0.05 vs. before treated with SMTC in each group.

Fig. 7.

Fig. 7.

Open in a new tab

Representative (A) and quantitative data (B) for protein expression of Ca2+-dependent K+ channel α-subunit (BK-α) in glomus cells from sham and CHF rabbits. Merged image (yellow) for overlap of TH (a marker for glomus cells) and BK-α. Data are mean ± SE. Image in 5 clusters from each rabbits (n = 4 rabbits for each group) were scored.

Fig. 8.

Fig. 8.

Open in a new tab

Whole cell current recording illustrating enhanced Ca2+ currents in CB glomus cells from CHF rabbits, compared with that in sham rabbits. A: representative recordings of Ca2+ currents in glomus cell from a sham and a CHF rabbit. The current was evoked by 25 ms voltage step from −80 to 0 mV. B: I–V curves of Ca2+ currents in 4 cells from sham or CHF rabbits. *P < 0.05 vs. sham.

DISCUSSION

The findings reported here indicate that: 1) nNOS mRNA and protein are expressed in the rabbit CB glomus cells and CHF markedly decreases nNOS mRNA and protein in these cells; 2) Ad.nNOS transgene expression partially improves the attenuated K+ currents in CHF CB glomus cells; 3) a specific nNOS inhibitor (SMTC) and BK channel blocker (iberiotoxin) suppress K+ currents in the CB glomus cells and fully abolish the effect of Ad.nNOS on the K+ currents in CHF cells; and 4) BK currents in CHF CB glomus cells are attenuated despite enhanced Ca2+ channel activity. These results indicate that endogenous nNOS is involved in the regulation of glomus cell BK channels in rabbit CB glomus cells and, importantly, a reduced nNOS expression mediates the suppression of BK currents in glomus cells from CHF rabbits.

Although many studies have demonstrated that endogenous NO plays an important role in the CB chemoreceptor function as an inhibitory modulator (Chugh et al. 1994; Iturriaga et al. 2000; Li et al. 2004, 2005; Prabhakar et al. 1993; Sun et al. 1999b; Wang et al. 1994), the source(s) of the NO and the localization of NOS in the CB are still unclear. In the cat CB, NOS immunoreactivity and disphorase activities have been found in endothelial cells, carotid sinus nerve but not in glomus cells, type II cells, and vascular smooth muscle cells (Grimes et al. 1995; Wang et al. 1993, 1994). Immunohistochemical evidence has shown that only carotid sinus nerves but not glomus cells are nNOS-immunoreactive in the rats (Dvorakova and Kummer 2005). On the other hand, guinea pig CB glomus cells do exhibit nNOS-immunoreactivity (Dvorakova and Kummer 2005). These results suggest that there are species differences in the nNOS localization in the CB.

In our previous study, the NOS inhibitor (l-NNA) reduced the outward K+ currents in isolated primary CB glomus cells (Li et al. 2004). Based on the above-cited evidence, we proposed two possible explanations for this phenomenon: first, NOS might be present in glomus cells at low levels that are difficult to detect, but sufficient to influence K+ channel activation; and second, even though glomus cells are dispersed in cell culture, other neural and endothelial cells of the CB coexisted with glomus cells might produce sufficient NO to exert a paracrine effect on the neighboring glomus cells (Li et al. 2004). In the present study, we demonstrate, using single-cell real-time RT-PCR and immunofluorescent staining, that nNOS mRNA and protein are expressed in the rabbit CB glomus cells (Figs. 1 and 2). Further, by using gene transfer of nNOS to the glomus cells, we demonstrate that NOS functions within rabbit CB glomus cells to modulate BK channel activation.

Our previous studies have documented the suppression of the outward K+ currents in the CB glomus cells from CHF rabbits (Li et al. 2004). The present study indicates that nNOS mRNA and protein are substantially lower in the CB glomus cells from CHF rabbits compared with that from sham rabbits. Transgene expression of nNOS via Ad.nNOS infection increased the expression of nNOS protein and K+ currents in the CB glomus cells from CHF rabbits. A specific nNOS inhibitor (SMTC) totally abolished the effect of Ad.nNOS on the K+ current in the CB glomus cells from CHF rabbits and also reduced the K+ currents in the CB glomus cells from sham rabbits, regardless of gene transfer of Ad.nNOS. Our previous study has demonstrated that Ad.nNOS gene transfer to the CB reverses the enhanced CB chemoreceptor activity and peripheral chemoreflex sensitivity in CHF rabbits (Li et al. 2005). These data suggest that the nNOS down-regulation in CB glomus cells reduces the outward K+ currents and contributes to the enhanced chemoreceptor activity in CHF rabbits.

K+ channels are functionally classified into voltage-gated K+ (Kv) channels, BK channels, ATP-sensitive K+ channels, inward rectifier K+ channels, and voltage-insensitive background K+ channels (Jan and Jan 1997). Of these K+ channels, Kv channels, BK channels, and HERG-like K+ channels are expressed in the rabbit CB glomus cells (Lopez-Lopez et al. 1993; Overholt et al. 2000). Our previous study has shown that the attenuated K+ currents in these glomus cells are mainly due to the suppressed current density of BK channels and the decreased availability of NO is responsible for the suppression of BK currents in the CB glomus cells from CHF rabbits (Li et al. 2004). In the present study, we confirm that NO modulates the activation of BK channels since the selective BK inhibitor (iberiotoxin) fully abolished the effect of Ad.nNOS on the K+ currents in the CB glomus cells from CHF rabbits (Fig. 6). Furthermore, this suppression of K+ current density in CHF glomus cells and the reversal by Ad.nNOS are not brought about via an influence of NO on the expression of the BK channel α-subunit (Fig. 7). The possibility remains, however, that NO modulates BK channel activity in CB glomus cells via influencing the functionality or expression of BK channel β-subunits. Wu et al. (2002) found that the excitatory effect of NO on the BK channels is likely mediated by the BK channel β-subunit.

In the present study, even though nNOS gene transfer to CHF glomus cells increased nNOS expression to normal levels (Fig. 2), K+ currents were not completely normalized (Fig. 4). These data, although paradoxical, are consistent with our previous study (Jan and Jan 1997) in which CB chemoreceptor activity and chemoreflex function were not completely normalized in CHF rabbits after nNOS gene transfer to the CB. The results would suggest either that NO signaling downstream from nNOS also is altered in these cells in the CHF state and/or that changes occur in the expression of BK β-subunits or functionality of the BK channel. Alternatively, it is possible that other endogenous factors, such as angiotensin II as implicated in our other study (Li and Schultz 2006), also modulate the activation of the BK channels. These issues warrant further study.

It is worthy of consideration whether NO raises cytosolic Ca2+ concentration since the BK channel is Ca2+ sensitive. However, this viewpoint is not supported by many studies. First, NO inhibits L-type Ca2+ channels via a cyclic guanosine 3′,5′-monophosphate (cGMP)–dependent protein kinase in cell-attached patches of bovine chromaffin cells (Carabelli et al. 2002) or cGMP-independent mechanism in whole cell recording of rabbit CB glomus cells (Summers et al. 1999). Second, NO decreases the cytosolic free Ca2+ concentration via increasing Ca2+ stores in sarcoplasmic reticulum and inhibiting store-operated Ca2+ influx in the smooth muscle cells from rabbit aorta (Cohen et al. 1999). Furthermore, NOS inhibition activates L- and T-type Ca2+ channels in renal afferent and efferent arterioles (Feng and Navar 2006). Importantly, our data show that Ca2+ currents are enhanced in the CB glomus cells from CHF rabbits despite impaired NOS expression and K+ channel activity (Fig. 8). Therefore it is not likely that the modulatory effect of NO on BK channel activity by the CB glomus cell is secondary to changes in intracellular Ca2+.

In conclusion, our results indicate that the nNOS expressed in the rabbit CB glomus cells and the reduced endogenous nNOS expression decrease the activation of BK channels, but not involving altered expression of BK-α in the CHF condition.

GRANTS

This study was supported by National Heart, Lung, and Blood Institute Program Project Grant P01-HL-62222.

DISCLOSURES

No conflicts of interest are declared by the authors.

ACKNOWLEDGMENTS

We thank Dr. Keith Channon, University of Oxford, UK, for kindly providing the Ad.nNOS, and K. Talbitzer and Dr. Kurtis Cornish for surgical assistance and supervision of the heart failure animal core at University of Nebraska Medical Center.

REFERENCES

  1. Carabelli V, D'Ascenzo M, Carbone E, Grassi C. Nitric oxide inhibits neuroendocrine Ca(V)1 L-channel gating via cGMP-dependent protein kinase in cell-attached patches of bovine chromaffin cells. J Physiol 541: 351–366, 2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Channon KM, Blazing MA, Shetty GA, Potts KE, George SE. Adenoviral gene transfer of nitric oxide synthase: high level expression in human vascular cells. Cardiovasc Res 32: 962–972, 1996 [PubMed] [Google Scholar]
  3. Channon KM, Qian H, Neplioueva V, Blazing MA, Olmez E, Shetty GA, Youngblood SA, Pawloski J, McMahon T, Stamler JS, George SE. In vivo gene transfer of nitric oxide synthase enhances vasomotor function in carotid arteries from normal and cholesterol-fed rabbits. Circulation 98: 1905–1911, 1998 [DOI] [PubMed] [Google Scholar]
  4. Chugh DK, Katayama M, Mokashi A, Bebout DE, Ray DK, Lahiri S. Nitric oxide-related inhibition of carotid chemosensory nerve activity in the cat. Respir Physiol 97: 147–156, 1994 [DOI] [PubMed] [Google Scholar]
  5. Cohen RA, Weisbrod RM, Gericke M, Yaghoubi M, Bierl C, Bolotina VM. Mechanism of nitric oxide-induced vasodilatation: refilling of intracellular stores by sarcoplasmic reticulum Ca2+ ATPase and inhibition of store-operated Ca2+ influx. Circ Res 84: 210–219, 1999 [DOI] [PubMed] [Google Scholar]
  6. Ding Y, Li YL, Schultz HD. Downregulation of carbon monoxide as well as nitric oxide contributes to peripheral chemoreflex hypersensitivity in heart failure rabbits. J Appl Physiol 105: 14–23, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dvorakova MC, Kummer W. Immunohistochemical evidence for species-specific coexistence of catecholamines, serotonin, acetylcholine and nitric oxide in glomus cells of rat and guinea pig aortic bodies. Ann Anat 187: 323–331, 2005 [DOI] [PubMed] [Google Scholar]
  8. Feng MG, Navar LG. Nitric oxide synthase inhibition activates L- and T-type Ca2+ channels in afferent and efferent arterioles. Am J Physiol Renal Physiol 290: F873–F879, 2006 [DOI] [PubMed] [Google Scholar]
  9. Gonzalez C, Almaraz L, Obeso A, Rigual R. Carotid body chemoreceptors: from natural stimuli to sensory discharges. Physiol Rev 74: 829–898, 1994 [DOI] [PubMed] [Google Scholar]
  10. Grimes PA, Mokashi A, Stone RA, Lahiri S. Nitric oxide synthase in autonomic innervation of the cat carotid body. J Auton Nerv Syst 54: 80–86, 1995 [DOI] [PubMed] [Google Scholar]
  11. Hajjar RJ, Schmidt U, Matsui T, Guerrero JL, Lee KH, Gwathmey JK, Dec GW, Semigran MJ, Rosenzweig A. Modulation of ventricular function through gene transfer in vivo. Proc Natl Acad Sci USA 95: 5251–5256, 1998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Iturriaga R, Mosqueira M, Villanueva S. Effects of nitric oxide gas on cat carotid body chemosensory response to hypoxia. Brain Res 855: 282–286, 2000 [DOI] [PubMed] [Google Scholar]
  13. Jan LY, Jan YN. Cloned potassium channels from eukaryotes and prokaryotes. Annu Rev Neurosci 20: 91–123, 1997 [DOI] [PubMed] [Google Scholar]
  14. Li YL, Li YF, Liu D, Cornish KG, Patel KP, Zucker IH, Channon KM, Schultz HD. Gene transfer of neuronal nitric oxide synthase to carotid body reverses enhanced chemoreceptor function in heart failure rabbits. Circ Res 97: 260–267, 2005 [DOI] [PubMed] [Google Scholar]
  15. Li YL, Schultz HD. Enhanced sensitivity of Kv channels to hypoxia in the rabbit carotid body in heart failure: role of angiotensin II. J Physiol 575: 215–227, 2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Li YL, Sun SY, Overholt JL, Prabhakar NR, Rozanski GJ, Zucker IH, Schultz HD. Attenuated outward potassium currents in carotid body glomus cells of heart failure rabbit: involvement of nitric oxide. J Physiol 555: 219–229, 2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25: 402–408, 2001 [DOI] [PubMed] [Google Scholar]
  18. Lopez-Lopez JR, De Luis DA, Gonzalez C. Properties of a transient K+ current in chemoreceptor cells of rabbit carotid body. J Physiol 460: 15–32, 1993 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Overholt JL, Ficker E, Yang T, Shams H, Bright GR, Prabhakar NR. HERG-like potassium current regulates the resting membrane potential in glomus cells of the rabbit carotid body. J Neurophysiol 83: 1150–1157, 2000 [DOI] [PubMed] [Google Scholar]
  20. Overholt JL, Prabhakar NR. Ca2+ current in rabbit carotid body glomus cells is conducted by multiple types of high-voltage-activated Ca2+ channels. J Neurophysiol 78: 2467–2474, 1997 [DOI] [PubMed] [Google Scholar]
  21. Prabhakar NR. Neurotransmitters in the carotid body. Adv Exp Med Biol 360: 57–69, 1994 [DOI] [PubMed] [Google Scholar]
  22. Prabhakar NR, Kumar GK, Chang CH, Agani FH, Haxhiu MA. Nitric oxide in the sensory function of the carotid body. Brain Res 625: 16–22, 1993 [DOI] [PubMed] [Google Scholar]
  23. Snyder SH. Nitric oxide: first in a new class of neurotransmitters. Science 257: 494–496, 1992 [DOI] [PubMed] [Google Scholar]
  24. Summers BA, Overholt JL, Prabhakar NR. Nitric oxide inhibits L-type Ca2+ current in glomus cells of the rabbit carotid body via a cGMP-independent mechanism. J Neurophysiol 81: 1449–1457, 1999 [DOI] [PubMed] [Google Scholar]
  25. Sun SY, Wang W, Zucker IH, Schultz HD. Enhanced peripheral chemoreflex function in conscious rabbits with pacing-induced heart failure. J Appl Physiol 86: 1264–1272, 1999a [DOI] [PubMed] [Google Scholar]
  26. Sun SY, Wang W, Zucker IH, Schultz HD. Enhanced activity of carotid body chemoreceptors in rabbits with heart failure: role of nitric oxide. J Appl Physiol 86: 1273–1282, 1999b [DOI] [PubMed] [Google Scholar]
  27. Wang ZZ, Bredt DS, Fidone SJ, Stensaas LJ. Neurons synthesizing nitric oxide innervate the mammalian carotid body. J Comp Neurol 336: 419–432, 1993 [DOI] [PubMed] [Google Scholar]
  28. Wang ZZ, Stensaas LJ, Bredt DS, Dinger B, Fidone SJ. Localization and actions of nitric oxide in the cat carotid body. Neuroscience 60: 275–286, 1994 [DOI] [PubMed] [Google Scholar]
  29. Wu L, Cao K, Lu Y, Wang R. Different mechanisms underlying the stimulation of K(Ca) channels by nitric oxide and carbon monoxide. J Clin Invest 110: 691–700, 2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Xia H, Qi H, Li Y, Pei J, Barton J, Blackstad M, Xu T, Tao W. LATS1 tumor suppressor regulates G2/M transition and apoptosis. Oncogene 21: 1233–1241, 2002 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Neurophysiology are provided here courtesy of American Physiological Society

RESOURCES