Proteomic analysis of V-ATPase-rich cells harvested from the kidney and epididymis by fluorescence-activated cell sorting

Abstract

Proton-transporting cells are located in several tissues where they acidify the extracellular environment. These cells express the vacuolar H⁺-ATPase (V-ATPase) B1 subunit (ATP6V1B1) in their plasma membrane. We provide here a comprehensive catalog of the proteins that are expressed in these cells, after their isolation by enzymatic digestion and fluorescence-activated cell sorting (FACS) from transgenic B1-enhanced green fluorescent protein (EGFP) mice. In these mice, type A and B intercalated cells and connecting segment cells of the kidney, and narrow and clear cells of the epididymis, which all express ATP6V1B1, also express EGFP, while all other cell types are negative. The proteome of renal and epididymal EGFP-positive (EGFP⁺) cells was identified by liquid chromatography-tandem mass spectrometry (LC-MS/MS) and compared with their respective EGFP-negative (EGFP⁻) cell populations. A total of 2,297 and 1,564 proteins were detected in EGFP⁺ cells from the kidney and epididymis, respectively. Out of these proteins, 202 and 178 were enriched by a factor greater than 1.5 in EGFP⁺ cells compared with EGFP⁻ cells, in the kidney and epididymis respectively, and included subunits of the V-ATPase (B1, a4, and A). In addition, several proteins involved in intracellular trafficking, signaling, and cytoskeletal dynamics were identified. A novel common protein that was enriched in renal and epididymal EGFP⁺ cells is the progesterone receptor, which might be a potential candidate for the regulation of V-ATPase-dependent proton transport. These proteomic databases provide a framework for comprehensive future analysis of the common and distinct functions of V-ATPase-B1-expressing cells in the kidney and epididymis.

specialized proton-secreting cells are located in several tissues that are involved in acid/base regulation. These cells belong to the mitochondria-rich cell family, indicating that they have a high energy requirement to achieve their characteristic functions (8). Among these cells are intercalated cells (IC) of the kidney (59) and narrow and clear cells of the epididymis (6, 9). The epididymis is a long, convoluted tubule located downstream of the testis and is the site where sperm mature and are stored (32, 43, 52). Renal intercalated cells regulate systemic acid/base balance, while narrow and clear cells establish an acidic environment in the lumen of the epididymis, a process that is essential to maintain spermatozoa quiescent before ejaculation (11, 17, 46, 55, 59). Therefore, both the epididymis and the kidney have similar luminal acidifying functions. This and many other similarities in transport properties that occur in both renal and epididymal tubules have been pointed out previously (33). Accordingly, kidney intercalated cells and epididymal narrow/clear cells have in common a high expression of the vacuolar proton pumping ATPase (V-ATPase) in their plasma membrane as well as in intracellular recycling vesicles. The V-ATPase has two main functions (11, 59). It is expressed in all cell types, where it is located in intracellular organelles (e.g., endosomes, lysosomes, Golgi) and acidifies their lumen. In intercalated cells, narrow and clear cells, as well as in osteoclasts and interdental cells of the inner ear, the V-ATPase is also located in the plasma membrane, where it is involved in proton extrusion from the cell cytoplasm (2, 6, 9, 25, 49, 50, 56, 58, 59). In these specialized cells, regulation of proton secretion is achieved at least in part by recycling mechanisms. The V-ATPase also plays a major role in proton secretion and in energizing other ion transport processes in lower vertebrates and invertebrates, and it is frequently concentrated in specialized “mitochondria-rich” cells in these nonmammalian organisms (8, 61).

The V-ATPase is composed of several subunits and is divided into two distinct domains, the V₀ domain that contains integral membrane proteins, labeled a, d, e, c, c′, and c″, and the V₁ domain that contains cytosolic subunits, labeled A through H (reviewed in Refs. 2, 25, 59, and 61). In mammals, the a subunit is encoded by four genes (ATP6V0A1–A4) leading to the production of four isoforms (a1–a4). Similarly subunits B, H, and d have two isoforms, and subunits C and G have three isoforms. In addition, one E isoform, originally designated as ATP6E1 and later renamed ATP6V1E2, is expressed in testis and spermatozoa while its homolog, originally designated as ATP6E2 and now labeled ATP6V1E1, is expressed ubiquitously (34, 57). Kidney IC and epididymal clear cells both have an identical combination of V-ATPase subunit isoforms that are inserted into their plasma membrane. In particular, subunits B1 and a4 are enriched in these cells and can preferentially accumulate in the plasma membrane compared with the B2 and a1, a2, and a3 isoforms, which are mainly located in intracellular structures (16, 47, 48, 50). While the V-ATPase is located in the apical membrane of type A IC and epididymal narrow and clear cells, type B IC have a more complex phenotype and can have basolateral, bipolar, and even apical V-ATPase. In addition, ICs and narrow and clear cells express distinct transporters involved in their acid/base regulating function. A-ICs express the chloride/bicarbonate exchanger, AE1, in their basolateral membrane, while B-ICs express a distinct chloride/bicarbonate exchanger, pendrin, in their apical membrane (reviewed in Refs. 11 and 59). Narrow/clear cells express the ubiquitous anion exchanger AE2, and the sodium-bicarbonate cotransporter NBCe1 in their basolateral membrane (46). All these cell types also express high levels of the cytosolic carbonic anhydrase, CAII. Therefore, while these cells share identical transporters for their common proton extrusion functions, they have also established different expression patterns for partner proteins involved in this process.

To characterize the function of V-ATPase-expressing epithelial cells, we have generated a transgenic mouse model, in which the promoter of the V-ATPase B1 subunit drives expression of enhanced green fluorescent protein (EGFP) (39). In these mice, EGFP fluorescence is detectable only in cells that strongly express the B1 subunit. These include kidney A-IC and B-IC, epididymal narrow and clear cells, and nonciliated cells of the lung. Intermediate EGFP fluorescence was also detected in nonintercalated cells of the renal connecting segments that also express B1, but no green fluorescence was detected in other cell types, including renal proximal tubule cells, thick ascending limb cells, thin limbs of Henle, and collecting duct principal cells. Similarly, no other cell types in the epididymis were found to express EGFP. Thus, these mice are extremely valuable to characterize the phenotypes of positively identified B1-expressing V-ATPase-rich cells. In this study, we characterized the proteomic signature of B1-expressing renal and epididymal cells isolated by fluorescence-activated cell sorting (FACS).

MATERIALS AND METHODS

Animals.

Generation and breeding of V-ATPase B1-EGFP (B1-EGFP) mice have been described previously (39). Adult B1-EGFP mice were housed under standard conditions and maintained on a standard rodent diet. All animal studies were approved by the Massachusetts General Hospital (MGH) Subcommittee on Research Animal Care, in accordance with National Institutes of Health, Department of Agriculture, and Accreditation of Laboratory Animal Care requirements.

Isolation of B1-expressing cells from the epididymis and kidney.

Mice were anesthetized using pentobarbital sodium (50 mg/kg body wt ip). Epididymides and kidneys were dissected and minced immediately with scissors in prewarmed RPMI 1640 medium (Gibco Invitrogen, Carlsbad, CA) containing 1.0 mg/ml collagenase type I (Gibco Invitrogen) and 1.0 mg/ml collagenase type II (Sigma Aldrich, St. Louis, MO). Tissue dissociation was performed for 45 min in a shaking (100 rpm) 37°C water bath. Cell preparations were then passed through a cell strainer with 40-μm nylon mesh to remove undigested material, and cells were washed once with RPMI 1640 medium and once with calcium-free phosphate-buffered saline (PBS). Populations of EGFP-positive (EGFP⁺) cells from epididymis and kidney preparations were isolated immediately by FACS based on their green fluorescence intensity. Sorting was performed at the MGH flow cytometry core facility using a modified FACSVantage cell sorter (BD Biosciences, San Jose, CA). EGFP⁺ and EGFP-negative (EGFP⁻) cell samples were collected in PBS and used without delay for protein isolation, RNA isolation, or imaging. Cells with intermediate to low fluorescence intensity were discarded to avoid potential contamination of cells that were negative for EGFP, but had a high autofluorescence, in the EGFP⁺ cell preparation. A fraction of each cell sample was reanalyzed by flow cytometry to estimate the purity (>95%). For liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis, EGFP⁺ and EGFP⁻ cells collected in PBS were centrifuged briefly, resuspended in Laemmli sample buffer (10 mM Tris·HCl, 6% glycerol, 1.5% SDS, 60 mg/ml dithiothreitol), heated for 5 min at 99°C, and stored at −20°C. For RNA isolation, cell pellets were resuspended in RNA extraction buffer (PicoPure RNA isolation, Molecular Devices, Sunnyvale, CA) and stored at −80°C. For preparation of Cytospin smears, cells were fixed for 2 h with PBS containing 2% paraformaldehyde and stored at 4°C.

Preparation of proteins for LC-MS/MS identification.

Proteins were separated by one-dimensional SDS-PAGE using a 4–15% gradient polyacrylamide gel (Bio-Rad, Hercules, CA) to reduce sample complexity. Gels were stained with Coomassie R-250 (Pierce Imperial Protein Stain, Thermo Fisher Scientific, Rockford, IL) for 5 min, then washed in deionized water for 1 h, and scanned. Each sample lane was sliced into 19 blocks, from the top of the gel to the dye front. Each block was further minced into small pieces (up to 2 mm³). Proteins were reduced, alkylated, and trypsin-digested in gel as we have previously described (51, 54). After trypsin digestion, the peptides were extracted with 50% acetonitrile-0.1% formic acid (FA), dried in a Speed Vac concentrator, and desalted using ZipTip C18 pipette tips (Millipore, Billerica, MA). Desalted peptides were dried and reconstituted with 0.1% FA for LC-MS/MS analysis.

LC-MS/MS protein identification.

Tryptic peptides were stratified over time by reverse-phase LC (PicoFrit, BioBasic C18 column, New Objective, Woburn, MA) before delivery to an LTQ tandem mass spectrometer (MS/MS, Thermo Fisher Scientific) equipped with a nanoelectrospray ion source. The mass-to-charge (m/z) ratios of peptides and their fragmented ions were recorded as spectra by the mass spectrometer. The spectra with a total ion current >10,000 were used to search for matches to peptides in a concatenated RefSeq database, composed of forward and reverse protein sequences derived from the National Center for Biotechnology Information on April 1, 2008. The search was performed using BioWorks software (version 3.3, Thermo Fisher Scientific) based on the SEQUEST algorithm, and InsPecT (University of California San Diego, La Jolla, CA). The search parameters included 1) precursor ion mass tolerance <2 atomic mass units (amu), 2) fragment ion mass tolerance <1 amu, 3) up to three missed tryptic cleavages allowed, and 4) amino acid modifications: cysteine carboxyamidomethylation (plus 57.02 amu) and methionine oxidation (plus 15.99 amu). A target-decoy analysis was performed to set false discovery rates below 2%. To assess relative protein abundance, we applied spectral counting normalized by molecular weight to correct for the higher probability of peptide identification in larger proteins. SEQUEST search and InsPecT search results were combined in a Microsoft Excel spreadsheet. A χ²-analysis was performed to determine the proteins that were significantly enriched in the EGFP⁺ populations compared with EGFP⁻ cells. Significance was set at P < 0.05.

Immunofluorescence.

Cell suspensions were fixed in paraformaldehyde before and after FACS and were collected onto microscope slides by cytocentrifugation (Cytospin Shando, Thermo Scientific, Waltham, MA) at 500 rpm for 10 min. Microscope slides were then either mounted in Vectashield medium containing DAPI (Vector Labs, Burlingame, CA), and visualized directly for their GFP fluorescence, or immunolabeled. For immunolabeling, Cytospin smears were rehydrated in PBS and pretreated with 1% (wt/vol) SDS in PBS to retrieve antigen (10). After preincubation in 1% (wt/vol) bovine serum albumin in PBS to prevent nonspecific labeling, slides were incubated for 90 min at room temperature with an affinity-purified anti-V-ATPase B1 primary antibody (7) diluted in antibody diluent (Dako, Carpinteria, CA). Slides were washed twice in high salt (2.7% NaCl) PBS and once in PBS. They were then incubated for 1 h at room temperature with a donkey anti-rabbit Cy3-conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA) and washed again. After mounting in Vectashield containing DAPI, slides were examined under a Nikon epifluorescence microscope and images were captured using a Hamamatsu Orca digital camera and IPLab software (BD Biosciences, Rockville, MD).

Electron microscopy.

Isolated cells were fixed in 2% glutaraldehyde (in 0.1 M sodium cacodylate buffer) overnight and were rinsed in sodium cacodylate buffer. They were then stained with 2% aqueous uranyl acetate, dehydrated with graded ethanol up to 100%, rinsed with propylene oxide, and embedded in 100% Epon. Ultrathin (70 to 80 nm) sections were mounted on formvar-coated nickel grids, stained with uranyl acetate and lead citrate, and inspected and photographed with a JEOL 1011 electron microscope. Images were acquired using an AMT digital imaging system.

RT-PCR.

RNA isolation was performed using the PicoPure kit following the manufacturer's instructions. The quantity and quality of RNA samples were assessed using a 2100 BioAnalyzer (Agilent Technologies, Santa Clara, CA). RNA samples were reverse-transcribed for 1 h at 42°C in a final volume of 50 μl with 1× buffer II, 5 mM MgCl₂, 1.0 mM each dNTP, 1 U/μl RNase inhibitor, 2.5 μM random hexamers, and 2.5 U/μl Moloney murine leukemia virus reverse transcriptase. Reverse transcription products were used as templates for PCR. The sequences of the PCR primer sets, synthesized by Invitrogen, are listed in Table 1. Reaction mixtures consisted of a 20 μl final volume containing 2 μl template, 1.25 units AmpliTaq Gold DNA polymerase, 1× buffer II, 1.5 mM MgCl₂, 1.0 mM each dNTP, and 0.5 μM forward and reverse oligonucleotide primers. All RT and PCR reagents were from Applied Biosystems (Foster City, CA). PCR was performed in a Flexigene thermal cycler (Techne, Princeton, NJ) with the following parameters: 8 min at 95°C to activate the polymerase, followed by 35 cycles of melting for 30 s at 95°C, annealing for 30 s at 60°C, extension for 30 s at 72°C, and a final extension for 10 min at 72°C. The PCR products were analyzed by electrophoresis on a 2.5% agarose gel containing GelStar stain (Lonza, Rockland, ME).

Table 1.

Sequence of the primers used for PCR

Gene	Forward Primer (5′–3′)	Reverse Primer (5′–3′)	Product Size, bp
mAnxa6	AGGCGGTCCCTTCTGTTATC	AGTCAGGCAGGGTTATGTGG	142
mAtp6v0a4	TGACCACCATCTTCCTGTGA	TAGAGGCAGGAGGAACCTGA	143
mAtp6v1b1	CCCTACGATTGAGCGGATCAT	TATATCCAGGAAAGCCACGGC	182
mAqp9	AGACGGTGTGGGCTTTGTAG	GACGGAGACAGAGAGCCACT	177
mDbnl	ACCTGAATGGGGGAGAAATC	GCACCATCATGTCTGCTCAC	139
mGapdh	TGAGCAAGAGAGGCCCTATCC	CCCTAGGCCCCTCCTGTTAT	98
mHsd17b12	TGGGCCAAAGTGTACATCAA	GCAGTGCAGACACAACGAAT	100
mIqgap1	GCTGCTGAATAACCCTGCTT	TCCAAAGACAAAGGATTCCAA	142
mKrt18	AAGGTGAAGCTTGAGGCAGA	CTGCACAGTTTGCATGGAGT	111
mLrba	GCTAAGCCAGAGCCAGGTG	AAGGTGGGTGCTGCTTACAC	100
mMyo6	CCCAGCACTAACCTGCGTAT	TGCCTGTTTGTAGTTTGACTTTG	149
mPgrmc1	GCTGGGTGAGTTTGAAAGGA	CCAAGACCTAGACACCTGACG	113
mProm1	GCTCGTTTTGGAGCTACCTG	GCTGAGCGACAGTTCCTTCT	121
mProm2	CAAAGACTCCAGCAAGCACA	CCTCACCCCCAAGTTAACAA	130
mSlco4a1	TTACTGCCTGTCCTGGAAGC	TCAGTGCAGTTTGCTTGGAC	150

RESULTS

Isolation of EGFP⁺ cells from kidney and epididymis.

Significant numbers of EGFP⁺ cells were isolated after FACS sorting from kidney and epididymis cell suspensions (Fig. 1). Three different batches of EGFP⁺ and EGFP⁻ cells were isolated from four B1-EGFP mice each time. On average, 330,000 and 120,000 EGFP⁺ cells were isolated from the kidneys and epididymides of these mice, respectively. These samples were pooled to perform proteomics analysis. Thus, a total of 1,100,000 renal EGFP⁺ cells and 360,000 epididymal EGFP⁺ cells, originating from a total of 12 mice, were analyzed. Immunofluorescence labeling of EGFP⁺ cells for the B1 subunit of the V-ATPase showed that they retain their polarized V-ATPase expression phenotype during the isolation procedure (Fig. 2). In addition, electron microscopy showed that EGFP⁺ cells retain morphological features characteristic of “mitochondria-rich” cells after FACS sorting (Fig. 3). These results confirmed that the cells isolated by FACS are indeed V-ATPase enriched and that their integrity was preserved during the isolation procedure.

Fig. 1.

Flow cytometry sorting of B1-enhanced green fluorescent protein (EGFP) cells. Left: dot plot of a representative epididymal cell sorting sample [EGFP vs. phycoerythrin channel autofluorescence (PE-A)]. Events in the top left quadrant are EGFP-positive (EGFP⁺) cells, representing ∼6% of the live cell population. Right: fluorescence microscopy of Cytospin smears of cells isolated from B1-EGFP mouse kidney (A and B) and epididymis (C and D) before (A and C) and after (B and D) sorting. A few vacuolar H⁺-ATPase (V-ATPase)-B1-expressing cells (green) are seen in the cell suspension before fluorescence-activated cell sorting (FACS). After FACS, all cells show positive EGFP fluorescence. Nuclei are visualized with DAPI (blue). Bars = 20 μm (A and C), 30 μm (B), and 15 μm (D).

Fig. 2.

Three examples of epididymal EGFP⁺ cells (green) labeled for the V-ATPase B1 subunit (red) visualized after FACS. Cells retained their polarized expression of the V-ATPase. Nuclei are labeled with DAPI (blue). Bars = 5 μm.

Fig. 3.

Electron microcopy showing several renal EGFP⁺ cells isolated by FACS. All cells retained their characteristic morphology with visible microvilli (arrows) and numerous vesicles. Bar = 3 μm.

RT-PCR analysis showed a high enrichment of the V-ATPase B1 subunit as well as depletion of aquaporin 9 (a marker of epididymal principal cells) in EGFP⁺ cells isolated from the epididymis compared with the EGFP⁻ population (Fig. 4), further confirming that clear cells had been positively selected by FACS. Enrichment of the V-ATPase B1 subunit was also observed in EGFP⁺ cells isolated from the kidney (see Fig. 6, top: Atp6v1b1).

Fig. 4.

RT-PCR analysis showing depletion of aquaporin 9 (AQP9) mRNA (top; Aqp9) and high enrichment of the V-ATPase B1 subunit (middle; Atp6v1b1) in epididymal EGFP⁺ cells compared with EGFP-negative (EGFP⁻) cells. Controls using GAPDH-specific primers (Gapdh) are shown (bottom).

Fig. 6.

RT-PCR analysis of selected genes that were shown to be enriched in EGFP⁺ cells from the kidney (top; GFP⁺) and epididymis (bottom; GFP⁺) compared with their respective EGFP⁻ samples (GFP⁻). Of note, the B1 subunit of the V-ATPase (Atp6v1b1) was significantly enriched in both kidney and epididymis EGFP⁺ cells compared with EGFP⁻ cells. Atp6v0a4, V-ATPase a4 subunit; Prom1 and 2, Prominin 1 and 2, respectively; Lrba, LPS-responsive beige-like anchor; Pgrmc1, progesterone receptor; Anxa6, annexin A6; Dbnl, drebrin-like; Krt18, keratin 18; Myo6, myosin 6; Slco4a1, solute carrier organic anion transporter member 4a1; Hsd17b12, hydroxysteroid (17-β) dehydrogenase 12; Gapdh, GAPDH.

Mass spectrometry analysis of proteins enriched in the EGFP⁺ cell population compared with EGFP⁻ cells.

To determine the proteomic profile of B1-V-ATPase-expressing cells in the kidney and epididymis, we carried out a comparative proteomic analysis using LC-MS/MS in EGFP⁺ cell samples. Data were compared with proteins that were detected in the EGFP⁻ cell samples. A total of 2,297 and 1,564 proteins were detected in EGFP⁺ cells from the kidney and epididymis, respectively. These proteins are listed in supplemental Tables S1 and S2 (supplemental data for this article can be found online at the American Journal of Physiology-Cell Physiology website) and are also available at the National Heart, Lung, and Blood Institute Laboratory of Kidney and Electrolyte Metabolism (NHLBI-LKEM) website (http://dir.nhlbi.nih.gov/papers/lkem/kevcpd/). We then determined the proteins that were significantly enriched in the EGFP⁺ populations compared with the EGFP⁻ populations in both kidney and epididymis by performing a χ²-analysis of the spectral counts for all proteins detected. Figure 5 summarizes the gene ontology terms for these proteins, listing the 15 most frequent terms in each EGFP⁺ sample, grouped according to their location (cell components), their function, or their role in cellular processes. In both renal and epididymal EGFP⁺ cells, the most abundant group of proteins was located in mitochondria, in agreement with the fact that intercalated cells and clear cells are part of the mitochondria-rich cell family. Interestingly, in both samples the “proton-transporting two-sector ATPase complex,” the “hydrogen ion transmembrane transporter activity,” and the “proton transport” groups were listed in the top 15 cell components, functions, and processes, respectively. In addition, the “H⁺ transporting ATPase activity, rotational mechanism” group was identified in the top 15 functions group of kidney EGFP⁺ cells. These results are in agreement with the proton secretory function of renal intercalated cells and epididymal narrow and clear cells. We also grouped the proteins enriched in each EGFP⁺ cell population according to their established role in more specific cellular functions (Tables 2 and 3). Proteins belonging to the acid/base transport group were identified, including several V-ATPase subunits. In fact, among the proteins that were at the top of the list was the V-ATPase B1 subunit in both the kidney and epididymis EGFP⁺ samples, further confirming the enrichment of B1-expressing cells after FACS sorting. Pendrin, which is expressed in B-IC exclusively, and Rhbg (expressed in A-IC) were detected in renal EGFP⁺ cells but not in epididymal EGFP⁺ cells. Similarly, proteins specific for the male urogenital tract, including Crisp 1, Adam 7, and Pebp1 (14, 15, 21, 42), were identified in epididymal EGFP⁺ cells but not in renal EGFP⁺ cells. In addition, proteins known to be expressed in nonintercalated cells of the connecting segment were detected in the renal EGFP⁺ sample, confirming that these EGFP-expressing cells were also selected during the isolation procedure. These include calbindin-D28K (5) and aquaporin 3 (12).

Fig. 5.

Pie charts of the top 15 gene ontology terms for the proteins that were significantly enriched in the renal (top) and epididymal (bottom) EGFP⁺ cell populations compared with their respective EGFP⁻ cell samples.

Table 2.

List of proteins that were identified as being significantly enriched in renal EGFP⁺ cells compared with renal EGFP⁻ cells

Protein Name	Gene Symbol	Accession No.	EGFP+	EGFP−	Ratio
V-ATPase - acid/base
V-ATPase subunit B1	Atp6v1b1	NP_598918.1	2007.375	0.00	Unique
Rhesus blood group-associated B glycoprotein	Rhbg	NP_067350.2	645.90	0.00	Unique
V-ATPase subunit G3	Atp6v1 g3	NP_796371.1	363.67	0.00	Unique
V-ATPase subunit C2	Atp6v1c2	NP_598460.1	248.19	0.00	Unique
Pendrin	Slc26a4	NP_035997.1	198.40	0.00	Unique
Carbonic anhydrase 15	Car15	NP_085035.1	140.91	0.00	Unique
V-ATPase subunit D	Atp6v1d	NP_076210.1	810.74	70.50	11.50
V-ATPase subunit H	Atp6v1 h	NP_598587.2	1,217.44	125.32	9.71
V-ATPase subunit A	Atp6v1a	NP_031534.2	4,932.23	629.34	7.84
V-ATPase subunit a4	Atp6v0a4	NP_536715.2	606.85	94.17	6.44
V-ATPase subunit E1	Atp6v1e1	NP_031536.2	1,261.59	229.38	5.50
Carbonic anhydrase 2	Car2	NP_033931.4	2,617.75	792.21	3.30
Intracellular trafficking
chaperonin subunit 6a (zeta)	Cct6a	NP_033968.1	137.92	17.24	8.00
SAR1a gene homolog	Sar1a	NP_033146.1	535.74	89.29	6.00
RAB10, member RAS oncogene family	Rab10	NP_057885.1	709.82	177.45	4.00
RAB1, member RAS oncogene family	Rab1	NP_033022.1	1,411.07	529.15	2.67
Ubiquitin B	Ubb	NP_035794.1	2,473.19	1,076.57	2.30
Cytoskeleton
Keratin 7	Krt7	NP_149064.1	1,222.67	0.00	Unique
Keratin 86	Krt86	NP_034797.1	582.15	0.00	Unique
Tubulin, β	Tubb2b	NP_076205.1	380.36	0.00	Unique
WD repeat domain 1	Wdr1	NP_035845.1	346.35	0.00	Unique
Wiskott-Aldrich syndrome homolog	Was	NP_033541.1	313.70	0.00	Unique
Protein kinase C and casein kinase substrate in neurons 2	Pacsin2	NP_035992.1	250.75	0.00	Unique
Keratin 33A	Krt33a	NP_082259.2	151.72	0.00	Unique
Keratin complex 2, basic gene 18	Krt85	NP_058575.2	143.47	0.00	Unique
Keratin 82	Krt82	NP_444479.1	122.56	0.00	Unique
Drebrin-like	Dbnl	NP_038838.1	103.25	0.00	Unique
Plastin 3 precursor	Pls3	NP_663604.1	98.95	0.00	Unique
Spectrin-β3	Spnb3	NP_067262.1	195.63	3.69	53.00
CAP, adenylate cyclase-associated protein 1	Cap1	NP_031624.2	193.93	19.39	10.00
Myosin, heavy polypeptide 14	Myh14	NP_082297.1	65.86	8.78	7.50
Keratin 18	Krt18	NP_034794.1	863.08	168.41	5.13
IQ motif containing GTPase activating protein 1	Iqgap1	NP_057930.1	651.63	148.34	4.39
Gelsolin	Gsn	NP_666232.2	477.07	116.36	4.10
Serum deprivation response	Sdpr	NP_620080.1	769.83	192.46	4.00
Cell division cycle 42	Cdc42	NP_033991.1	940.80	235.20	4.00
Spectrin-α2	Spna2	NP_001070022.1	2,358.55	848.10	2.78
Myosin ID	Myo1d	NP_796364.2	215.37	77.53	2.78
Destrin	Dstn	NP_062745.1	1,835.69	755.87	2.43
Plectin 1 isoform 2	Plec1	NP_958787.1	121.98	52.28	2.33
Myosin, heavy polypeptide 9, nonmuscle isoform 1	Myh9	NP_071855.2	1740.50	870.25	2.00
Actin, α2, smooth muscle, aorta	Acta2	NP_031418.1	16,448.88	9,140.91	1.80
Membrane dynamics
Myoferlin	Fer1l3	NP_001093104.1	64.29	4.29	15.00
Annexin A6 isoform b	Anxa6	NP_001103681.1	318.77	26.56	12.00
Annexin A11	Anxa11	NP_038497.2	203.40	18.49	11.00
Annexin A4	Anxa4	NP_038499.2	696.07	83.53	8.33
Filamin B, β	Flnb	NP_598841.1	867.68	198.84	4.36
Ankyrin 3, epithelial isoform h	Ank3	NP_733925.2	219.39	66.77	3.29
Cadherin 16	Cdh16	NP_031689.1	389.49	166.93	2.33
Transporters, channels
Solute carrier family 8 (sodium/calcium exchanger)	Slc8a1	NP_001106269.1	459.39	0.00	Unique
Aquaporin 3	Aqp3	NP_057898.2	380.13	0.00	Unique
Potassium inwardly rectifying channel J10	Kcnj10	NP_001034573.1	117.84	0.00	Unique
Chloride channel Kb	Clcnkb	NP_062675.1	106.58	0.00	Unique
Plasma membrane calcium ATPase 4	Atp2b4	NP_998781.1	120.24	7.51	16.00
Chloride channel Ka	Clcnka	NP_077723.2	105.68	13.21	8.00
Solute carrier family 12, member 3	Slc12a3	NP_062288.1	605.97	90.44	6.70
Na+/K+-ATPase α1-subunit	Atp1a1	NP_659149.1	10,373.32	4,929.98	2.10
ATPase, Na+/K+ transporting, α2-polypeptide	Atp1a2	NP_848492.1	6,371.57	3,092.21	2.06
Intracellular signaling, receptors, hormones
S100 calcium binding protein G	S100 g	NP_033919.1	2,564.06	0.00	Unique
Adenylate kinase 1	Ak1	NP_067490.1	216.30	0.00	Unique
Kallikrein 1	Klk1	NP_034769.4	556.04	0.00	Unique
chaperonin subunit 3 (γ)	Cct3	NP_033966.1	197.92	0.00	Unique
Ataxin 2	Atxn2	NP_033151.2	73.28	0.00	Unique
Archain 1	Arcn1	NP_666097.3	139.79	0.00	Unique
Chapsyn-110	Dlg2	NP_035937.2	94.86	0.00	Unique
Chaperonin subunit 8 (θ)	Cct8	NP_033970.3	100.75	0.00	Unique
Pre-B-cell colony-enhancing factor 1	Nampt	NP_067499.1	126.40	0.00	Unique
Calbindin 2	Calb2	NP_031612.1	1,625.62	63.75	25.50
Calbindin-D28K	Calb1	NP_033918.1	2,333.79	100.02	23.33
Hydroxysteroid 11-β dehydrogenase 2	Hsd11b2	NP_032315.2	1,066.68	47.41	22.50
Progesterone receptor membrane component	Pgrmc1	NP_058063.2	737.52	92.19	8.00
LPS-responsive beige-like anchor isoform α	Lrba	NP_109620.2	101.01	41.03	2.46
Stress response/antioxidant
Glutamate-cysteine ligase, catalytic subunit	Gclc	NP_034425.1	137.80	13.78	10.00
Stress-induced phosphoprotein 1	Stip1	NP_058017.1	143.81	15.98	9.00
Glutathione S-transferase, &thetas; 3	Gstt3	NP_598755.1	328.43	36.49	9.00
Heat shock 70-kDa protein 1B	Hspa1b	NP_034608.2	384.75	57.00	6.75
Peroxiredoxin 2	Prdx2	NP_035693.3	2,525.41	826.50	3.06
Peroxiredoxin 3	Prdx3	NP_031478.1	1,564.33	568.85	2.75
Heat shock protein 9	Hspa9	NP_034611.2	4,002.11	1,483.78	2.70
Heat shock protein 2	Hspa2	NP_001002012.1	1,694.39	689.24	2.46
Heat shock protein 8	Hspa8	NP_112442.2	2,370.50	1,100.59	2.15
Peroxiredoxin 1	Prdx1	NP_035164.1	5,862.06	3,291.77	1.78
Nuclear proteins
Acidic (leucine-rich) nuclear phosphoprotein 32 f	Anp32a	NP_033802.2	175.21	0.00	Unique
Mitochondria-ER-metabolism
Phosphoglycerate mutase 2	Pgam2	NP_061358.1	1,318.20	0.00	Unique
Acyl-coenzyme A dehydrogenase, short/branched cha	Acadsb	NP_080102.1	459.54	0.00	Unique
NADH-ubiquinone oxidoreductase flavoprotein 3 is	1500032D16Rik	NP_084363.2	297.04	0.00	Unique
Malic enzyme 3, NADP(+)-dependent, mitochondrial	Me3	NP_852072.1	267.94	0.00	Unique
LRP16 protein	Macrod1	NP_598908.1	258.11	0.00	Unique
AAA-ATPase TOB3	Atad3a	NP_849534.1	224.65	0.00	Unique
Hydroxysteroid dehydrogenase like 2	Hsdl2	NP_077217.2	221.37	0.00	Unique
DnaJ (Hsp40) homolog, subfamily C, member 11	Dnajc11	NP_766292.2	173.96	0.00	Unique
Endoplasmic reticulum protein ERp29 precursor	Erp29	NP_080405.1	173.47	0.00	Unique
Acyl-CoA thioesterase 9	Acot9	NP_062710.2	158.23	0.00	Unique
ERO1-like	Ero1l	NP_056589.1	147.92	0.00	Unique
Glutaminase isoform 1	Gls	NP_001074550.1	135.20	0.00	Unique
Sulfite oxidase	Suox	NP_776094.2	115.22	0.00	Unique
Ferredoxin reductase	Fdxr	NP_032023.1	110.70	0.00	Unique
Malic enzyme 2, NAD(+)-dependent, mitochondrial	Me2	NP_663469.1	106.38	0.00	Unique
Aspartyl-tRNA synthetase	Dars	NP_803228.1	104.99	0.00	Unique
Lectin, mannose-binding, 1	Lman1	NP_081676.1	103.83	0.00	Unique
NADH dehydrogenase subunit 5	ND5	NP_904338.1	87.62	0.00	Unique
Monoamine oxidase A	Maoa	NP_776101.2	83.91	0.00	Unique
Leucyl/cystinyl aminopeptidase	Lnpep	NP_766415.1	59.67	0.00	Unique
Hexokinase domain containing 1	Hkdc1	NP_663394.1	48.90	0.00	Unique
Creatine kinase, mitochondrial 1, ubiquitous	Ckmt1	NP_034027.1	1,531.79	42.55	36.00
Glutaminase isoform 2	Gls	NP_001106854.1	1,030.39	30.31	34.00
Solute carrier family 25 (mitochondrial carrier,	Slc25a12	NP_766024.1	1,005.77	67.05	15.00
Cytochrome-c oxidase subunit III	COX3	NP_904334.1	401.03	33.42	12.00
Metaxin 1	Mtx1	NP_038632.1	308.78	28.07	11.00
Phosphoglucomutase 2	Pgm2	NP_082408.2	178.81	16.26	11.00
Branched chain ketoacid dehydrogenase E1, α p	Bckdha	NP_031559.2	178.72	19.86	9.00
Mitochondrial ribosomal protein S2	Mrps2	NP_536700.2	247.37	30.92	8.00
Methylcrotonoyl-coenzyme A carboxylase 2 (β)	Mccc2	NP_084302.1	602.81	81.46	7.40
Branched chain aminotransferase 2, mitochondrial	Bcat2	NP_033867.1	657.19	90.65	7.25
Isocitrate dehydrogenase 3, β-subunit	Idh3b	NP_570954.1	426.59	71.10	6.00
Mitochondrial trifunctional protein, α-subunit	Hadha	NP_849209.1	3,471.64	737.87	4.70
Sorting and assembly machinery component 50 homol	Samm50	NP_848729.1	597.72	134.97	4.43
Citrate synthase	Cs	NP_080720.1	1,681.59	386.57	4.35
Cytochrome-c oxidase, subunit VIb polypeptide 1	Cox6b1	NP_079904.1	3,078.01	794.32	3.88
Pyruvate kinase, muscle	Pkm2	NP_035229.2	1,711.47	449.48	3.81
Acetyl-CoA synthetase 2-like	Acss1	NP_542142.1	2,572.92	696.83	3.69
NADH dehydrogenase (ubiquinone) 1 α subcomple	Ndufa10	NP_077159.1	1,305.31	369.43	3.53
3-Hydroxybutyrate dehydrogenase, type 1	Bdh1	NP_780386.2	548.52	156.72	3.50
ATP synthase F0 subunit 8	ATP8	NP_904332.1	2,961.52	901.33	3.29
Carnitine acetyltransferase	Crat	NP_031786.2	494.07	155.28	3.18
13-kDa differentiation-associated protein	Ndufa12	NP_079827.2	2,835.57	907.38	3.13
Inner membrane protein, mitochondrial	Immt	NP_083949.2	1,573.30	512.51	3.07
NADH dehydrogenase (ubiquinone) Fe-S protein 2	Ndufs2	NP_694704.1	741.08	247.03	3.00
ATP synthase, H+ transporting, mitochondrial F0	Atp5f1	NP_033855.2	3,385.28	1,139.94	2.97
NADH dehydrogenase (ubiquinone) 1 α subcomple	Ndufa4	NP_035016.1	3,752.63	1,286.62	2.92
Voltage-dependent anion channel 3	Vdac3	NP_035826.1	845.45	292.66	2.89
Choline dehydrogenase	Chdh	NP_780552.1	602.28	210.80	2.86
Pyruvate dehydrogenase (lipoamide) β	Pdhb	NP_077183.1	2,414.15	847.52	2.85
Isocitrate dehydrogenase 3 (NAD+) α	Idh3a	NP_083849.1	2,371.42	857.75	2.76
Propionyl-coenzyme A carboxylase, α polypepti	Pcca	NP_659093.1	1,338.49	487.86	2.74
ATP synthase, H+ transporting, mitochondrial F1 com	Atp5o	NP_613063.1	8,645.95	3,252.93	2.66
Aldehyde dehydrogenase 1 family, member L1	Aldh1l1	NP_081682.1	2,360.47	891.51	2.65
Cytochrome-c oxidase subunit II	COX2	NP_904331.1	4,504.09	1,732.34	2.60
Hexokinase 1	Hk1	NP_034568.1	1,032.45	397.82	2.60
Upregulated during skeletal muscle growth 5	Usmg5	NP_075700.2	4,544.37	1,880.43	2.42
NADH dehydrogenase (ubiquinone) 1 α subcomple	Ndufa8	NP_080979.1	3,951.57	1,650.65	2.39
Solute carrier family 25, member 5	Slc25a5	NP_031477.1	14,727.63	6,316.18	2.33
Solute carrier family 25 (mitochondrial carrier)	Slc25a31	NP_848473.1	6,461.13	2,777.15	2.33
Isocitrate dehydrogenase 3 (NAD+), gamma	Idh3 g	NP_032349.1	1,028.39	444.08	2.32
Superoxide dismutase 2, mitochondrial	Sod2	NP_038699.2	3,983.27	1,747.76	2.28
Solute carrier family 25 (mitochondrial carrier, ph	Slc25a3	NP_598429.1	6,461.13	2,777.15	2.23
Isocitrate dehydrogenase 2 (NADP+), mitochondrial	Idh2	NP_766599.1	7,362.44	3,376.91	2.18
NADH dehydrogenase (ubiquinone) Fe-S protein 1	Ndufs1	NP_663493.1	2,144.23	990.61	2.16
Solute carrier family 25 (mitochondrial carrier)	Slc25a4	NP_031476.3	2,704.82	1,276.43	2.12
Glutamate oxaloacetate transaminase 2, mitochondrial	Got2	NP_034455.1	3,648.91	1,729.54	2.11
Methylcrotonoyl-coenzyme A carboxylase 1 (α)	Mccc1	NP_076133.2	693.43	340.41	2.04
ATP synthase, H+ transporting, mitochondrial F1F0 c	Atp5k	NP_031533.2	8,135.41	4,006.99	2.03
NADH dehydrogenase (ubiquinone) 1 α subcomplex	Ndufa9	NP_079634.1	1,223.27	611.63	2.00
Aconitase 2, mitochondrial	Aco2	NP_542364.1	11,677.50	5,873.85	1.99
Acetyl-coenzyme A acetyltransferase 1 precursor	Acat1	NP_659033.1	3,994.10	2,052.83	1.95
ATP synthase, H+ transporting, mitochondrial F1 co	Atp5a1	NP_031531.1	10,928.39	6,426.50	1.70
Succinate dehydrogenase Fp subunit	Sdha	NP_075770.1	3,265.12	1,970.09	1.66
ATP synthase, H+ transporting mitochondrial F1 co	Atp5b	NP_058054.2	14,280.52	9,253.92	1.54
Oxoglutarate dehydrogenase (lipoamide)	Ogdh	NP_035086.2	2,370.14	1,545.74	1.53
Other
Basigin isoform 2	Bsg	NP_001070652.1	539.18	0.00	Unique
Cardiotrophin-like cytokine factor 1	Clcf1	NP_064336.1	356.28	0.00	Unique
Ladinin	Lad1	NP_598425.2	305.79	0.00	Unique
Small glutamine-rich tetratricopeptide repeat (TP)	Sgta	NP_078775.1	262.22	0.00	Unique
Tetraspanin 8	Tspan8	NP_666122.1	195.45	0.00	Unique
Proteasome activator subunit 2 isoform 2	Psme2	NP_001025026.1	191.14	0.00	Unique
Hypothetical protein LOC67809	1200015F23Rik	NP_001028308.1	134.54	0.00	Unique
ROD1 regulator of differentiation 1 isoform 2	Rod1	NP_835458.1	105.82	0.00	Unique
Protease (prosome, macropain) 26S subunit, ATPase	Psmc1	NP_032973.1	101.66	0.00	Unique
Acid sphingomyelinase-like phosphodiesterase 3a	Smpdl3a	NP_065586.3	100.29	0.00	Unique
U2 small nuclear ribonucleoprotein auxiliary fac	U2af2	NP_598432.2	94.13	0.00	Unique
Asparaginyl-tRNA synthetase	Nars	NP_081626.1	79.28	0.00	Unique
α-Isoform of regulatory subunit A, protein pho	Ppp2r1a	NP_058587.1	76.54	0.00	Unique
Predicted: cingulin	Cgn	XP_001001375.2	40.13	0.00	Unique
Predicted: similar to novel C2, FerI (NUC094)	Fer1l4	XP_001481330.1	25.82	0.00	Unique
Nascent polypeptide-associated complex α su	Naca	NP_001106670.1	22.68	0.00	Unique
ATP-binding cassette, subfamily B (MDR/TAP), mem	Abcb8	NP_083296.2	128.21	12.82	10.00
Predicted: similar to 3-methylcrotonyl-CoA car	LOC677576	XP_001005025.1	922.79	106.48	8.67
Thioredoxin reductase 1 isoform 1	Txnrd1	NP_001035988.1	119.52	14.94	8.00
Mannosidase 2, α1	Man2a1	NP_032575.1	60.80	7.60	8.00
Glutamate oxaloacetate transaminase 1, soluble	Got1	NP_034454.2	735.17	108.11	6.80
Aldolase 1, A isoform	Aldoa	NP_031464.1	2,515.50	381.14	6.60
IQ motif containing GTPase activating protein 2	Iqgap2	NP_081987.1	288.04	44.31	6.50
Peptidase M20 domain containing 1	Pm20d1	NP_835180.1	197.87	35.98	5.50
Aldo-keto reductase family 1, member C19	Akr1c19	NP_001013807.1	296.32	53.88	5.50
Eukaryotic translation initiation factor 4B	Eif4b	NP_663600.1	270.29	49.14	5.50
Transmembrane protein 109	Tmem109	NP_598903.1	418.15	76.03	5.50
Nodal modulator 1	Nomo1	NP_694697.2	120.13	22.52	5.33
Predicted: NADH dehydrogenase (ubiquinone) 1 α subcomple	Ndufa11	XP_930081.2	1,389.31	330.79	4.20
NADH dehydrogenase (ubiquinone) 1 β-subcomplex	Ndufb9	NP_075661.1	2410.84	591.34	4.08
Predicted: hypothetical protein isoform 2	LOC100039281	XP_001472561.1	8,538.62	2,148.08	3.98
Phosphoglycerate kinase 1	Pgk1	NP_032854.2	1,167.22	314.25	3.71
Predicted: hypothetical protein	LOC100046199	XP_001475883.1	1,900.90	536.15	3.55
Predicted: similar to ubiquitin A-52 residue ribos	LOC629750	XP_899768.2	2,583.06	815.70	3.17
Enolase 2, γ neuronal	Eno2	NP_038537.1	401.72	126.86	3.17
Spectrin β2-isoform 2	Spnb2	NP_033286.2	1,660.32	581.31	2.86
Prothymosin-α	Ptma	NP_032998.1	2,692.98	979.26	2.75
Nicotinamide nucleotide transhydrogenase	Nnt	NP_032736.2	2,028.41	807.85	2.51
Histone cluster 1, H2ab	Hist1 h2ab	NP_783591.2	3,820.17	1,627.11	2.35
Carnitine palmitoyltransferase 1a, liver	Cpt1a	NP_038523.2	861.18	373.93	2.30
Heterogeneous nuclear ribonucleoprotein L	Hnrnpl	NP_796275.2	864.89	415.81	2.08
Histone H3-like	OTTMUSG00000007855	NP_001074488.1	6,757.74	3,346.07	2.02
Histone cluster 2, H2bb	Hist2 h2bb	NP_783597.2	7,758.53	4,094.78	1.89

Values are normalized spectral counts from mass spectrometry. Final column shows ratio of normalized protein spectral count in EGFP⁺ cells to EGFP⁻ cells.

Table 3.

List of proteins that were identified as being significantly enriched in epididymal EGFP⁺ cells compared with renal EGFP⁻ cells

Protein Name	Gene Symbol	Accession No.	EGFP+	EGFP−	Ratio
V-ATPase - acid/base
V-ATPase subunit A	Atp6v1a	NP_031534.2	219.54	0.00	Unique
V-ATPase subunit B1	Atp6v1b1	NP_598918.1	158.48	0.00	Unique
V-ATPase subunit B2	Atp6v1b2	NP_031535.2	123.78	0.00	Unique
V-ATPase subunit a4	Atp6v0a4	NP_536715.2	41.85	0.00	Unique
Male urogenital tract
Cysteine-rich secretory protein 1	Crisp1	NP_033768.3	216.77	0.00	Unique
Serine (or cysteine) proteinase inhibitor, clade B, member 6b	Serpinb6b	NP_035584.1	117.55	0.00	Unique
Serine proteinase inhibitor member 6C	Serpinb6c	NP_683744.2	93.21	0.00	Unique
Chaperonin containing Tcp1, subunit 5 (ε)	Cct5	NP_031663.1	67.09	0.00	Unique
Lactate dehydrogenase B	Ldhb	NP_032518.1	492.18	82.03	6.00
Dihydrolipoamide dehydrogenase	Dld	NP_031887.2	184.26	36.85	5.00
N-acylsphingosine amidohydrolase 1	Asah1	NP_062708.1	313.41	67.16	4.67
Acyl-coenzyme A oxidase 3, pristanoyl	Acox3	NP_109646.2	459.16	102.04	4.50
A disintegrin and metalloprotease domain 7	Adam7	NP_031428.2	168.18	44.85	3.75
Phosphatidylethanolamine binding protein 1	Pebp1	NP_061346.2	1,296.18	528.07	2.45
Intracellular trafficking
RAB5A, member RAS oncogene family	Rab5a	NP_080163.1	211.88	0.00	Unique
Cathepsin B preproprotein	Ctsb	NP_031824.1	134.12	0.00	Unique
Adaptor protein complex AP-1, μ2-subunit isoform 2	Ap1m2	NP_033808.2	103.84	0.00	Unique
SAC1 (supressor of actin mutations 1, homolog)-like	Sacm1l	NP_109617.1	89.63	0.00	Unique
Junction plakoglobin	Jup	NP_034723.1	48.90	0.00	Unique
Ubiquitin specific protease 14 isoform 2	Usp14	NP_001033678.1	95.57	0.00	Unique
Fatty acid synthase	Fasn	NP_032014.3	150.50	7.34	20.50
Coatomer protein complex, subunit β 2 (β prime)	Copb2	NP_056642.1	107.37	9.76	11.00
Solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 1	Slc9a3r1	NP_036160.1	440.41	51.81	8.50
ADP-ribosylation factor 5	Arf5	NP_031506.1	487.10	97.42	5.00
Ubiquitin B	Ubb	NP_035794.1	1,338.43	756.51	1.77
Clathrin, heavy polypeptide (Hc)	Cltc	NP_001003908.1	751.74	480.28	1.57
Cytoskeleton
Hypothetical protein LOC66302	2410005O16Rik	NP_079752.3	114.29	0.00	Unique
Histone deacetylase 6	Hdac6	NP_034543.2	79.55	0.00	Unique
Keratin 82	Krt82	NP_444479.1	70.04	0.00	Unique
Keratin 7	Krt7	NP_149064.1	611.33	118.32	5.17
Myosin VI	Myo6	NP_001034635.1	144.10	34.31	4.20
Keratin 18	Krt18	NP_034794.1	1,389.35	336.81	4.13
Dynein, cytoplasmic, heavy chain 1	Dync1 h1	NP_084514.2	77.06	20.67	3.73
Myosin IB	Myo1b	NP_034993.2	101.12	31.11	3.25
Gelsolin	Gsn	NP_666232.2	360.71	174.54	2.07
Keratin complex 2, basic, gene 8	Krt8	NP_112447.2	1,429.48	806.37	1.77
Membrane dynamics
Prominin 2 isoform 1	Prom2	NP_620089.1	171.71	0.00	Unique
Annexin A13	Anxa13	NP_081487.1	139.19	0.00	Unique
Dynamin 1-like isoform a	Dnm1l	NP_690029.2	50.29	0.00	Unique
Prominin 1	Prom1	NP_032961.1	93.53	10.39	9.00
Transporters and channels
Solute carrier organic anion transporter family, member 4a1	Slco4a1	NP_683735.1	77.25	0.00	Unique
Chloride intracellular channel 3	Clic3	NP_081361.1	186.25	0.00	Unique
Solute carrier family 16, member 1	Slc16a1	NP_033222.1	262.83	18.77	14.00
Intracellular signaling, receptors, hormones
Prostaglandin E synthase	Ptges	NP_071860.1	347.11	0.00	Unique
Prostaglandin H2 d-isomerase	Ptgds	NP_032989.2	189.88	0.00	Unique
Hydroxysteroid (17-β) dehydrogenase 12 protein	Hsd17b12	NP_062631.1	143.92	0.00	Unique
Prostaglandin-endoperoxide synthase 2	Ptgs2	NP_035328.2	57.96	0.00	Unique
Prostaglandin-endoperoxide synthase 1	Ptgs1	NP_032995.1	57.94	0.00	Unique
LPS-responsive beige-like anchor isoform α	Lrba	NP_109620.2	22.09	0.00	Unique
Progesterone receptor membrane component	Pgrmc1	NP_058063.2	645.33	230.48	2.80
Protein disulfide isomerase associated 4	Pdia4	NP_033917.2	732.35	428.36	1.71
Stress response-antioxidant
Glutathione S-transferase, μ 6	Gstm6	NP_032210.3	273.21	0.00	Unique
Glutathione peroxidase 5	Gpx5	NP_034473.1	590.98	0.00	Unique
Glutathione S-transferase, μ 7	Gstm7	NP_080948.2	505.65	77.79	6.50
Heat shock 70-kDa protein 1B	Hspa1b	NP_034608.2	327.75	114.00	2.88
Glutathione S-transferase, μ 4	Gstm4	NP_081040.1	1,567.43	548.60	2.86
Heat shock protein 5	Hspa5	NP_071705.2	1,891.66	828.47	2.28
Glutathione S-transferase, μ 5	Gstm5	NP_034490.1	1,314.06	713.35	1.84
Glutathione S-transferase, μ 2	Gstm2	NP_032209.1	1,710.94	933.24	1.83
Peroxiredoxin 1	Prdx1	NP_035164.1	1,758.62	1,037.13	1.70
Apoptosis
FGF receptor activating protein 1	Frag1	NP_663558.1	379.27	0.00	Unique
Carboxylesterase 1	Ces1	NP_067431.2	143.59	0.00	Unique
Membrane metallo endopeptidase	Mme	NP_032630.2	105.02	0.00	Unique
Tripeptidyl-peptidase I	Tpp1	NP_034036.1	179.32	32.60	5.50
Aminolevulinate, δ-, dehydratase	Alad	NP_032551.3	749.51	166.56	4.50
Apoptosis-inducing factor, mitochondrion-associated 1	Aifm1	NP_036149.1	134.80	29.96	4.50
Voltage-dependent anion channel 1	Vdac1	NP_035824.1	747.83	260.12	2.88
Prolyl 4-hydroxylase, β polypeptide	P4 hb	NP_035162.1	1,174.23	683.51	1.72
Nuclear proteins
Aminomethyltransferase	Amt	NP_001013836.1	159.06	0.00	Unique
Synaptic nuclear envelope 2	Syne2	NP_001005510.2	16.61	1.28	13.00
Nuclear mitotic apparatus protein 1	Numa1	NP_598708.2	38.19	4.24	9.00
Lysosome
Hexosaminidase B	Hexb	NP_034552.1	212.71	0.00	Unique
Cathepsin D	Ctsd	NP_034113.1	88.98	0.00	Unique
Mannosidase 2, α B1	Man2b1	NP_034894.2	43.61	0.00	Unique
Epididymal secretory protein E1	Npc2	NP_075898.1	1824.59	121.64	15.00
Mitochondria - ER-metabolism
6.8-kDa Mitochondrial proteolipid	2010107E04Rik	NP_081636.1	597.19	0.00	Unique
CDGSH iron sulfur domain 1	Cisd1	NP_598768.1	495.99	0.00	Unique
NADPH-dependent retinol dehydrogenase/reductase isoform 1	Dhrs4	NP_001033027.1	234.01	0.00	Unique
Alcohol dehydrogenase 5 (class III), χ-polypeptide	Adh5	NP_031436.2	202.29	0.00	Unique
Arginine-rich, mutated in early stage tumors	Armet	NP_083379.2	196.20	0.00	Unique
Succinate-coenzyme A ligase, GDP-forming, β-subunit	Suclg2	NP_035637.1	170.85	0.00	Unique
Acyl-coenzyme A dehydrogenase, short/branched chain	Acadsb	NP_080102.1	167.11	0.00	Unique
Creatine kinase, mitochondrial 1, ubiquitous	Ckmt1	NP_034027.1	148.92	0.00	Unique
Solute carrier family 25 (adenine nucleotide translocator), member 13	Slc25a13	NP_056644.1	147.72	0.00	Unique
Nipsnap homolog 3A	Nipsnap3a	NP_079899.1	141.30	0.00	Unique
Sideroflexin 3	Sfxn3	NP_444427.1	141.22	0.00	Unique
Cytochrome P450, family 4, subfamily a family	Cyp4a12b	NP_758510.2	120.05	0.00	Unique
Mitochondrial carrier homolog 2	Mtch2	NP_062732.1	119.41	0.00	Unique
Sulfite oxidase	Suox	NP_776094.2	98.76	0.00	Unique
Hexokinase 2	Hk2	NP_038848.1	97.53	0.00	Unique
Methylcrotonoyl-coenzyme A carboxylase 1 (α)	Mccc1	NP_076133.2	88.25	0.00	Unique
L-specific multifunctional β-oxdiation protein	Ehhadh	NP_076226.2	76.63	0.00	Unique
Hydroxysteroid dehydrogenase like 2	Hsdl2	NP_077217.2	73.79	0.00	Unique
Proline dehydrogenase	Prodh	NP_035302.2	58.79	0.00	Unique
Acetyl-CoA synthetase 2-like	Acss1	NP_542142.1	53.60	0.00	Unique
Propionyl-coenzyme A carboxylase, α polypeptide	Pcca	NP_659093.1	50.04	0.00	Unique
Serine hydroxymethyltransferase 2 (mitochondrial)	Shmt2	NP_082506.1	179.34	17.93	10.00
Dnaj (Hsp40) homolog, subfamily C, member 10	Dnajc10	NP_077143.2	88.32	11.04	8.00
Endoplasmic reticulum protein erp29 precursor	Erp29	NP_080405.1	242.86	34.69	7.00
Superoxide dismutase 2, mitochondrial	Sod2	NP_038699.2	528.39	81.29	6.50
Valyl-tRNA synthetase	Vars	NP_035820.2	178.28	28.52	6.25
Aldehyde dehydrogenase family 3, subfamily A2	Aldh3a2	NP_031463.2	222.34	37.06	6.00
Leucine-rich PPR motif-containing protein	Lrpprc	NP_082509.2	70.24	12.77	5.50
Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	Mthfd1l	NP_758512.2	331.08	66.22	5.00
Acyl-CoA thioesterase 10	Acot10	NP_073727.2	197.81	39.56	5.00
Pyrroline-5-carboxylate reductase 1	Pycr1	NP_659044.1	278.01	61.78	4.50
Phosphoglucomutase 2	Pgm2	NP_082408.2	146.30	32.51	4.50
Acyl-CoA synthetase long-chain family member 5	Acsl5	NP_082252.1	118.10	26.24	4.50
Acyl-CoA synthetase long-chain family member 1	Acsl1	NP_032007.2	166.77	38.49	4.33
Solute carrier family 25, member 5	Slc25a5	NP_031477.1	1,336.12	334.03	4.00
d-Lactate dehydrogenase	Ldhd	NP_081846.3	212.16	57.86	3.67
Glutamate oxaloacetate transaminase 2, mitochondrial	Got2	NP_034455.1	3,290.35	906.96	3.63
Leucine aminopeptidase 3	Lap3	NP_077754.2	249.18	71.19	3.50
Aldehyde dehydrogenase family 6, subfamily A1	Aldh6a1	NP_598803.1	500.73	155.40	3.22
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit	Atp5o	NP_613063.1	642.03	214.01	3.00
ATP synthase, H+ transporting, mitochondrial F1 complex, gamma subunit isoform b	Atp5c1	NP_001106209.1	760.18	264.41	2.88
ER lipid raft associated 2	Erlin2	NP_705820.1	369.66	132.02	2.80
Hypoxia upregulated 1	Hyou1	NP_067370.3	314.80	116.93	2.69
Aconitase 2, mitochondrial	Aco2	NP_542364.1	819.06	315.92	2.59
Solute carrier family 25 (adenine nucleotide translocator), member 31	Slc25a31	NP_848473.1	850.15	340.06	2.50
Acetyl-coenzyme A acetyltransferase 1 precursor	Acat1	NP_659033.1	468.58	200.82	2.33
Lactate dehydrogenase A	Ldha	NP_034829.1	493.17	219.19	2.25
Calreticulin	Calr	NP_031617.1	958.44	458.39	2.09
Pyruvate kinase, muscle	Pkm2	NP_035229.2	708.79	345.75	2.05
Aldehyde dehydrogenase family 1, subfamily A1	Aldh1a1	NP_038495.2	1,872.67	991.41	1.89
ATP synthase, H+ transporting, mitochondrial F1 complex, α subunit, isoform 1	Atp5a1	NP_031531.1	1,338.85	719.63	1.86
Calnexin	Canx	NP_001103970.1	1,040.46	564.82	1.84
ATP synthase, H+ transporting mitochondrial F1 complex, β-subunit	Atp5b	NP_058054.2	1,705.14	941.38	1.81
Aldehyde dehydrogenase 2, mitochondrial	Aldh2	NP_033786.1	1,609.55	902.06	1.78
Malate dehydrogenase 2, NAD (mitochondrial)	Mdh2	NP_032643.2	1,516.37	898.59	1.69
Other
Predicted: similar to ubiquitin A-52 residue ribosomal protein fusion product 1 isoform 2	LOC629750	XP_899768.2	407.85	0.00	Unique
Serine (or cysteine) proteinase inhibitor, clade B, member 9	Serpinb9	NP_033282.1	402.28	0.00	Unique
Hypothetical protein LOC231293	C130090K23Rik	NP_851840.1	396.52	0.00	Unique
Aldo-keto reductase family 1, member C19	Akr1c19	NP_001013807.1	296.32	0.00	Unique
Aldo-keto reductase family 1, member C13	Akr1c13	NP_038806.1	243.15	0.00	Unique
Acetyl-coenzyme A acetyltransferase 2	Acat2	NP_033364.2	217.93	0.00	Unique
D6Wsu176e protein	D6Wsu176e	NP_613053.3	202.00	0.00	Unique
Pyrroline-5-carboxylate reductase family, member 2	Pycr2	Np_598466.1	178.26	0.00	Unique
Predicted: similar to AFG3(ATPase family gene 3)-like 2 (yeast)	LOC100048880	XP_001472434.1	149.66	0.00	Unique
Golgi apparatus protein 1	Glg1	Np_033175.1	142.07	0.00	Unique
Lectin, mannose-binding 2	Lman2	Np_080104.2	123.67	0.00	Unique
Nucleobindin 2 isoform 2	Nucb2	Np_058053.2	99.30	0.00	Unique
Farnesyl diphosphate synthetase	Fdps	Np_608219.1	98.57	0.00	Unique
Hypothetical protein LOC68646 isoform 2	1110020G09Rik	NP_001035485.2	82.76	0.00	Unique
Hydroxysteroid (17-β) dehydrogenase 4	Hsd17b4	Np_032318.2	75.49	0.00	Unique
Eukaryotic translation initiation factor 3 subunit 6 interacting protein	Eif3eip	Np_660121.2	75.06	0.00	Unique
Transmembrane 9 superfamily member 2	Tm9 sf2	Np_542123.2	66.34	0.00	Unique
ATP citrate lyase	Acly	NP_598798.1	50.11	0.00	Unique
Predicted: similar to GPI inositol-deacylase	D230012E17Rik	XP_912118.2	47.81	0.00	Unique
U5 snRNP-associated 102 kDa protein	Prpf6	NP_598462.1	37.48	0.00	Unique
Predicted: Golgi autoantigen, golgin subfamily b, macrogolgin 1	Golgb1	XP_001481110.1	24.37	0.00	Unique
Staphylococcal nuclease domain containing 1	Snd1	Np_062750.2	235.09	19.59	12.00
Predicted: hypothetical protein	LOC640248	XP_922185.2	556.21	46.35	12.00
Carbonyl reductase 1	Cbr1	Np_031646.2	391.63	32.64	12.00
Carboxylesterase 3	Ces3	Np_444430.2	291.32	32.37	9.00
N-acetylneuraminic acid synthase	Nans	NP_444409.1	224.86	24.98	9.00
Galactosidase, β 1-like 2	Glb1l2	Np_722498.1	121.68	13.52	9.00
Palmitoyl-protein thioesterase 1	Ppt1	Np_032943.2	260.94	28.99	9.00
Pyridoxal-dependent decarboxylase domain containing 1 isoform 3	Pdxdc1	Np_001034622.1	432.88	50.93	8.50
Predicted: similar to serine proteinase inhibitor hongrES1	Gm46	XP_001478131.1	171.03	21.38	8.00
Aconitase 1	Aco1	Np_031412.2	142.67	20.38	7.00
Ribosomal protein S3	Rps3	NP_036182.1	262.42	37.49	7.00
Endoplasmic reticulum-Golgi intermediate compartment (ERGIC) 1	Ergic1	NP_080446.1	214.97	30.71	7.00
Lysophospholipase-like 1	Lyplal1	Np_666218.1	265.73	37.96	7.00
Hypoxanthine guanine phosphoribosyl transferase 1	Hprt1	Np_038584.2	284.90	40.70	7.00
Plasma glutamate carboxypeptidase	Pgcp	Np_061225.2	501.80	77.20	6.50
Glycoprotein, synaptic 2	Gpsn2	Np_598879.1	1,717.91	332.50	5.17
Abhydrolase domain containing 12	Abhd12	Np_077785.2	220.90	44.18	5.00
3-Phosphoglycerate dehydrogenase	Phgdh	Np_058662.2	247.41	53.02	4.67
UDP-glucose ceramide glucosyltransferase-like 1	Ugcgl1	NP_942602.1	158.70	39.68	4.00
Predicted: similar to desmoplakin	Dsp	XP_001481322.1	36.06	12.02	3.00
Argininosuccinate lyase	Asl	Np_598529.1	347.90	135.29	2.57
Predicted: similar to vesicle associated protein	Sec31a	XP_912694.3	124.94	48.59	2.57
Coatomer protein complex subunit α	Copa	Np_034068.2	122.72	50.53	2.43
UbiE-YGHL1 fusion protein	LOC554292	NP_001019843.1	566.72	233.35	2.43
Protein disulfide isomerase-associated 6	Pdia6	Np_082235.1	1,150.15	513.46	2.24
Malate dehydrogenase 1, NAD (soluble)	Mdh1	NP_032644.2	987.16	493.58	2.00
Triosephosphate isomerase 1	Tpi1	Np_033441.1	1,684.60	973.32	1.73

Values are normalized spectral counts from mass spectrometry. Final column shows ratio of normalized protein spectral count in EGFP⁺ cells to EGFP⁻ cells.

Several proteins involved in intracellular trafficking were detected in the EGFP⁺ populations. For example, in renal EGFP⁺ cells, Rab1, Rab1B, Rab2a, Rab4a, Rab5a, Rab5b, Rab5c, Rab7, Rab8a, Rab8b, Rab10, Rab11a, Rab14, Rab18, Rab21, Rab27a, Rab31, and Rab35 were detected in these cells (supplemental Table S1). However, only Rab1 and Rab10 were enriched in these cells compared with all other cell types (EGFP⁻ cells). Similarly, out of several Rab proteins present in epididymal EGFP⁺ cells—Rab1, Rab2a, Rab5a, Rab5b, Rab5c, Rab6a, Rab6b, Rab7, Rab8a, Rab10, Rab11a, Rab11b, Rab12a, Rab14, and Rab35 (supplemental Table S2)—only Rab5a was shown to be enriched in these cells compared with EGFP⁻ cells. Of note, the adaptor protein complex AP-1 mu1B, as well as Fasn, a protein that interacts with caveolin-1 in lipid rafts, β-COP, clathrin, and NHERF-1 (Slc9a3r1) were all enriched in epididymal EGFP⁺ cells. Several annexins (Anxa4, Anxa6, and Anxa11) were enriched in renal EGFP⁺ cells, while Anxa13 was enriched in epididymal EGFP⁺ cells.

In agreement with their dynamic endocytic function, proteins involved in cytoskeletal reorganization and vesicle recycling were shown to be enriched in the renal and epididymal EGFP⁺ populations. Among these proteins, Cdc42 and its downstream effector, Iqgap1 (3), as well as Pacsin 2, were identified in renal EGFP⁺ cells. These proteins have been implicated in actin and microtubule dynamics (3, 27). Hdac6, another protein involved in actin dynamics, was detected exclusively in epididymal EGFP⁺ cells.

Enriched proteins common to renal and epididymal EGFP⁺ cells.

A list of enriched proteins common to both renal and epididymal EGFP⁺ populations is provided in Table 4. As expected, among these proteins, subunits A, B1, and a4 of the V-ATPase, and gelsolin were present in both samples. Interestingly, the progesterone receptor, Pgrmc1, was enriched in both cell types, as well as the PKA-binding protein, Lrba. Members of the keratin family, keratin 7, 18, and 82, were also identified, of which keratin 82 was uniquely detected in the EGFP⁺ populations compared with their respective EGFP⁻ samples.

Table 4.

List of proteins enriched in EGFP⁺ cells and common to both renal and epididymal samples

Protein Name	Gene Symbol	Accession No.	Ratio Epididymis	Ratio Kidney
V-ATPase
ATPase, H+ transporting, lysosomal V1 subunit B1	Atp6v1b1	NP_598918.1	Unique	Unique
ATPase, H+ transporting, lysosomal V1 subunit A	Atp6v1a	NP_031534.2	Unique	7.84
ATPase, H+ transporting, lysosomal V0 subunit A isoform 4	Atp6v0a4	NP_536715.2	Unique	6.44
PKA binding-endosomal transport
LPS-responsive beige-like anchor isoform α	Lrba	NP_109620.2	Unique	2.46
Receptors
Progesterone receptor membrane component	Pgrmc1	NP_058063.2	2.80	8.00
Cytoskeleton
Keratin 82	Krt82	NP_444479.1	Unique	Unique
Keratin 7	Krt7	NP_149064.1	5.17	Unique
Keratin 18	Krt18	NP_034794.1	4.13	5.13
Gelsolin	Gsn	NP_666232.2	2.07	4.10
Stress response-antioxidant
Heat shock 70-kDa protein 1B (Hspa1b)	Hspa1b	NP_034608.2	2.88	6.75
Peroxiredoxin 1	Prdx1	NP_035164.1	1.70	1.78
Mitochondria
Hydroxysteroid dehydrogenase like 2	Hsdl2	NP_077217.2	Unique	Unique
Acyl-coenzyme A dehydrogenase, short/branched chain	Acadsb	NP_080102.1	Unique	Unique
Sulfite oxidase	Suox	NP_776094.2	Unique	Unique
Creatine kinase, mitochondrial 1, ubiquitous	Ckmt1	NP_034027.1	Unique	36.00
Aldo-keto reductase family 1, member C19	Akr1c19	NP_001013807	Unique	5.50
Acetyl-CoA synthetase 2-like [Mus musculus]	Acss1	NP_542142.1	Unique	3.69
Propionyl-coenzyme A carboxylase, α polypeptide	Pcca	NP_659093.1	Unique	2.74
Superoxide dismutase 2, mitochondrial	Sod2	NP_038699.2	6.50	2.28
Solute carrier family 25, member 5	Slc25a5	NP_031477.1	4.00	2.33
Glutamate oxaloacetate transaminase 2, mitochondrial	Got2	NP_034455.1	3.63	2.11
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit	Atp5o	NP_613063.1	3.00	2.66
Aconitase 2, mitochondrial	Aco2	NP_542364.1	2.59	1.99
Solute carrier family 25 (adenine nucleotide translocator), member 31	Slc25a31	NP_848473.1	2.50	2.33
Acetyl-coenzyme A acetyltransferase 1 precursor	Acat1	NP_659033.1	2.33	1.95
Pyruvate kinase, muscle	Pkm2	NP_035229.2	2.05	3.81
ATP synthase, H+ transporting, mitochondrial F1 complex, α subunit, isoform 1	Atp5a1	NP_031531.1	1.86	1.70
ATP synthase, H+ transporting mitochondrial F1 complex, β-subunit	Atp5b	NP_058054.2	1.81	1.54
Glucose metabolic process
Phosphoglucomutase 2	Pgm2	NP_082408.2	4.50	11.00
Protein modification
Ubiquitin B	Ubb	NP_035794.1	1.77	2.30
Lumen of ER, protein secretion
Endoplasmic reticulum protein ERp29 precursor	Erp29	NP_080405.1	7.00	Unique
Not classified
Methylcrotonoyl-coenzyme A carboxylase 1 (α)	Mccc1	NP_076133.2	Unique	2.04
Predicted: similar to ubiquitin A-52 residue ribosomal protein fusion product 1 isoform 2	LOC629750	XP_899768.2	Unique	3.17

Confirmation of proteins identified by proteomics using RT-PCR.

Enrichment of some of the proteins identified by proteomics in the EGFP⁺ populations compared with the EGFP⁻ populations was confirmed by RT-PCR. Figure 6 shows higher expression of genes coding for the V-ATPase B1 subunit (Atp6v1b1), prominin 2 (Prom2), the LPS-responsive beige-like anchor (Lrba), the progesterone receptor (Pgrmc1), annexin A6 (Anxa6), drebrin-like (Dbnl), keratin 18 (Krt18), myosin 6 (Myo6), and the solute carrier organic anion transporter (Slco4a1) in both the renal and epididymal EGFP⁺ samples, compared with their respective EGFP⁻ samples. In addition, Iqgap1 mRNA was enriched in renal EGFP⁺ cells, and mRNAs coding for prominin 1 (Prom1), and the hydroxysteroid (17-β) dehydrogenase 12 protein (Hsd17b12) were enriched in epididymal EGFP⁺ cells.

DISCUSSION

The major aim of this study was to determine the proteomic profiles of specialized acidifying cells in the kidney and epididymis. These cells all have in common a high expression of the B1 subunit of the V-ATPase in their plasma membrane, and we used our transgenic mice that express EGFP under the control of the promoter of this subunit (39) to harvest specifically these cells by FACS. An LC-MS/MS-based proteomic analysis was carried out in EGFP⁺ cells, which correspond chiefly to intercalated cells in the kidney and to narrow and clear cells in the epididymis. Results were compared with the proteins detected in the respective EGFP⁻ cell samples of both organs. To minimize false positive identification, a target-decoy analysis was performed. We also corrected for the higher probability of detecting peptides from larger proteins by normalizing spectral counts to their molecular weight. An exhaustive list of all proteins identified in renal and epididymal EGFP⁺ cells is provided in supplemental data and is available at the NHLBI-LKEM website (http://dir.nhlbi.nih.gov/papers/lkem/kevcpd/). These new databases provide a foundation for further analysis of the specific functions of specialized acidifying cells in the kidney and epididymis.

Out of the thousands of proteins that were identified in these cells, 202 and 178 proteins were enriched in the renal and epididymal EGFP⁺ populations, respectively. A large number of these proteins are located in mitochondria, in agreement with the high density of mitochondria in renal intercalated cells and epididymal clear cells (8). In addition, expression of several proteins known to be expressed in B1-expressing cells in both the kidney and epididymis was confirmed in this study. These include subunits of the V-ATPase, such as the B1 subunit itself, and other proteins involved in acid/base transport—pendrin (expressed in B-IC), Rhbg (expressed in A-IC), and Car2 (expressed in both A-IC and B-IC). Interestingly, the membrane-bound Car15 was uniquely detected in renal EGFP⁺ cells. This latest member of the carbonic anhydrase family has recently been described in the mouse gastrointestinal tract (44) and kidney (31). While the role of Car2 in proton secretion and bicarbonate reabsorption is well established in the kidney, it will be interesting to examine the potential participation of Car15 in these processes. It has to be noted, however, that while this isoform is expressed in several species including rodents, fish and birds, it is absent from humans and chimpanzees (30).

The presence of calbindin-28K and aquaporin 3 in renal EGFP⁺ cells indicates that connecting tubule cells were also positively selected during FACS sorting, in agreement with our previous report showing expression of EGFP in these cells (39). Interestingly, the closely related calcium-binding protein, calbindin 2 (also known as calretinin), was also enriched in the renal EGFP⁺ population. These two genes are located in the chromosomal regions where the carbonic anhydrase isozyme gene cluster (CA1, CA2, CA3) is located (45). While the role of calbindin-28K in calcium reabsorption by the kidney is well characterized (5), the role of calretinin in kidney function is not known. Calretinin is expressed in neurons and cancer cells, including colon cancer cells. It is also expressed in the chick embryonic kidney (18), but its expression in the adult kidney has not been described previously.

Proton secretion by renal intercalated cells and epididymal clear cells is dynamically regulated via recycling of the V-ATPase to and from the plasma membrane. Several proteins involved in vesicle trafficking were detected in EGFP⁺ cells. These include several members of the small GTPase protein family. Interestingly, only a few of these proteins, Rab5a in epididymal EGFP⁺ cells and Rab1 and Rab10 in renal EGFP⁺ cells, were actually enriched in these cells compared with all other cell types of their respective organ, indicating their potential involvement in the acidifying function of these cells. Rab5a is located in early endosomes and it will be interesting to determine its potential participation in V-ATPase recycling. Interestingly, while Rab10 is traditionally involved in Golgi export, it was recently shown to interact with myosin V proteins, indicating its participation in vesicle transport along actin filaments (53).

Several proteins involved in cytoskeletal reorganization were identified in EGFP⁺ cells. Of note, the actin remodeling protein, gelsolin, was concentrated in both renal and epididymal EGFP⁺ cells, in agreement with our previous reports showing high expression of this protein in clear cells (1) and intercalated cells (37), and its participation in the recycling of V-ATPase in clear cells (1). Pacsin 2, another actin cytoskeleton modulating protein, was enriched in renal EGFP⁺ cells. In addition to its role in actin dynamics, Pacsin 2 has recently been proposed to modulate the formation of microtubules (27). Similarly, Cdc42 and its downstream effector, Iqgap1, two proteins also involved in actin and microtubule remodeling, were enriched in the renal EGFP⁺ cells. The presence of Iqgap1 in these cells correlates with its colocalization with AE1 in the basolateral membrane of type A intercalated cells (36).

Active recycling of the V-ATPase is accompanied by marked alterations in the shape of renal type A intercalated cells and epididymal clear cells. Accumulation of the V-ATPase in their apical membrane correlates with extensive elongation of microvilli, which contain higher numbers of the pump, and increased proton secretion (11, 46, 55, 59). Interestingly, several proteins involved in membrane dynamics were detected in these cells. For example, prominin 1 and 2 were enriched in epididymal EGFP⁺ cells, and prominin 2 was enriched in renal EGFP⁺ cells. These proteins are cholesterol-binding proteins that participate in the formation of membrane protrusions (13, 23). Prominin 1 is highly expressed in the kidney and epididymis, where it is restricted to the apical membrane of epithelial cells (22, 24), while prominin 2 is present in both the apical and basolateral domains of MDCK cells (23). Interestingly, prominin 1 and 2 can be released into the extracellular space and are associated with membrane particles that are present in the urine, saliva, and seminal fluids (23, 38). The physiological role of these particles, referred to as “prominosomes,” has not been elucidated, but microvilli have been proposed to be at the origin of these prominosomes (23). In the epididymis, prominin 1 is a highly glycosylated protein that has been localized to the stereocilia of principal cells (22). In the present study, while prominin 1 was identified in the epididymal EGFP⁻ sample, which contains principal cells, we detected an enrichment of this protein in the EGFP⁺ population showing its expression in clear cells also. Several prominin 1 splice variants have been identified (22), and characterization of the splice variant(s) expressed in these cells will require further studies.

Renal intercalated cells and epididymal clear cells have a very high rate of endocytosis. While this process is partially due to the active recycling of the V-ATPase in these cells, clear cells were also proposed to help in clearing the luminal content of the epididymis of proteins that are shed from spermatozoa as they transit through this organ (28, 40). In agreement with this notion, Hdac6, a protein involved in fluid-phase endocytosis (26), was detected in these cells. In addition, the sperm surface protein, Crisp1, was enriched in the epididymal EGFP⁺ cells, while we have shown by RT-PCR that these cells do not express Crisp1 mRNA (data not shown). These data further support the notion that clear cells might contain “foreign” proteins that have been internalized for degradation.

While thousands of proteins were detected in renal and epididymal EGFP⁺ cells, only a few hundreds were shown to be concentrated in these cells compared with their respective EGFP⁻ samples. Among these proteins, only a few dozen were common to both EGFP⁺ preparations. This shows that while V-ATPase-rich cells of the kidney and epididymis do share a common function (transmembrane proton transport), they are nevertheless very distinct cells expressing specific sets of proteins. Interestingly, in addition to the proteins known to be expressed in these cells (V-ATPase, gelsolin, etc.), novel candidates were identified in this study that might play a role in their common acidifying function. These include the progesterone receptor, Pgrmc1, which is highly enriched in both renal and epididymal EGFP⁺ cells. The putative PKA-binding protein, Lrba, which participates in endosomal transport (19, 20, 60), is another potential candidate for the regulation of V-ATPase recycling in these cells. In addition, a protein involved in estradiol production, Hsd17b12 (4), was detected uniquely in the epididymal EGFP⁺ population. Epididymal epithelial cells express estrogen receptors and are regulated by estrogens in addition to androgens (29, 62). The present study thus points toward a potential role for clear cells in the hormonal regulation of the male reproductive tract. Interestingly, both of the ammonia-producing enzymes, glutaminase 1 and 2, were detected in renal EGFP⁺ cells. This might indicate the potential participation of intercalated cells or connecting tubule cells in the production of ammonia in the kidney, which is currently attributed to proximal tubules (35).

The proteins identified here will, therefore, constitute the targets for future studies on the regulation of the acidifying function, or other functions, of these cells. It has to be noted that while the LC-MS/MS approach is extremely useful to detect many proteins in a particular sample, some proteins remained undetected or their detection was below the level of confidence set during statistical analysis. This is the case for prominin 2, which was detected exclusively in the renal and epididymal EGFP⁺ cells and not in their respective EGFP⁻ samples, but was marked as “nonsignificant” in renal EGFP⁺ cells (see Table S1). Subsequent RT-PCR analysis correlated with the high expression of this protein in both renal and epididymal EGFP⁺ populations. On the other hand, our proteomic analysis was very accurate in determining whether or not a given protein was enriched in the EGFP⁺ cells compared with EGFP⁻ cells. For example, the drebrin-like protein, Dbnl, was detected in both renal and epididymal EGFP⁺ cells, but it was significantly enriched only in renal EGFP⁺ cells and not in epididymal EGFP⁺ cells. These results were confirmed by RT-PCR confirming the high accuracy of the χ²-analysis performed here.

In summary, while both renal intercalated cells and epididymal clear cells do share some common features and functions, including active proton transport, they are nevertheless very distinct cells that express individual sets of proteins. These cells have well-established roles in the maintenance of 1) systemic acid/base balance (intercalated cells) and 2) an acidic luminal environment that is essential for sperm maturation and viability in the epididymis (clear cells). This is reflected by their common expression of the V-ATPase, and proteins involved in cytoskeletal rearrangement (e.g., gelsolin). A novel common candidate for the regulation of these cells is the progesterone receptor, which was enriched in both cell populations. Further studies will be required to determine the role of progesterone in their regulation and, in particular, whether this hormone modulates V-ATPase-dependent proton secretion. In conclusion, we provide here the first comprehensive protein expression profiles of specialized V-ATPase-B1-expressing cells in the kidney and epididymis. These proteomic databases provide a unique framework for the future characterization of the common and distinct functions of these specialized acidifying cells.

GRANTS

This work was supported by National Institutes of Health Grants HD-40793 (to S. Breton), DK-38452 (to S. Breton and D. Brown), and DK-42956 (to D. Brown) as well as the intramural research budget of NHLBI Project HL-001285 (to M. A. Knepper). N. Da Silva was supported by a research career enhancement award from the American Physiological Society. The Microscopy Core facility of the MGH Program in Membrane Biology receives support from the Boston Area Diabetes and Endocrinology Research Center (DK-57521) and the Center for the Study of Inflammatory Bowel Disease (DK-43341).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.