Skip to main content
NCBI home page
Annals of Botany logoLink to Annals of Botany
. 2010 May 22;106(1):149–155. doi: 10.1093/aob/mcq094

Microsatellites reveal substantial among-population genetic differentiation and strong inbreeding in the relict fern Dryopteris aemula

Ares Jiménez 1,*, Rolf Holderegger 2, Daniela Csencsics 2, Luis G Quintanilla 1
PMCID: PMC2889802  PMID: 20495199

Abstract

Background and Aims

A previous study detected no allozyme diversity in Iberian populations of the buckler-fern Dryopteris aemula. The use of a more sensitive marker, such as microsatellites, was thus needed to reveal the genetic diversity, breeding system and spatial genetic structure of this species in natural populations.

Methods

Eight microsatellite loci for D. aemula were developed and their cross-amplification with other ferns was tested. Five polymorphic loci were used to characterize the amount and distribution of genetic diversity of D. aemula in three populations from the Iberian Peninsula and one population from the Azores.

Key Results

Most microsatellite markers developed were transferable to taxa close to D. aemula. Overall genetic variation was low (HT = 0·447), but was higher in the Azorean population than in the Iberian populations of this species. Among-population genetic differentiation was high (FST = 0·520). All loci strongly departed from Hardy–Weinberg equilibrium. In the population where genetic structure was studied, no spatial autocorrelation was found in any distance class.

Conclusions

The higher genetic diversity observed in the Azorean population studied suggested a possible refugium in this region from which mainland Europe has been recolonized after the Pleistocene glaciations. High among-population genetic differentiation indicated restricted gene flow (i.e. lack of spore exchange) across the highly fragmented area occupied by D. aemula. The deviations from Hardy–Weinberg equilibrium reflected strong inbreeding in D. aemula, a trait rarely observed in homosporous ferns. The absence of spatial genetic structure indicated effective spore dispersal over short distances. Additionally, the cross-amplification of some D. aemula microsatellites makes them suitable for use in other Dryopteris taxa.

Keywords: Cross-amplification, Dryopteris aemula, ferns, inbreeding, genetic bottleneck, glacial refugium, microsatellites, population differentiation, spatial genetic structure

INTRODUCTION

Microsatellites are tandem repeats of two to six nucleotides found in most nuclear genomes (Tautz, 1989; Chambers and MacAvoy, 2000). Since their discovery over three decades ago and with the rise of polymerase chain reaction (PCR) technology, microsatellite markers have progressively become the current molecular marker of choice for population genetic studies. Their popularity is based on their ubiquity across most organisms, their single-locus co-dominant inheritance, and their high variability resulting from high mutation rates (Tautz, 1989; Sunnucks, 2000; Selkoe and Toonen, 2006). Microsatellites are thus a valuable tool for detecting population genetic structure, evaluating genetic diversity, testing parentage relationships and interpreting recent population history (Zhang and Hewitt, 2003). The widespread use of microsatellites is, however, largely confined to vertebrates and seed plants; they remain largely unexploited in organisms such as lichens, algae, lycophytes and ferns.

Homosporous ferns have aroused the interest of researchers due to their capacity for long-distance dispersal and their exceptional life cycle. Their haploid spores germinate into potentially bisexual gametophytes, which are able to self-fertilize via intragametophytic selfing and to produce completely homozygous sporophytes. Intragametophytic selfing enables homosporous ferns to found new populations from a single spore. Although these populations harbour little genetic diversity during their first generations, recurrent wind dispersal of spores over long distances may lead to additional gene flow among populations. Fern populations are therefore viewed as exhibiting low genetic differentiation, with most variation being intrapopulational (Soltis and Soltis, 1989), in agreement with expectations for long-lived plant species with potential for long-range gene movement (Hamrick and Godt, 1989). Most genetic studies on ferns have used allozyme electrophoresis (Ranker and Geiger, 2008). However, the low allelic diversity usually found at allozyme loci limits their applicability in population genetic studies as compared with microsatellites (Estoup et al., 1998; Degen et al., 1999), especially in the case of recently founded or bottlenecked populations (Quintanilla et al., 2007). Recently, a few researchers have applied microsatellites to populations of ferns (Pryor et al., 2001; Vitalis et al., 2002; Woodhead et al., 2005; Kang et al., 2008) and demonstrated that these markers are useful for the characterization of genetic diversity and structure of populations of ferns.

Dryopteris aemula, a diploid buckler-fern, is considered to be a relict from the tropical flora that covered the Mediterranean area during the Tertiary (Pichi-Sermolli, 1979). Its present distribution comprises oceanic refugial areas along the coasts of western Europe, some islands of the Macaronesian archipelagos, north-eastern Turkey and south-western Transcaucasia. It is listed as a vulnerable species in Spain because of the rarity of its habitat, i.e. deciduous, temperate oceanic forests at low altitude close to the sea (Bañares et al., 2004). The production and response to antheridiogen, a pheromone released by female or hermaphrodite gametophytes promoting maleness in nearby asexual gametophytes, suggests that D. aemula may be mainly outbreeding (Jiménez et al., 2008). Additionally, a previous survey found no genetic variation at 13 allozyme loci in three populations spanning the distribution area of D. aemula in the Iberian Peninsula (Jiménez et al., 2009). Genetic bottlenecks and founder effects as the consequence of cycles of local extinction and recolonization from Macaronesian refugia during Pleistocene glaciations are a possible cause of the lack of allozyme diversity in the Iberian populations of this species. The use of more variable genetic markers is necessary to ascertain whether the lack of allozyme diversity in D. aemula is reflected in other genomic regions than the allozyme coding genes. The present study reports on eight newly developed nuclear microsatellite markers isolated from D. aemula and checks for their cross-amplification in other fern taxa including hybrids and polyploids incorporating the ‘aemula’ parental genome. Using five of these polymorphic microsatellite loci, the following hypotheses were then tested: (1) overall genetic variation is low, as indicated by allozymes, and higher in the Azores than in the Iberian Peninsula, because this archipelago acted as a refugium during glaciations; (2) among-population genetic differentiation is low due to long-distance gene flow via spore dispersal; (3) genotype frequencies within populations are in Hardy–Weinberg equilibrium, as a consequence of antheridiogen-mediated outcrossing; and (4) genetic variation within populations is not spatially structured because of effective spore dispersal and outcrossing.

MATERIALS AND METHODS

Sampling design

Four Dryopteris aemula (Ait.) Kuntze populations were sampled, three in the northern Iberian Peninsula (SAN, MUT and EUM), and a fourth in São Miguel Island, Azores (AZO, Table 1). Individuals were randomly sampled in all populations except in EUM, which was selected to study the spatial genetic structure within a population. Here, all individuals present along a 30 × 6-m transect were sampled, and the position of each individual was mapped. One or two pinnules per individual were collected and directly dried in silica-gel until DNA extraction.

Table 1.

Populations studied with five microsatellite loci in Dryopteris aemula

Acronym Locality Latitude (N) Longitude (W) Altitude (m a.s.l.) Number of individuals
SAN Spain, Asturias, Santianes del Agua 43°25′ 5°20′ 50 49
MUT Spain, Gipuzkoa, Mutriku 43°18′ 2°24′ 90 50
EUM Spain, A Coruña, Fragas do Eume 43°23′ 8°00′ 350 74
AZO Portugal, Azores, São Miguel Island 37°48′ 25°14′ 950 56
Open in a new tab

Microsatellite development and genotyping

DNA was extracted with the DNeasy 96 Plant Kit (Qiagen, Hilden, Germany). Genomic DNA of one D. aemula individual sampled from SAN was used by Ecogenics (Zurich, Switzerland) to make an enriched library from size-selected genomic DNA ligated into TspADshort/TspADlong-linker (Armour et al., 1994) and enriched by magnetic bead selection with biotin-labelled (GT)13, (CT)13, (AAG)10 and (TAC)10 oligonucleotide repeats (Gautschi et al., 2000a, b). Of 378 recombinant colonies screened, 59 gave positive signals after hybridization. Plasmids from these 59 positive clones were sequenced and primers were designed for 18 microsatellite inserts with primer3 (Rozen and Skaletsky, 2000). Eight consistently amplifying microsatellite loci (Dae04, Dae05, Dae06, Dae07, Dae09-1, Dae09-2, Dae11 and Dae15; Table 2) were tested for cross-amplification in 13 Dryopteris species and hybrids of various ploidy levels (D. oligodonta, D. oreades, D. affinis subsp. affinis, D. carthusiana, D. corleyi, D. crispifolia, D. dilatata, D. filix-mas, D. guanchica, D. × arecesiae, D. × asturiensis, D. × fraser-jenkinsii, D. × madalenae), three other Dryopteridaceae species (Polystichum lonchitis, P. setiferum and P. aculeatum) and two Woodsiaceae species (Gymnocarpium dryopteris and Athyrium filix-femina). Five of these loci (Dae06, Dae07, Dae09-2, Dae11 and Dae15) were finally used to genotype all D. aemula individuals sampled. As primer pair Dae09 seemed to amplify two loci, with two distinct amplification products consistently appearing 7–39 bp apart, the presence of an AG microsatellite in Dae09-2 was proven by sequencing of PCR products cut from 2 % agarose gels using the BigDye® Terminator v3·1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA).

Table 2.

Characterization of eight microsatellites for Dryopteris aemula

Locus GenBank accession number Repeat motif Size range (bp) Primer sequences (5′–3') Ta (°C)
Dae04 FJ455846 (AAG)16 111 F: GCCTCCTTGAAGGTCTACCC 56
R: CCCCCGGAAAAGAGTGTATG
Dae05 FJ554839 (CTT)8 (CTA) (CCT) (CTT)3 102–108 F: ATGGTCACCTTCGACCTTTG 59
R: TAACCGACCATGAGTCCTTG
Dae06 FJ455847 (TC)21 107–117 F: TGGCAAAAATAGAGAGAGGCAAC 59
R: ATCAGGCGGCCAGTAGGAG
Dae07 FJ455848 (TG)22 77–101 F: GTACTACGCGCGCCACAAG 59
R: CGTGAGCTTCTGTGAAGAGC
Dae09-1 FJ455849 (AG)13 95–97 F: CTTTGCAGGCGGCATAGC 56
R: AGTTGACAAGAACTACTCGGATGC
Dae09-2 FJ455849 (AG)26 102–134 F: CTTTGCAGGCGGCATAGC 56
R: AGTTGACAAGAACTACTCGGATGC
Dae11 FJ455850 (AG)21 151–157 F: TCAACTCCTTGTAAGCCCAAG 56
R: CCGTGGACGGTAATAAACTACTC
Dae15 FJ455851 (AG)27 106–140 F: TATGTTGGTCTTGCGTGTGC 62
R: AAACCATCAGTAGCCTCGACA
Open in a new tab

GenBank accession number, repeat motif, size range in base pairs, annealing temperature (Ta), and forward (F) and reverse primer (R) sequences are given for each locus.

Forward primers of each primer pair were labelled with a fluorescent dye (6FAM, NED, PET or VIC; Applied Biosystems). Multiplexed PCR amplifications were performed with 20–40 ng of genomic DNA using the Multiplex PCR kit (Qiagen) in final reaction volumes of 10 µL. PCR profiles consisted of 15 min of initial denaturation at 95 °C, followed by 30 cycles of 94 °C for 30 s, 56–62 °C (depending on primer pair; Table 2) for 90 s and 72 °C for 60 s, and a final elongation step at 72 °C for 30 min. PCR products were separated on an ABI 3130 Avant Automated Sequencer (Applied Biosystems), and fragment sizes were determined with genemapper 3·7 (Applied Biosystems) using the internal size standards 400HD ROX™ for primer pair Dae15 and 500 LIZ® (Applied Biosystems) for all other primer pairs.

Statistical analyses

Levels of genetic diversity were assessed based on the average number of alleles per locus (A) and, to allow comparison with allozyme studies, overall total heterozygosity (HT). Genetic differentiation among populations was assessed with FST (Weir and Cockerham, 1984). Population structure was also studied by estimating RST, an analogue of FST developed for microsatellite loci mutating under the stepwise mutation model (Slatkin, 1995). The number of reproductively successful migrants per generation (Nm) was estimated using the private allele method (Barton and Slatkin, 1986). The observed heterozygosity (Ho), expected heterozygosity (He) under Hardy–Weinberg equilibrium, and Wright's (1943) fixation index F = 1 – Ho/He were calculated for each locus in each population. Concordance of genotype frequencies with Hardy–Weinberg equilibrium was tested using chi-squared tests. Linkage disequilibrium was tested among all pairs of loci and its significance was determined after applying sequential Bonferroni correction (Rice, 1989). All statistics except HT and RST were estimated with genepop 4·0 (Rousset, 2008). HT was calculated according to Nei (1973), and RST was estimated with fstat 2.9.3.2 (Goudet, 2002). The spatial autocorrelation of genotypes in population EUM was explored using Moran's I in sgs (1000 permutations; Degen et al., 2001) taking into consideration the four loci polymorphic in this population and ten distance classes of 3 m width between 0 and 30 m.

RESULTS

Microsatellite development and cross-taxa amplification

Of the 18 primer pairs tested in D. aemula, seven failed to amplify the target microsatellites and four amplified several fragments, whereas seven amplified products consistently amenable to interpretation. One of these primer pairs (Dae04) amplified monomorphic products, whereas the other six (Dae05, Dae06, Dae07, Dae09, Dae11 and Dae15) amplified polymorphic products (Table 2). Primer pair Dae09 amplified two microsatellite loci (Dae09-1 and Dae09-2), which showed fragments varying in size according to an AG-microsatellite.

Transferability to other Dryopteris species and hybrids, especially those including an ‘aemula’ parental genome, was feasible for most microsatellites isolated from D. aemula (see Supplementary Data Table S1, available online). Transferability to Polystichum species was limited and there was no cross-amplification to Gymnocarpium or Athyrium. Locus Dae04, which was monomorphic in D. aemula, showed polymorphisms in other species.

Overall genetic variation

Total genetic variation considering all loci was HT = 0·447. Overall, the Azorean population (AZO) showed a higher microsatellite variation than the three Iberian populations (EUM, MUT and SAN (Supplementary Data Table S2). The mean number of alleles per locus (A) in AZO, EUM, MUT and SAN was 5·0, 2·6, 2·2 and 2·0, respectively, with an average of 3·0. In these populations, the number of private alleles was 13, one, three and two, respectively.

Among-population genetic structure

Genetic differentiation was high (FST = 0·520), and the value of RST (0·409) was lower than that of FST, although still high. In consequence, the estimated number of migrants per generation was low (Nm = 0·25).

Hardy–Weinberg equilibrium and linkage disequilibrium

All loci significantly departed from Hardy–Weinberg equilibrium in all populations, exhibiting a remarkable deficit of heterozygotes as shown by the positive fixation indexes (F), which ranged from 0·650 to 1·000 (Table 3) and had a value of 0·855 averaged over all loci and populations. Loci pairs Dae09-2/Dae11 and Dae11/Dae15 were in linkage disequilibrium (P < 0·05 after sequential Bonferroni correction) in some but not all populations: loci Dae09-2 and Dae11 were linked in SAN, and loci Dae11 and Dae15 were linked in SAN and MUT.

Table 3.

Observed (Ho) and expected (He) heterozygosity as well as fixation index (F) for four Dryopteris aemula populations from the Iberian Peninsula (SAN, MUT, EUM) and Azores (AZO)

Population Locus Ho He F
SAN Dae06 0 0 –
Dae07 0 0 –
Dae09-2 0·122 0·95 0·795***
Dae11 0·061 0·414 0·853***
Dae15 0·102 0·484 0·789***
MUT Dae06 0 0 –
Dae07 0 0·04 1·000***
Dae09-2 0 0 –
Dae11 0·02 0·134 0·851***
Dae15 0·02 0·170 0·882***
EUM Dae06 0·27 0·153 0·824***
Dae07 0·014 0·040 0·650***
Dae09-2 0 0 –
Dae11 0 0·027 1·000***
Dae15 0·054 0·581 0·907***
AZO Dae06 0·071 0·385 0·816***
Dae07 0·089 0·604 0·853***
Dae09-2 0·054 0·444 0·878***
Dae11 0·089 0·400 0·778***
Dae15 0·018 0·336 0·946***
Open in a new tab

Asterisks indicate significant deviation from Hardy–Weinberg equilibrium; a dash indicates the locus is monomorphic within a population.

Within-population genetic structure

In population EUM, all values of mean Moran's I per distance class fell within the confidence interval of the correlogram, indicating no significant spatial autocorrelation at any distance class. Hence, there was no spatial genetic structure within this population.

DISCUSSION

Microsatellite development and cross-taxa amplification

Only seven of 18 originally designed primer pairs for D. aemula consistently amplified interpretable products, a result comparable to the attrition rates reported by Squirrell et al. (2003) for primer optimization steps. Primer pair Dae09 amplified two putatively independent loci, Dae09-1 and Dae09-2, and it appeared that Dae09-2 was a duplicated locus. This locus duplication was probably a consequence of repeated polyploidization and gene silencing cycles in the evolution of genus Dryopteris, as reported formerly for many ferns (Nakazato et al., 2008).

The microsatellite loci developed for D. aemula were largely transferable to other species and hybrids of the genus and, to some extent, to other Dryopteridaceae. Product amplifications were more successful in taxa which incorporated at least one ‘aemula’ parental genome, indicating that the flanking regions of these microsatellites were largely conserved. The microsatellites presented herein thus have the potential to be succesfully used in taxa that are phylogenetically close to D. aemula.

Overall genetic variation

In agreement with our first hypothesis, total genetic variation was low (HT = 0·447). Even if the value of HT is similar to those reported for ferns in allozyme studies (Gitzendanner and Soltis, 2000), microsatellites are likely to show much higher values due to their high allelic variability (Hedrick, 1999; Woodhead et al., 2005). In the Iberian populations, the maximum number of microsatellite alleles per locus was four (Supplementary Data Table S2), which indicates an overall low genetic diversity as compared with other microsatellite-based studies on species with restricted and scattered distribution ranges (Salgueiro et al., 2003; Mitrovski et al., 2007; Kang et al., 2008). Population AZO showed a maximum of seven microsatellite alleles per locus and was polymorphic for all five microsatellite loci studied, whereas populations SAN, MUT, and EUM were polymorphic for only a portion of them. In addition, the number and proportion of private alleles in population AZO was also larger than in the Iberian populations, and a large number of the alleles present in the Iberian populations were shared with population AZO (Supplementary Data Table S2). These results generally reinforce the hypothesis of a strong genetic bottleneck in the Iberian populations of D. aemula due to a recent founder effect, as suggested by the absence of allozyme diversity of this species in the Iberian Peninsula (Jiménez et al., 2009). Rather than the persistence of D. aemula in Iberian refugia during Pleistocene glaciations (Hewitt, 1996; Quintanilla et al., 2007), the higher genetic diversity of population AZO suggests that the Macaronesian archipelagos acted as a glacial refugium from which D. aemula spread and recolonized mainland Europe. This hypothesis is not only congruent with the higher genetic diversity of population AZO and with the fact that a high proportion of the alleles were shared among Azorean and Iberian populations, but also with the finding that the identity of the most frequent allele differed among Iberian populations for loci Dae09-2, Dae11 and Dae15, as expected under a scenario of repeated but independent colonization events (Schneller and Holderegger, 1996).

Among-population genetic structure

In marked disagreement with our second hypothesis, among-population genetic differentiation was very high, as shown by the values of both FST and RST (0·520 and 0·409, respectively). Population differentiation is intimately linked to the frequency and magnitude of gene flow among populations (Loveless and Hamrick, 1984), which, in ferns, takes place in the form of spore dispersal. Homosporous ferns have remarkable potential for long-distance dispersal and colonization, as illustrated by the fact that they are an important component of oceanic island floras (Muñoz et al., 2004; Ranker and Geiger, 2008) and by their low among-population variation in both genetic and phenotypic markers (Sciarretta et al., 2005; Schneller and Liebst, 2007). Given the high microsatellite differentiation among the four D. aemula populations studied, the corresponding number of migrants per generation is low (Nm = 0·25). Theory predicts that, in the long run, a migration rate of 1·0 is generally needed to offset drift-mediated population differentiation (Spieth, 1974), and empirical studies suggest that even higher values of Nm are necessary to counteract drift (Lacy, 1987; Mills and Allendorf, 1996).

High population differentiation is well in agreement with the above presented colonization scenario of D. aemula on the Iberian Peninsula. However, other studies on ferns attributed high genetic population differentiation to the action of inbreeding. Substantial genetic differentiation among homosporous fern populations has, for instance, been observed in Alsophila spinulosa (Su et al., 2004), which has functionally bisexual, self-fertilizing gametophytes, as well as in the polyploid taxa Asplenium septentrionale, A. ruta-muraria and Polypodium vulgare (Schneller and Holderegger, 1996), which are expected to self-fertilize due to polyploidy. Therefore, inbreeding (see below) might have contributed to high genetic population differentiation in D. aemula.

Hardy–Weinberg equilibrium and linkage disequilibrium

Our third hypothesis, that populations of D. aemula are in Hardy–Weinberg equilibrium, can be rejected. All loci departed from Hardy–Weinberg equilibrium in all populations and inbreeding coefficients were high, exhibiting heterozygote deficits. Several factors such as allelic dropout or null alleles can bias results obtained with microsatellites towards the inference of homozygous genotypes (Selkoe and Toonen, 2006). However, the substantial deviation from Hardy–Weinberg equilibrium found in D. aemula across loci and populations indicated rather that our results most likely point to inbreeding. In addition, the linkage disequilibrium detected may also be a consequence of successive generations of inbreeding, which lead to the fixation of different multilocus genotypes within populations (Loveless and Hamrick, 1984).

The marked tendency to inbreeding observed in natural populations of D. aemula contrasts with the high outbreeding rates displayed by most diploid ferns (Ranker and Geiger, 2008), and also with the substantial tendency to outcrossing shown by other diploid Dryopteris species such as D. oreades (Jiménez et al., 2008). The inbreeding coefficient detected in D. aemula (F = 0·855) approaches those found in Botrychium species, which have subterranean gametophytes that obligately self-fertilize via intragametophytic selfing (McCauley et al., 1985; Hauk and Haufler, 1999). Female gametophytes of D. aemula and other Dryopteris species produce antheridiogens that inhibit growth and favour maleness both within and among species (Jiménez et al., 2008). Most authors consider that antheridiogens promote outcrossing as they increase the probability of cross-fertilization between adjacent gametophytes by facilitating dioecy (e.g. Haig and Westoby, 1988; Hamilton and Lloyd, 1991). Reduction of intragametophytic selfing due to antheridiogens may confer a strong fitness advantage, given that zygotes produced by this breeding system are homozygous at all loci and, consequently, all deleterious recessive alleles are expressed. The present results are not consistent with this adaptive interpretation of antheridiogens, as D. aemula is mostly inbreeding. They are, instead, compatible with an alternative hypothesis of Willson (1981), who proposed that antheridiogens are allelopathic substances secreted by females to stunt the growth of unrelated individuals. This interpretation, which considers antheridiogens as a mechanism for competition among gametophytes, holds for both outbreeding and inbreeding species.

Within-population genetic structure

In agreement with our fourth hypothesis, no significant spatial structure of genetic variation was observed in population EUM. However, this result conflicts with the results for highly inbred populations, which often present genetically structured populations (Loveless and Hamrick, 1984; Soltis et al., 1989). In ferns, within-population genetic structure has been found both in inbreeding (e.g. Asplenium trichomanes subsp. quadrivalens; Suter et al., 2000) and in outbreeding taxa (e.g. Cheilanthes gracillima; Soltis et al., 1989). Spore dispersal ability and other ecological factors may be more important than breeding system in determining the genetic structure of fern populations (Cousens et al., 1988; Soltis et al., 1989; Pryor et al., 2001). The lack of genetic structure in the studied D. aemula populations suggests that in its habitat, i.e. deciduous forest understorey, microsites suitable for spore germination and gametophyte development are randomly distributed in space, and that there is effective mixing of selfed genotypes by spore dispersal. Regardless, we cannot completely rule out the possibility that the absence of spatial genetic structure in population EUM is partly a consequence of using microsatellites, as high mutation rates can reduce the estimates of spatial structure in populations (Epperson, 2005).

CONCLUSIONS

Microsatellites revealed low levels of genetic diversity in D. aemula, as often observed in bottlenecked populations. Iberian populations harboured a lower number of alleles across loci than the Macaronesian population studied, which may be a consequence of post-glacial long-distance founder effects. Restricted gene flow among populations within the scattered distribution of D. aemula on the Iberian Peninsula maintained a strong genetic differentiation among populations, an effect reinforced by high inbreeding in this fern. Inbreeding is inferred from the substantial heterozygote deficits. This finding suggests that the ultimate role of the antheridiogen pheromone is not the promotion of outcrossing but competition avoidance via growth inhibition in nearby individuals. Homogeneity of habitats as well as effective spore dispersal over smaller distances caused, in spite of inbreeding, a lack of spatial genetic structure within a population of D. aemula.

The microsatellite loci reported here can potentially be used to design conservation strategies for the endangered D. aemula, to evaluate genetic diversity in other Dryopteris species or to clarify parental identities among diploid and polyploid members of this genus. Given the advantages of using microsatellites, we believe that this marker type will help in understanding the importance of evolutionary factors shaping population genetic variation and structure in ferns and other groups of organisms.

SUPPLEMENTARY INFORMATION

Supplementary data are available online at www.aob.oxfordjournals.org and consist of two tables. Table S1 shows the cross-amplification and fragment size of D. aemula microsatellites in 18 other fern taxa and hybrids. Table S2 shows the allele frequencies of five microsatellite loci in four D. aemula populations from the Iberian Peninsula and Azores.

Supplementary Material

[Supplementary Data]
mcq094_index.html (814B, html)

ACKNOWLEDGEMENTS

We thank U. Landergott for useful guidelines on primer design, S. Brodbeck, C. Cornejo and I. Widmer for help in the laboratory, J. Ramos and D. Sastre for help during fieldwork, and F. Maestre for statistical advice. This research was supported by the Spanish Ministry of Education and Science (project CGL2006-07012) and the Xunta de Galicia (contract 215/2006).

LITERATURE CITED

  1. Armour JA, Neumann R, Gobert S, Jeffreys AJ. Isolation of human simple repeat loci by hybridization selection. Human Molecular Genetics. 1994;3:599–605. doi: 10.1093/hmg/3.4.599. [DOI] [PubMed] [Google Scholar]
  2. Bañares A, Blanca G, Güemes J, Moreno JC, Ortiz S. Atlas y Libro Rojo de la Flora Vascular Amenazada de España. Madrid: Dirección General de Conservación de la Naturaleza; 2004. [Google Scholar]
  3. Barton NH, Slatkin M. A quasi-equilibrium theory of the distribution of rare alleles in a subdivided population. Heredity. 1986;56:409–415. doi: 10.1038/hdy.1986.63. [DOI] [PubMed] [Google Scholar]
  4. Chambers GK, MacAvoy ES. Microsatellites: consensus and controversy. Comparative Biochemistry and Physiology B. 2000;126:455–476. doi: 10.1016/s0305-0491(00)00233-9. [DOI] [PubMed] [Google Scholar]
  5. Cousens MI, Lacey DG, Schneller JM. Safe sites and the ecological life history of Lorinseria areolata. American Journal of Botany. 1988;75:797–807. [Google Scholar]
  6. Degen B, Streiff R, Ziegenhagen B. Comparative study of genetic variation and differentiation of two pedunculate oak (Quercus robur) stands using microsatellite and allozymic loci. Heredity. 1999;83:597–603. doi: 10.1038/sj.hdy.6886220. [DOI] [PubMed] [Google Scholar]
  7. Degen B, Petit R, Kremer A. SGS – spatial genetic software: a computer program for analysis of spatial genetics and phenotypic structures of individuals and populations. Journal of Heredity. 2001;92:447–448. doi: 10.1093/jhered/92.5.447. [DOI] [PubMed] [Google Scholar]
  8. Epperson BK. Mutation at high rates reduces spatial structure within populations. Molecular Ecology. 2005;14:703–710. doi: 10.1111/j.1365-294X.2005.02429.x. [DOI] [PubMed] [Google Scholar]
  9. Estoup A, Rousset F, Michalakis Y, Cornuet J-M, Adriamanga M, Guyomard R. Comparative analysis of microsatellite and allozyme markers: a case study investigating microgeographic differentiation in brown trout (Salmo trutta) Molecular Ecology. 1998;7:339–353. doi: 10.1046/j.1365-294x.1998.00362.x. [DOI] [PubMed] [Google Scholar]
  10. Gautschi B, Tenzer I, Müller JP, Schmid B. Isolation and characterization of microsatellite loci in the bearded vulture (Gypaetus barbatus) and cross-amplification in three Old World vulture species. Molecular Ecology. 2000a;9:2193–2195. doi: 10.1046/j.1365-294x.2000.105321.x. [DOI] [PubMed] [Google Scholar]
  11. Gautschi B, Widmer A, Koella J. Isolation and characterization of microsatellite loci in the dice snake (Natrix tessellata) Molecular Ecology. 2000b;9:2191–2193. [PubMed] [Google Scholar]
  12. Gitzendanner MA, Soltis PS. Patterns of genetic variation in rare and widespread plant congeners. American Journal of Botany. 2000;87:783–792. [PubMed] [Google Scholar]
  13. Goudet J. FSTAT, a program to estimate and test gene diversities and fixation indices, version 2.9.3.2. 2002 Available from: http://www2.unil.ch/popgen/softwares/fstat.htm . [Google Scholar]
  14. Haig D, Westoby M. Sex expression in homosporous ferns: an evolutionary perspective. Evolutionary Trends in Plants. 1988;2:111–119. [Google Scholar]
  15. Hamilton RG, Lloyd RM. Antheridiogen in the wild: the development of fern gametophyte communities. Functional Ecology. 1991;5:804–809. [Google Scholar]
  16. Hamrick JL, Godt MJW. Allozyme diversity in plant species. In: Brown AHD, Clegg MT, Kahler AL, Weir BS, editors. Plant population genetics, breeding and genetic resources. Sunderland, MA: Sinauer Associates; 1989. pp. 42–46. [Google Scholar]
  17. Hauk WD, Haufler CH. Isozyme variability among cryptic species of Botrychium subgenus Botrychium (Ophioglossaceae) American Journal of Botany. 1999;86:614–633. [PubMed] [Google Scholar]
  18. Hedrick PW. Highly variable loci and their interpretation in evolution and conservation. Evolution. 1999;53:313–318. doi: 10.1111/j.1558-5646.1999.tb03767.x. [DOI] [PubMed] [Google Scholar]
  19. Hewitt GM. Some genetic consequences of ice ages, and their role in divergence and speciation. Biological Journal of the Linnean Society. 1996;58:247–276. [Google Scholar]
  20. Jiménez A, Quintanilla LG, Pajarón S, Pangua E. Reproductive and competitive interactions among gametophytes of the allotetraploid fern Dryopteris corleyi and its two diploid parents. Annals of Botany. 2008;102:353–359. doi: 10.1093/aob/mcn099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jiménez A, Quintanilla LG, Pajarón S, Pangua E. Genetic variation in the allotetraploid Dryopteris corleyi and its diploid parental species in the Iberian Peninsula. American Journal of Botany. 2009;96:1880–1886. doi: 10.3732/ajb.0900055. [DOI] [PubMed] [Google Scholar]
  22. Kang M, Huang H, Jiang M, Lowe AJ. Understanding population structure and historical demography in a conservation context: population genetics of an endangered fern. Diversity and Distributions. 2008;14:799–807. [Google Scholar]
  23. Lacy RC. Loss of genetic diversity from managed populations: interacting effects of drift, mutation, immigration, selection, and population subdivision. Conservation Biology. 1987;1:143–158. [Google Scholar]
  24. Loveless MD, Hamrick JL. Ecological determinants of genetic structure in plant populations. Annual Review of Ecology and Systematics. 1984;15:65–95. [Google Scholar]
  25. McCauley DE, Whittier DP, Reilly LM. Inbreeding and the rate of self-fertilization in a grape fern, Botrychium dissectum. American Journal of Botany. 1985;72:1978–1981. [Google Scholar]
  26. Mills LS, Allendorf FW. The one-migrant-per-generation rule in conservation and management. Conservation Biology. 1996;10:1509–1518. [Google Scholar]
  27. Mitrovski P, Heinze DA, Broome L, Hoffmann AA, Weeks AR. High levels of variation despite genetic fragmentation in populations of the endangered mountain pygmy-possum, Burramys parvus, in alpine Australia. Molecular Ecology. 2007;16:75–87. doi: 10.1111/j.1365-294X.2006.03125.x. [DOI] [PubMed] [Google Scholar]
  28. Muñoz J, Felicísimo AM, Cabezas F, Burgaz AR, Martínez I. Wind as a long-distance dispersal vehicle in the Southern Hemisphere. Science. 2004;304:1144–1147. doi: 10.1126/science.1095210. [DOI] [PubMed] [Google Scholar]
  29. Nakazato T, Barker MS, Rieseberg LH, Gastony GJ. Evolution of the nuclear genome of ferns and lycophytes. In: Ranker RA, Haufler CH, editors. Biology and evolution of ferns and lycophytes. Cambridge: Cambridge University Press; 2008. pp. 175–198. [Google Scholar]
  30. Nei M. Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences USA. 1973;70:3321–3323. doi: 10.1073/pnas.70.12.3321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Pichi-Sermolli REG. A survey of the pteridological flora of the Mediterranean Region. Webbia. 1979;34:175–242. [Google Scholar]
  32. Pryor KV, Young JE, Rumsey FJ, Edwards KJ, Bruford MW, Rogers HJ. Diversity, genetic structure and evidence of outcrossing in British populations of the rock fern Adiantum capillus-veneris using microsatellites. Molecular Ecology. 2001;10:1881–1894. doi: 10.1046/j.1365-294x.2001.01343.x. [DOI] [PubMed] [Google Scholar]
  33. Quintanilla LG, Pajarón S, Pangua E, Amigo J. Allozyme variation in the sympatric ferns Culcita macrocarpa and Woodwardia radicans at the northern extreme of their ranges. Plant Systematics and Evolution. 2007;263:135–144. [Google Scholar]
  34. Ranker TA, Geiger JMO. Population genetics. In: Ranker RA, Haufler CH, editors. Biology and evolution of ferns and lycophytes. Cambridge: Cambridge University Press; 2008. pp. 175–198. [Google Scholar]
  35. Rice WR. Analyzing tables of statistical tests. Evolution. 1989;43:223–225. doi: 10.1111/j.1558-5646.1989.tb04220.x. [DOI] [PubMed] [Google Scholar]
  36. Rousset F. Genepop'007: a complete reimplementation of the Genepop software for Windows and Linux. Molecular Ecology Resources. 2008;8:103–106. doi: 10.1111/j.1471-8286.2007.01931.x. [DOI] [PubMed] [Google Scholar]
  37. Rozen S, Skaletsky HJ. Primer3 on the www for general users, for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular miology. Totowa, NJ: Humana Press; 2000. pp. 365–386. [DOI] [PubMed] [Google Scholar]
  38. Salgueiro P, Carvalho G, Collares-Pereira MJ, Coelho MM. Microsatellite analysis of genetic population structure of the endangered cyprinid Anaecypris hispanica in Portugal: implications for conservation. Biological Conservation. 2003;109:47–56. [Google Scholar]
  39. Schneller JJ, Holderegger R. Genetic variation in small, isolated fern populations. Journal of Vegetation Science. 1996;7:113–120. [Google Scholar]
  40. Schneller JJ, Liebst B. Patterns of variation of a common fern (Athyrium filix-femina; Woodsiaceae): population structure along and between altitudinal gradients. American Journal of Botany. 2007;94:965–971. doi: 10.3732/ajb.94.6.965. [DOI] [PubMed] [Google Scholar]
  41. Sciarretta KL, Arbuckle EP, Haufler CH, Werth CR. Patterns of genetic variation in southern Appalachian populations of Athyrium filix-femina var. asplenoides (Dryopteridaceae) International Journal of Plant Sciences. 2005;166:761–780. [Google Scholar]
  42. Selkoe KA, Toonen RJ. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecology Letters. 2006;9:615–629. doi: 10.1111/j.1461-0248.2006.00889.x. [DOI] [PubMed] [Google Scholar]
  43. Slatkin M. A measure of population subdivision based on microsatellite allele frequencies. Genetics. 1995;139:457–462. doi: 10.1093/genetics/139.1.457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Soltis DE, Soltis PS. Polyploidy, breeding system, and genetic differentiation in homosporous pteridophytes. In: Soltis DE, Soltis PS, editors. Isozymes in plant biology. Portland, OR: Dioscorides Press; 1989. pp. 241–258. [Google Scholar]
  45. Soltis PS, Soltis DE, Ness BD. Population genetic structure in Cheilanthes gracillima. American Journal of Botany. 1989;76:1114–1118. [Google Scholar]
  46. Spieth PT. Gene flow and genetic differentiation. Genetics. 1974;78:961–965. doi: 10.1093/genetics/78.3.961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Squirrell J, Hollingsworth PM, Woodhead M, et al. How much effort is required to isolate nuclear microsatellites from plants? Molecular Ecology. 2003;12:1339–1348. doi: 10.1046/j.1365-294x.2003.01825.x. [DOI] [PubMed] [Google Scholar]
  48. Su Y, Wang T, Zheng B, Jiang Y, Chen G, Gu H. Population genetic structure and phylogeographical pattern of a relict tree fern, Alsophila spinulosa (Cyatheaceae), inferred from cpDNA atpB-rbcL intergenic spacers. Theoretical and Applied Genetics. 2004;109:1459–1467. doi: 10.1007/s00122-004-1761-2. [DOI] [PubMed] [Google Scholar]
  49. Sunnucks P. Efficient genetic markers for population biology. Trends in Ecology and Evolution. 2000;15:199–203. doi: 10.1016/s0169-5347(00)01825-5. [DOI] [PubMed] [Google Scholar]
  50. Suter M, Schneller JJ, Vogel JC. Investigations into the genetic variation, population structure, and breeding systems of the fern Asplenium trichomanes subsp. quadrivalens. International Journal of Plant Sciences. 2000;161:233–244. doi: 10.1086/314258. [DOI] [PubMed] [Google Scholar]
  51. Tautz D. Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Research. 1989;17:6463–6471. doi: 10.1093/nar/17.16.6463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Vitalis R, Riba M, Colas B, Grillas P, Olivieri I. Multilocus genetic structure at contrasted spatial scales of the endangered water fern Marsilea strigosa Willd. (Marsileaceae, Pteridophyta) American Journal of Botany. 2002;89:1142–1155. doi: 10.3732/ajb.89.7.1142. [DOI] [PubMed] [Google Scholar]
  53. Weir BS, Cockerham CC. Estimating F-statistics for the analysis of population structure. Evolution. 1984;38:1358–1370. doi: 10.1111/j.1558-5646.1984.tb05657.x. [DOI] [PubMed] [Google Scholar]
  54. Willson MF. Sex expression in fern gametophytes: some evolutionary possibilities. Journal of Theoretical Biology. 1981;93:403–409. [Google Scholar]
  55. Woodhead M, Russell J, Squirrell J, et al. Comparative analysis of population genetic structure in Athyrium distentifolium (Pteridophyta) using AFLPs and SSRs from anonymous and transcribed gene regions. Molecular Ecology. 2005;14:1681–1695. doi: 10.1111/j.1365-294X.2005.02543.x. [DOI] [PubMed] [Google Scholar]
  56. Wright S. Isolation by distance. Genetics. 1943;28:114–138. doi: 10.1093/genetics/28.2.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Zhang DX, Hewitt GM. Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects. Molecular Ecology. 2003;12:563–584. doi: 10.1046/j.1365-294x.2003.01773.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplementary Data]
mcq094_index.html (814B, html)
mcq094_1.pdf (155.7KB, pdf)

Articles from Annals of Botany are provided here courtesy of Oxford University Press

RESOURCES