Skip to main content
BMC Microbiology logoLink to BMC Microbiology
. 2010 Jun 4;10:164. doi: 10.1186/1471-2180-10-164

Identification of a novel anti-σE factor in Neisseria meningitidis

Carla Th P Hopman 1, Dave Speijer 2, Arie van der Ende 1, Yvonne Pannekoek 1,✉
PMCID: PMC2893595  PMID: 20525335

Abstract

Background

Fine tuning expression of genes is a prerequisite for the strictly human pathogen Neisseria meningitidis to survive hostile growth conditions and establish disease. Many bacterial species respond to stress by using alternative σ factors which, in complex with RNA polymerase holoenzyme, recognize specific promoter determinants. σE, encoded by rpoE (NMB2144) in meningococci, is known to be essential in mounting responses to environmental challenges in many pathogens. Here we identified genes belonging to the σE regulon of meningococci.

Results

We show that meningococcal σE is part of the polycistronic operon NMB2140-NMB2145 and autoregulated. In addition we demonstrate that σE controls expression of methionine sulfoxide reductase (MsrA/MsrB). Moreover, we provide evidence that the activity of σE is under control of NMB2145, directly downstream of rpoE. The protein encoded by NMB2145 is structurally related to anti-sigma domain (ASD) proteins and characterized by a zinc containing anti-σ factor (ZAS) motif, a hall mark of a specific class of Zn2+-binding ASD proteins acting as anti-σ factors. We demonstrate that Cys residues in ZAS, as well as the Cys residue on position 4, are essential for anti-σE activity of NMB2145, as found for a minority of members of the ZAS family that are predicted to act in the cytoplasm and responding to oxidative stimuli. However, exposure of cells to oxidative stimuli did not result in altered expression of σE.

Conclusions

Together, our results demonstrate that meningococci express a functional transcriptionally autoregulated σE factor, the activity of which is controlled by a novel meningococcal anti-σ factor belonging to the ZAS family.

Background

RNA polymerase holoenzyme, consisting of a 5-subunit core RNA polymerase (α2ββ'ω) and a dissociable subunit, sigma (σ), initiates bacterial transcription. The σ factor contains many of the promoter recognition determinants and several σ factors each recognizing their specific class of promoter sequences have been described [1-5]. In general, in exponentially growing bacteria transcription is initiated by RNA polymerase carrying the housekeeping σ, known as σ70 [6]. Alternative σ factors mediate transcription of regulons activated under specific environmental conditions [7,8]. The activity of many alternative σs is inhibited by a specific anti-σ factor. In a wide variety of bacterial species the σ factor σE,, also known as extracytoplasmic factor or ECF, belonging to the group IV σs, is essential in mounting responses to environmental challenges such as oxidative stress, heat shock, and misfolding of membrane proteins [9,10]. In addition, σE is of importance for virulence of bacterial pathogens [11-22]. The regulon size of σE varies widely among bacterial species studied, ranging from 89 unique σE controlled transcription units in E. coli and related bacteria [23] to a relatively small regulon of 5 genes in Neisseria gonorrhoeae [24]. In most examples, the gene encoding σE (rpoE) is located in an autoregulated operon that also contains, directly downstream of rpoE, the gene encoding its cognate anti-σE factor [25-28]. Extensive sequence analysis showed that about one third (1265/˜3600) of known and predicted anti-group IV σ factors, encoded in a gene cluster with a group IV σ (with only one exception), contain a conserved structural N-terminal fold, recently described as the anti-sigma domain (ASD) [26]. Typically, the ASD is in the N-terminus, oriented towards the cytoplasm, preceding a C-terminal transmembrane segment. However, 20% of the 1265 ASD containing proteins are not predicted to contain a transmembrane spanning C-terminal domain [26]. Among these, 95% (227/248) are characterized by the presence of an invariant Hisx3Cysx2Cys sequence motif important for anti-sigma activity, co-ordinating Zn2+, described as the zinc containing anti-σ factor (ZAS) group IV anti-σs proteins [29]. ASD proteins and ASD proteins containing the ZAS motif are predicted to bind specifically to σs and inhibit their activities [25-28].

The strictly human pathogen Neisseria meningitidis colonizes the nasopharynx of approximately 10 to 30% of the population. In rare instances colonization results in invasive disease leading to life-threatening septicemia and meningitis [30]. Meningococci possess a variety of genes involved in adaptation to specific changes in the environment encountered in the host [31-36]. In addition to nutrient limitation, meningococci are also exposed to massive amounts of reactive oxygen species produced by host defenses [37,38]. Fine tuning expression of genes required to survive hostile growth conditions is a prerequisite for the meningococcus to establish disease.

All four publicly available, completely sequenced genomes of N. meningitidis contain a gene (NMA0233, NMB2144, NMC2123 and NMCC˜2103) encoding a protein with homology to σE, the σ factor involved in stress responses [39-42]. In this study we explored the σE regulon of N. meningitidis. In addition, we provide evidence that the expression of σE (encoded by NMB2144) in meningococci is autoregulated and that its activity is under control of a protein encoded directly downstream of rpoE. This protein, encoded by NMB2145, is structurally related to ASD proteins and contains the ZAS motif (His30x3Cys34x2Cys37). We demonstrate that the Cys residues in the ZAS motif, as well as a Cys on position 4, are important (Cys4 and C37) or essential (Cys34) for anti-σE activity of NMB2145.

Results

The gene cluster containing rpoE is transcribed as a polycistronic operon and transcriptionally regulated by σE

In many bacterial species, rpoE is part of an autoregulated polycistronic operon also encoding its cognate anti-sigma factor [25-28]. In meningococci, NMB2144 is annotated as rpoE, encoding a protein with a molecular weight of approximately 23 kDa, 98% identical to the σE orthologue of N. gonorrhoeae [24] and 28% identical to σE of E. coli. Meningococcal rpoE is part of a ˜3 kb cluster of genes NMB2140 through NMB2145 (Fig.1a) having a genomic arrangement similar to that found in N. gonorrhoeae [24]. All genes, except NMB2144, are annotated as hypothetical proteins. The minimal spacing found in the cluster suggests co-transcription of its genes.

Figure 1.

Figure 1

Transcriptional analysis of the NMB2140-NMB2145 region. A) Schematic representation of the organization of the NMB2140-NMB2145 region. Genes are indicated as open arrows that show the orientation and relative sizes of the putative ORFs. Primers used in RT-PCR are indicated by closed arrows. Sizes of calculated RT-PCR products are indicated below the black lines. The bent arrow indicates the promoter. B) RpoE is cotranscribed in the polycistronic operon NMB2140-2145 upon overexpressing of rpoE. RT-PCR analysis of transcription of the rpoE operon in H44/76 transformed with pNMB2144 before (- IPTG) and after (˜IPTG) induction of over expression of rpoE. Products obtained by RT-PCR were separated on agarose gels. Numbers on the right represent DNA marker sizes; lanes 1, 4,: RT-PCR product (calculated size 2421 nt) obtained with primer pair 2140-01/2143-02; lanes 2, 5,: RT-PCR product (calculated size 2123 nt) obtained with primer pair 2142-01/2144-02; lanes 3, 6,: RT-PCR product (calculated size 735 nt) obtained with primer pair 2144-01/2145-02. Reactions without reverse transcriptase did not yield any products (not shown).

To investigate whether the genes found in the gene cluster NMB2140 through NMB2145 are co-transcribed and under transcriptional control of σE, a meningococcal strain in which expression of rpoE can be controlled, was generated by transformation of H44/76 with the shuttle vector pEN11 carrying rpoE under control of an IPTG-inducible promoter, creating H44/76 + pNMB2144. Transcript levels of the gene cluster were analysed by RT-PCR using RNA isolated from these cells grown in the absence and presence of IPTG and primer pairs as depicted in Fig. 1a. With either wt cells (not shown) or H44/76 + pNMB2144 cells grown in the absence of IPTG, hardly any detectable RT-PCR products of co-transcripts were found (see Fig. 1B, lane 1 to 3). Only the small 735 nt product (NMB2144-NMB2145, see Fig. 1B, lane 3) could be seen (the band in lane 2 is an unrelated product as shown by sequence analysis). In contrast, only when H44/76 + pNMB2144 cells were grown in the presence of IPTG, specific RT-PCR products, with sizes corresponding to calculated sizes (2412 nt (Fig. 1B, lane 4) and 2123 nt (Fig. 1B, lane 5) containing the predicted sequences of NMB2140-NMB2144, were detected, while the 735 nt product was strongly induced (Fig. 1B, lane 6). These observations indicate that the gene cluster containing rpoE is transcribed as a polycistronic operon and transcriptionally regulated by σE. The fact that complete transcripts of the rpoE operon were only found upon overexpression of rpoE suggests that in H44/76 wt cells, under the growth conditions tested, the levels of (active) σE allow only barely detectable transcription.

Identification of proteins under control of σE

To further explore the meningococcal σE regulon, protein patterns of the H44/76 wt strain, ΔrpoE and H44/76˜pNMB2144 were compared by SDS-PAGE. No apparent protein expression level differences between H44/76 wt and ΔrpoE were observed in the proteomes of the cells (not shown). The addition of IPTG to the culture medium of cells transformed with pNMB2144 only gave minor changes in protein expression in the cytoplasm (Fig. 2a). In contrast, in the crude membrane fraction, a dramatic increase in the expression of a ˜60 kDa protein was observed (Fig. 2a). The increase in expression of this protein was IPTG dependent as the protein was hardly detectable in crude membranes prepared from the same cells not exposed to IPTG (Fig. 2a). Peptide mass fingerprinting, using MALDI-TOF MS to analyze the tryptic fragments generated by in gel digestion, identified this protein as the methionine sulfoxide reductase MsrA/MsrB, encoded by NMB0044 (Mowse score: 191 with 14 matching peptides).

Figure 2.

Figure 2

MsrA/MsrB is induced upon overexpression of rpoE via transcriptional control. Protein analysis of the cytoplasmic and crude membrane fraction by SDS-PAGE (A) and corresponding transcriptional analysis of msrA/mrsB by RT-PCR (B) of the wt strain (H44/76) and H44/76 transformed with pNMB2144 before (-) and after induction (+). Molecular weight markers (in kDa) indicated on the left. Arrow indicates MsrA/MsrB.

MsrA/MsrB is transcriptionally controlled by σE

To ascertain that msrA/msrB is under direct control of σE, transcript levels of msrA/msrB in diverse meningococcal genetic backgrounds were analyzed by RT-PCR using RNA isolated from cells grown in the absence and presence of IPTG and primers targeting msrA/msrB. When H44/76 wt or H44/76 + pNMB2144 cells were grown in the absence of IPTG, no detectable RT-PCR products were observed. In contrast, when H44/76 + pNMB2144 cells were grown in the presence of IPTG, an RT-PCR product with a size indicative of transcription of msrA/msrB was found (Fig. 2b). The identity of the transcript was confirmed by sequencing of the RT-PCR product. These results strongly suggest that msrA/msrB is transcriptionally controlled by σE.

NMB2145 inhibits transcription of the rpoE regulon

One possible explanation for low σE activity in H44/76 wt cells under the growth conditions tested is that σE is kept in an inactive state through an interaction with an anti-σ factor, thereby preventing σE binding to core RNA polymerase, one of the ways to inhibit σ activity found in σ-regulator circuits in other bacteria [43-47]. Interestingly, it was recently reported that NMB2145 contains the ZAS motif Hisx3Cysx2Cys [48], characteristic for a subset of group IV σ anti-σ factors, usually encoded directly downstream of rpoE and cotranscribed [26].

Amino acid sequence comparison of orthologues of NMB2145 in genomes of three other meningococcal strains, two gonococcal strains and six commensal neisserial species (N. cinerea, N. flavescence, N. lactamica, N. mucosa, N. sicca and N. subflava) revealed that the region containing the ZAS motif, as well as the region around Cys4, are highly conserved in these neisserial orthologues of NMB2145. This in contrast with other much less well conserved parts, highlighting the importance of the conserved regions (Fig. 3). The relative positions of the Cys residue and the ZAS motif in NMB2145 (Cys4; His30, Cys34 and Cys37) correspond exactly with those of the Cys residue and the ZAS motif in RsrA (Cys11; His37, Cys41 and Cys44), the anti-σR factor of Streptomyces coelicolor, of which the Cys residues, but not His37, are essential for anti-σ activity of the protein [29] (Fig. 3). These observations suggest that NMB2145 codes for the meningococcal anti-σE factor.

Figure 3.

Figure 3

Sequence alignment of orthologues of NMB2145 as found in other neisserial species and the ZAS containing anti-σ factors RsrA of S. coelicolor and ChrR of R. sphaeriodes. Numbers at the end of each sequence represent the total length of the protein and bracketed numbers show the number of residues not shown in the alignment of RsrA and ChrR with NMB2145. The ZAS motif (Hisx3Cysx2Cys) is indicated in yellow, the additional zinc ligand [48] is indicated in red. Conserved residues of neisserial NMB2145 orthologues are indicated in green. Protein IDs or genomic coordinates (in case of missing protein annotation) are indicated on the right. Details regarding strains of which sequences were obtained are listed in the Materials and Methods section.

To test this hypothesis we first investigated the effect of deletion or overexpression of NMB2145 on transcript levels of the rpoE operon. To this end, a NMB2145 deletion mutant (ΔNMB2145) was constructed and complemented with NMB2145 using pEN11 carrying NMB2145 under control of an IPTG-inducible promoter (generating ΔNMB2145 + pNMB2145). Transcript levels of the rpoE operon were assessed by semi-quantitative RT-PCR using primers annealing to NMB2140 and NMB2143, respectively.

As noticed before, RT-PCR products derived from the transcript encoding MsrA/MsrB (Fig.2b) and products indicative of co-transcription of NMB2140-NMB2145 (Fig.1b and Fig. 4) were found only upon overexpression of rpoE in trans. However, deletion of NMB2145 resulted in the direct detection of the NMB2140-2143 without the need for overexpression of rpoE in the H44/76 wt background. As expected, upon complementation of the ΔNMB2145 mutant by induction of expression of NM2145 in trans, the NMB2140-2143 RT-PCR product was no longer detectable. This effect was dependent upon induction of overexpression of NMB2145 in ΔNMB2145 as it was not observed in the absence of IPTG (Fig.4).

Figure 4.

Figure 4

NMB2145 represses transcription of the rpoE operon. Products obtained by RT-PCR were separated on agarose gel. RT-PCR analysis of transcription of the rpoE operon in the wt strain (H44/76), H44/76 transformed with pNMB2144 before (-) and after (+) induction of expression of rpoE, after deletion of NMB2145 (ΔNMB2145) and before (-) and after (+) induction of NMB2145 in the ΔNMB2145 background (upper panel). RT-PCR was carried out using primer pair 2140-01/2143-02 (cf Fig.1a) and RT-PCR on rmpM (lower panel) was used as input control of total RNA.

As one would predict, MsrA/MsrB protein was detected in ΔNMB2145 and could not be detected anymore upon complementation of ΔNMB2145 by NMB2145 when IPTG was added to the culture medium (Fig. 5a). Also, NMB0044 (msrA/msrB) RT-PCR product was indeed detected in ΔNMB2145 cells but hardly in ΔNMB2145 cells when complemented by NMB2145 (Fig. 5b).

Figure 5.

Figure 5

MsrA/msrB is expressed upon deletion of and transcriptionally repressed by NMB2145. Protein analysis of crude membranes by SDS-PAGE (A) and corresponding transcriptional analysis of msrA/msrB by RT-PCR (B) of the NMB2145 knockout (ΔNMB2145) and ΔNMB2145 transformed with pNMB2145 before (-) and after induction (+). Molecular weight markers (kDa) are indicated on the right. Arrow indicates MsrA/MsrB.

Together, these experiments demonstrate that NMB2145 inhibits transcription of the rpoE regulon. Conceivably, NMB2145 binds to σE, thereby inactivating it, resulting in decreased transcription by means of autoregulation of the rpoE operon and, as a consequence of that, decreased transcription of msrA/msrB.

The residues Cys4, Cys34 and Cys37 of NMB2145 are essential for optimal anti-σE activity

To investigate whether the Cys residues of the ZAS motif and the conserved Cys at position 4 of NMB2145, in analogy to corresponding Cys residues in RsrA of S. coelicolor [29], are also essential for anti-σE activity of NMB2145, we generated single Ala substitutions at each of the Cys residues and also of the single His residue of the ZAS motif (His30x3Cys34x2Cys37) and at position 4 of NMB2145. The ability of these mutant NMB2145 proteins to inhibit σE activity in meningococci was investigated by SDS-PAGE assessment of crude membranes, using MrsA/MrsB as reporter protein. All substitutions except His30Ala resulted in expression of MrsA/MrsB (MALDI-TOF confirmed). The substitution Cys34Ala resulted in MsrA/MsrB levels comparable to those found in crude membranes prepared from ΔNMB2145 cells while the substitutions Cys4Ala and Cys37Ala resulted in more modest, but clearly detectable levels of MsrA/MsrB (Fig. 6). Collectively, these experiments demonstrate that the Cys residues of the ZAS motif, as well as Cys4 of NMB2145 are important for functionality of NMB2145 as an anti-σE factor.

Figure 6.

Figure 6

Residues Cys4, Cys34 and Cys37 of NMB2145 are essential for optimal anti-σE activity of NMB2145. SDS-PAGE assessment of MsrA/MsrB protein levels in crude membranes extracted from ΔNMB2145 cells in which mutant NMB2145 proteins pNMB2145(His30Ala), pNMB2145(Cys4Ala), pNMB2145(Cys34Ala) and pNMB2145(Cys37Ala) are expressed. Crude membranes were extracted before (-) and after (+) induction. Molecular weight markers (kDa) are indicated on the right. Arrow indicates MsrA/MsrB.

Involvement of σE in the response to hydrogen peroxide, diamide and singlet oxygen

The Cys4 and Cys37 in NMB2145, essential in anti-σE activity, correspond exactly with Cys11 and Cys44 residues of RsrA of S. coelicolor involved in disulphide bond formation. In addition, residue His30 in the ZAS motif of NMB2145 is not required for anti-σE activity consistent with anti-σ properties of RsrA [29] and ChrR, the ZAS containing anti-σE factor of Rhodobacter sphaeroides [26,49,50]. In S. coelicolor, exposure to superoxide, hydrogen peroxide or the thiol specific oxidant diamide causes dissociation of the σR-RsrA complex [46,51,52]. In contrast, ChrR anti-σE activity is not affected by these reactive oxygen species, but responds to singlet oxygen (1O2) [53].

To investigate stimuli activating the σE response in meningococci, cells were exposed to hydrogen peroxide, diamide or singlet oxygen and transcript levels of rpoE and msrA/msrB were analysed by RT-PCR before and after exposure to these stress agents. No differences in transcript levels of either rpoE or msrA/msrB were detected, suggesting that in meningococci σE is not involved in the response to such stimuli. In addition, no detectable differences in transcription levels of rpoE and msrA/msrB were observed after exposure of cells to SDS-EDTA, a stimulant known to induce membrane stress and activate RpoE in other bacterial species (not shown).

In silico genome wide search for additional genes under control of σE using a deduced neisserial σE promoter consensus sequence

Each σ factor recognizes specific promoter sequences, characterized by relatively highly conserved -35 and -10 upstream DNA sequences. Using the promoter sequences of genes under the control of σE, a consensus sequence can be deduced. In several bacterial species, this motif has been successfully used for in silico genome searches to identify genes putatively controlled by σE. The σE dependent transcription of these genes can subsequently be confirmed by in vitro experiments [23,54-56].

To further explore the meningococcal σE regulon, we used a similar strategy. However, in the meningococcus we were able to demonstrate transcriptional control by σE for only one operon (the rpoE operon itself) and one gene (msrA/msrB), so far. Therefore, we extended the number of genes from which a σE promoter consensus sequence could be deduced with orthologues of NMB2140 and NMB0044 found in the sequences of 3 other meningococcal genomes, 2 gonococcal genomes and the genomes of 6 commensal neisserial species. In total, putative promoter sequences of 24 genes were used to generate a consensus promoter sequence by Weblogo [57]. Thus, the conserved putative -35 (GTMAGBWTT) and -10 (CGTCTAAH) motifs could be identified (Fig.7). These motifs are separated by spacer of 12-13 nt (not shown). In addition, an AT rich sequence was observed ˜30 nt upstream of the -35 motif, corresponding to a consensus sequence designated the UP element [58-60]. Six nucleotides downstream of the -10 motif a highly conserved adenosine is found. This nucleotide and its position correspond exactly with the transcriptional start as experimentally identified for msrA/msrB in gonococci [24].

Figure 7.

Figure 7

Consensus promoter sequences predicted to be recognized by σE. Consensus sequence logo's of the A/T rich UP sequence, the -35 and -10 motif and the +1 start obtained from the compilation of DNA sequences of orthologues of NMB044 and NMB2140 of 12 different neisserial strains. Letter heights indicate the frequency with which a given base is represented at each position. The spacing between the -35 and -10 motifs is 12-13 nt (not shown). Sequence logo's were generated using Weblogo http://weblogo.berkeley.edu/:[57]

Next, we used the -35 and -10 motif, allowing a spacer length of 10 to 16 nt to explore the genome of N. meningitidis MC58 to identify genes containing the rpoE promoter motif. Besides NMB2140 and NMB0044, no other genes were identified.

Discussion

According to the annotation of the genome of N. meningitidis four genes are supposed to encode σ factors: rpoD (σ70), rpoH (σ32), rpoN (σ54) and rpoE (σE) [24,39-42]. To our knowledge, so far no information is available regarding the functionality of alternative σ factors in the meningococcus. Here, we describe the first detailed investigation of the functionality of σE of N. meningitidis. In addition, we provide strong evidence that NMB2145, encodes a novel anti-σ factor structurally related to ASD proteins and containing the ZAS motif, making NMB2145 the first anti-σ-factor described for any neisserial species.

Experimental evidence for transcriptional control by σE could be provided for only 7 genes, the 6 gene containing σE operon and msrA/msrB. In line with this, genome wide in silico searches for genes with a σE promoter motif also did not result in additional genes putatively controlled by σE. This suggests a surprisingly small σE regulon in meningococci, as well as in gonococci [24] as compared to that of other bacterial species as σE regulons can comprise up to 89 transcription units (in E. coli K-12 and related bacteria) [23].

Although the consensus σE promoter recognition motifs of the -35 region of meningococci (GTAAGGTT) and E. coli (GGAACTT) are quite different, the last 5 residues of the -10 motifs of meningococci (TCTAA) and E. coli (TCAAA) differ in only one nucleotide [23]. In addition, other similarities between the structural elements of these promoter regions were observed, such as the AT rich sequence ˜30 nt upstream of the -35 motif. This sequence, designated the UP-element, is a binding site for the C-terminal domain of the α-subunit of RNA polymerase [58-60] and has recently been shown to increase transcription of σE dependent promoters [61].

Recently, the first comprehensive analysis of conservation and variation of the σE regulon in E. coli and related organisms was reported [23]. The products of the core genes of the conserved σE regulon coordinate assembly and maintaince of lipopolysaccharide (LPS) and outer membrane proteins (OMPs) of Gram-negative bacteria, in response to cell envelope stress. The majority of the variable regulon members are functionally involved in pathogenesis [23]. Of interest, it was also recently demonstrated that σE promoters in E. coli and its close relatives exhibit a large dynamic range, with a few strong and many weak promoters [61]. The three strongest promoters all carry out regulatory roles in the σE response, the strongest transcribing σE itself and its negative regulators, and the next two strongest transcribing small RNAs (sRNAs) involved in downregulation of porin expression [61]. We did not observe expression differences of major outer membrane proteins upon overexpression of σE, making the involvement of σE in meningococci cell envelope stress uncertain. This was confirmed by our observation that membrane stress did not alter σE activity. However, as mentioned before, the majority of σE dependent proteins are expressed at low levels [61], which might be below the detection limit of the assay used in this study. As it is much easier to detect small changes in the transcriptome comparing ΔrpoE (σE knock out) or H44/76 + pNMB2144 (σE overexpression) with H44/76 (wt strain), we are planning those experiments. The recent identification in N. meningitidis of an sRNA controlling a gene and functional Hfq facilitating the interaction between sRNA and target mRNA, suggests the existence of a ribo-regulated network in this pathogen [62-65]. In many other species links between the σE regulon and the ribo-regulated network exist [66-71], but in meningococci this is as yet unexplored.

The genetic organization of the rpoE operon (NGO1948 through NGO1943) of N. gonorrhoeae is identical to that of meningococci (NMB2140-NMB2145), and four genes, NGO1946, NGO1947, NGO1948 belonging to the rpoE operon, and NGO2059, encoding MsrA/MrsB, were also upregulated, along with σE (NGO1944) itself, in a gonococcal strain overexpressing rpoE [24]. We demonstrated cotranscription of all genes in the meningococcal rpoE operon. The function of proteins encoded by NMB2140-NMB2143 is currently unknown. NMB2140 might encode a protein with possible trans membrane domains and contains motifs found in the DoxX/D-like family, involved in oxidation of sulfur [72,73]. NMB2141 through NMB2143 encode hypothetical proteins of unknown function.

Based on the structural relatedness of NMB2145 to ASD proteins [26] and sequence conservation of Cys residues shown to be essential for anti-σR activity of RsrA of S. coelicolor [29] we argue that NMB2145, directly downstream of and co-transcribed with rpoE, encodes the anti-σE factor. Indeed, upon deletion of NMB2145, msrA/msrB, which we demonstrated to be transcriptionally controlled by σE, was abundantly expressed. Irrefutable evidence for a functional interaction of NMB2145 with σE was obtained by the substitution of Cys residues with Ala at positions in NMB2145 that correspond to Cys residues in RsrA. We found that Cys34 of NMB2145 is essential and, albeit to a lesser extent, Cys4 and Cys37 are also required for optimal anti-σE activity of NMB2145. We therefore suggest annotating NMB2145 as MseR, Meningococcal sigmaE Regulator.

RsrA is a metalloprotein, containing near-stoichiometric amounts of Zn2+ [29]. Oxidation induces a disulphide bond between two of the Zn2+ ligands (Cys11 and Cys44) resulting in loss of Zn2+ and dissociation of the σR-RsrA-complex, thereby allowing σR transcription. Thioredoxin is able to reduce oxidized RsrA, and the induction of expression of thioredoxin itself is σR dependent, suggesting that σR, RsrA and the thioredoxin system in S. coelicolor comprise a novel feedback homeostasis loop, sensing and responding to changes in the intracellular thiol-disulphide redox balance [29,52,74,75]. The Cys4 and Cys37 in NMB2145, of importance in anti-σE activity, correspond exactly with Cys11 and Cys44 residues of RsrA involved in disulphide bond formation, suggesting that MseR also contains Zn2+. Therefore, it was tempting to speculate that a similar thiol-disulphide redox balance also exists in meningococci. However, in N. meningitidis thioredoxin appears not to be upregulated upon exposure to hydrogen peroxide [34] and we showed that transcription levels of MsrA/MsrB are not affected after exposure of meningococci to hydrogen peroxide, diamide or singlet oxygen. Whether NMB2145 is also a Zn+ containing protein, deserves further study.Together, despite the structural resemblance between RsrA and MseR, these results show that MseR functionally differs from RsrA of S. coelicolor.

MsrA/MrsB, encoding methionine sulfoxide reductase, an enzyme repairing proteins exposed to reactive oxygen species [76], is a major target of σE, and abundantly expressed when active σE levels are high. Expression of MsrA/MsrB is also controlled by σE in N. gonorrhoeae and Caulobacter crescentus. Interestingly, in N. gonorrhoeae MsrA/MsrB is upregulated together with the genes NGO1947 and NGO1948 in response to hydrogen peroxide [24,77,78]. However, none of the meningococcal orthologues [34,78], nor σE activity, as shown in our study, appear to respond to hydrogen peroxide,strongly indicating the existence of different modes of regulation of σE between gonococci and meningococci. In addition we did not found detectable differences in transcription levels of MsrA/MsrB after exposure to SDS-EDTA, a stimulant known to activate RpoE in other bacterial species. Thus, in vivo stimuli activating the σE response in N. meningitidis are most likely different from those of gonococci and remain to be further explored.

Conclusions

The results show the existence of a σE regulon in meningococci. The product of NMB2145 (MseR) functions as an anti-σE factor with properties different from membrane spanning anti-σE factors responding to signals in the periplasma. Our data strongly indicate that MseR, the meningococcal anti-σE factor, closely mimics structural properties of members of the ZAS family that are acting on novel stimuli encountered in the cytoplasm. Stimuli of MseR differ from those of the ZAS family anti-sigma factors suggesting that MseR is a novel anti-σ factor. This could indicate a potentially important, specific role for σE in the pathogenesis of meningococcal disease.

Methods

Bacterial strains and culture conditions

N. meningitidis strain H44/76, B: P1.7,16: F3-3: ST-32 (cc32), is closely related to the sequenced serogroup B strain MC58, belonging to the same clonal complex [79]. Meningococci were grown on GC plates (Difco) supplemented with 1% (vol/vol) Vitox (Oxoid) at 37°C in a humidified atmosphere of 5% CO2. Broth cultures were incubated in tryptic soy broth (BD) on a gyratory shaker (180 rpm) at 37°C. When appropriate, plates or broths were supplemented with erythromycin (Erm) (5 μg/ml) and/or chloramphenicol (Cm) (5 μg/ml). Growth was monitored by measuring optical density of cultures at 600 nm (OD600) at regular time intervals. To investigate the effect of various stress agents on RpoE activity, cells were grown to mid log phase (OD600 = 0.6-0.7) and treated for different time periods (30 min-1 h) with hydrogen peroxide (5 mM), diamide (100 mM), 0.01% SDS-0.1 mM EDTA or methylene blue (1 μM) in the presence of white light (source of singlet oxygen) [77]. Sequences from the following strains (with Genbank ID) were downloaded for comparative aligments: N.meningitidis_MC58 (AE002098); N.meningitidis_FAM18 (AM421808); N.meningitidis_053442 (CP000381); N.meningitidis_Z2491 (AL157959); N.gonorrhoeae_FA1090 (AE004969); N.gonorrhoeae_NCCP11945 (CP001050); N.cinerea_ATCC_14685 (ACDY00000000); N.flavescens_NRL30031/H210 (ACEN00000000); N.lactamica_ATCC_23970 (ACEQ00000000); N.subflava_NJ9703 (ACEO00000000); N.sicca_ATCC_29256 (ACKO00000000); N.mucosa_ATCC_25996 (ACDX00000000); Streptomyces coelicolor_A3(2) (AL645882); Rhodobacter sphaeroides_ATCC_17025 (CP000661).

Construction of ΔrpoE and ΔNMB2145 mutants of N. meningitidis

N. meningitidis H44/76 knock-out mutants of rpoE (NMB2144) and NMB2145 were constructed using the PCR-ligation-PCR method [79,80]. All primers used in this study are listed in Table 1. PCR products were generated with primer pairs CTsE-1/CTsE-2 and CTsE-3/CTsE4 for creating ΔrpoE and primer pairs CT-2145-1/CT2145-2 and CT-2145-3/CT-2145-4 for creating ΔNMB2145, ligated and the ligation products were reamplified with primer pairs CTsE-1/CTsE-4 (for ΔrpoE) and CT-2145-1/CT-2145-4 (for ΔNMB2145). The resulting PCR products were cloned into pCR2.1 (Invitrogen). The EcoRI digested Erm resistance cassette from pAErmC' [81] was introduced into the created unique MfeI restriction site yielding plasmids pCR2.1-NMB2144 and pCR2.1-NM2145. The ΔrpoE and ΔNMB2145 strains were generated by natural transformation of strain H44/76 with pCR2.1-NMB2144 and pCR2.1-NMB2145 respectively, and selection for Erm resistance. Replacement of NMB2144 and NMB2145 by the Erm cassette was confirmed by PCR with primer pair CTsE-5/CTsE-6 (for ΔrpoE) and primer pair 2144-01/CT-2145-6 for ΔNMB2145. The orientation of the Erm cassette was determined by PCR using primer pair JP19/JP20 and mutant strains in which the transcriptional direction of the Erm cassette was in accordance with the transcriptional direction of the deleted genes were selected.

Table 1.

Oligonucleotides used in this study

Name Sequence 5'-3'
CTsE-1 AACAGCCTTGTTAATATGGCG
CTsE-2 ATCACAATTGATATGGCGGACAAGGAG
CTsE-3 CAGGACCGGGAAACCACC
CTsE-4 GAAGTGTGTATTATGGATG
CTsE-5 GCGAGTTCCTCCAATATTGCC
CTsE-6 CGGGAGGGGTAGCGCCG
CT-2145-1 CGCAGGAAGGGCAGCCGC
CT-2145-2 ATCACAATTGCGTTTACTTCGGGTTTTCTTGG
CT-2145-3 ACGGCATAAGCTGACGG
CT-2145-4 CGTTTGAGATTGTGCCG
CT-2145-6 TGGCAGTCTTGTATGCGGG
CTsE-7 ATCATATGCCGCTACCCGACC
CTsE-8 TTCATGAACGTTTACTTCGGG
CT-2145-11F CGTCATATGAAAAAATGCCGCG
CT-2145-11R TTTCATGACGGCATTTATTTTGAAGTTCTGG
2140-01 TCGGAACAACTTGGCAG
2143-02 GACCATTTCCCAAGCAA
2142-01 ATGATTCAACACGCAGG
2144-01 ACCCGACCTGACCGATGC
2144-02 GGTGCATAATGGTGTGGT
2145-02 CTGGTTGTTTTTGCCAG
CT-class4-1 CAAACAGCTGAAATTAAGCGC
CT-class4-2 GTGATGATTGTGTGCCGGC
CT-MSR-01 CTTTGCGCCAAGTTCGGC
CT-MSR-02 CTTTACCTTTCAACGCGCC
pEN11F TGTGGAATTGTGAGCGGATA
pEN11R AGCAAAAACAGGAAGGCAAA
ALpEN11F2 GACAATTAATCATCGGCTCGT
JP19 TAAATACAAAACGCTCATTGGC
JP22 AAATCGTCAATTCCTGCATGTT
YPNMB2145-C4A-FW GCATATGAAAAAAGCCCGCGATATCGCCC
YPNMB2145-C4A-RP GGGCGATATCGCGGGCTTTTTTCATATGC
YPNMB2145-H30A-FW GATTTCCATATACACAGCCCTGCTGTTCTGTCCG
YPNMB2145-H30A-RP CGGACAGAACAGCAGGGCTGTGTATATGGAAATC
YPNMB2145-C34A-FW CACACACCTGCTGTTCGCTCCGTATTGCCGTG
YPNMB2145-C34A-RP CACGGCAATACGGAGCGAACAGCAGGTGTGTG
YPNMB2145-C37A-FW GCTGTTCTGTCCGTATGCCCGTGAATATAAAAGAC
YPNMB2145-C37A-RP GTCTTTTATATTCACGGGCATACGGACAGAACAGC

Overexpression of rpoE and complementation of ΔNMB2145

To overexpress rpoE and to complement ΔNMB2145, NMB2144 and NMB2145 of strain H44/76 were amplified with primer pair CTsE-7/CTsE-8 (for NMB2144) and primer pair CT-2145-11F/CT-2145-11R (for NMB2145). Forward primers (CTsE-7 and CT-2145-11F) contain an NdeI restriction site and the reversed primers an RcaI restriction site. The resulting PCR products and shuttle vector pEN11-pldA [82] were digested with NdeI and RcaI, ligated into NdeI-RcaI predigested pEN11-pldA and transformed to E. coli TOP10F'(Invitrogen). Cm-resistant colonies were checked by colony PCR and sequencing, using pEN11F, pEN11R and ALpEN11F2 primers. Plasmids of clones containing an intact NMB2144 coding region (pNMB2144) or an intact NMB2145 coding region (pNMB2145) were isolated to transform H44/76 and ΔNMB2145 thereby generating H44/76 + pNMB2144 and ΔNMB2145 + pNMB2145, respectively. Expression of recombinant DNA was induced by addition of IPTG to the culture medium to a final concentration of 1 mM.

In vitro mutagenesis of NMB2145

Shuttle vector pNMB2145 was used to generate mutant NMB2145 proteins. Point mutations were generated using Quickchange site-directed mutagenesis (Stratagene). Four mutants of pNMB2145 were generated: Cys4Ala, His30Ala, Cys34Ala and Cys37Ala, using primer pairs YPNMB2145C4AFW-YPNMB2145C4ARP (for mutant pNMB2145(Cys4Ala)), YPNMB2145H30AFW-YPNMB2145H30ARP (for mutant pNMB2145(His30Ala)), YPNMB2145C34AFW-YPNMB2145C34ARP (for mutant pNMB2145(Cys34Ala)) and YPNMB2145C37AFW-YPNMB2145C37ARP (for mutant pNMB2145(Cys37Ala)). Mutations were confirmed by sequence analysis.

RT-PCR

RNA was isolated from meningococci grown to late mid log phase (OD600 1.0 -1. 5) using Rneasy® Midi Kit (Qiagen). RT-PCR was done using SuperScriptIII (Invitrogen). Primer pairs used to investigate whether NMB2140 through NMB2145 is transcribed as a polycistronic operon are depicted in Fig. 1. Primer pair CT-MSR-01/CT-MSR-02 was used to investigate transcription of NMB0044. One single batch of cDNA generated from RNA isolated from H44/76 wt, H44/76 + pNMB2144, ΔNMB2145 and ΔNMB2145 + pNMB2145, grown in the absence and presence of IPTG, was used for transcriptional analyses of the rpoE operon and NMB0044.To investigate the effect of hydrogen peroxide, diamide and singlet oxygen on RpoE activity, RNA was isolated from midlog phase grown cells with and without exposure to the stress stimuli and primer pairs CT-MSR-01/CT-MSR-02 and 2144-01/2144-02 were used to investigate transcription of NMB0044 and NMB2144 respectively. RT-PCR of RmpM (NMB0382) using primerset CT-class4-1/CT-class4-2, was used as loading control. Sequence analysis was carried out to confirm the identity of the generated RT-PCR products.

Cell fractionation

Meningococci were grown in broth until OD600 = 0.6-0.8, harvested by centrifugation (20 min at 5000 × g) and resuspended in 50 mM Tris-HCl (pH 7.8). Meningococcal cells were disrupted by sonication (Branson B15 Sonifier, 50 W, 10 min, 50% duty cycle, 4°C), followed by centrifugation (3000 × g, 4 min, 4°C). The supernatant was centrifuged (100,000 × g, 60 min, 4°C). This way obtained supernatant was considered as the cytoplasmic fraction and pellets, containing crude membranes were resuspended in 2 mM TrisHCL (pH 6,8). Protein concentrations were determined by the method described by Lowry [82,83].

SDS-PAGE and MALDI-TOF mass spectrometry

Proteins were resolved by SDS-PAGE [84]. Gels (11%) were stained with PageBlue (Fermentas), washed in MilliQ water and stored in 1% acetic acid at 4°C until bands of interest were excised for further analysis. MALDI-TOF mass spectrometry was carried out as described previously [64].

Authors' contributions

CThPH participated in the design of the study, carried out experiments and analyses of the data and helped to draft the manuscript. DS carried out the MALDI-TOF mass spectrometry and helped to draft the manuscript. AvdE participated in the design of the study, carried out the analyses of the data and helped to draft the manuscript. YP participated in the design of the study, carried out the analyses of the data and drafted the manuscript. All authors read and approved the final manuscript.

Contributor Information

Carla Th P Hopman, Email: c.t.hopman@amc.uva.nl.

Dave Speijer, Email: d.speijer@amc.uva.nl.

Arie van der Ende, Email: a.vanderende@amc.uva.nl.

Yvonne Pannekoek, Email: y.pannekoek@amc.uva.nl.

Acknowledgements

Melanie Nguyen is acknowledged for her technical assistance. This research was partly funded by the Sixth Framework Programme of the European Commission, Proposal/Contract no.: 512061 (Network of Excellence 'European Virtual Institute for Functional Genomics of Bacterial Pathogens', http://www.noe-epg.uni-wuerzburg.de

References

  1. Ebright RH. RNA polymerase: structural similarities between bacterial RNA polymerase and eukaryotic RNA polymerase II. J Mol Biol. 2000;304:687–698. doi: 10.1006/jmbi.2000.4309. [DOI] [PubMed] [Google Scholar]
  2. Gross CA, Chan CL, Lonetto MA. A structure/function analysis of Escherichia coli RNA polymerase. Philos Trans R Soc Lond B Biol Sci. 1996;351:475–482. doi: 10.1098/rstb.1996.0045. [DOI] [PubMed] [Google Scholar]
  3. Gross CA, Chan C, Dombroski A, Gruber T, Sharp M, Tupy J, Young B. The functional and regulatory roles of sigma factors in transcription. Cold Spring Harb Symp Quant Biol. 1998;63:141–155. doi: 10.1101/sqb.1998.63.141. [DOI] [PubMed] [Google Scholar]
  4. Murakami KS, Darst SA. Bacterial RNA polymerases: the wholo story. Curr Opin Struct Biol. 2003;13:31–39. doi: 10.1016/S0959-440X(02)00005-2. [DOI] [PubMed] [Google Scholar]
  5. Sweetser D, Nonet M, Young RA. Prokaryotic and eukaryotic RNA polymerases have homologous core subunits. Proc Natl Acad Sci USA. 1987;84:1192–1196. doi: 10.1073/pnas.84.5.1192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Lonetto M, Gribskov M, Gross CA. The sigma 70 family: sequence conservation and evolutionary relationships. J Bacteriol. 1992;174:3843–3849. doi: 10.1128/jb.174.12.3843-3849.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Gruber TM, Gross CA. Assay of Escherichia coli RNA polymerase: sigma-core interactions. Methods Enzymol. 2003;370:206–212. doi: 10.1016/S0076-6879(03)70018-4. full_text. [DOI] [PubMed] [Google Scholar]
  8. Helmann JD. The extracytoplasmic function (ECF) sigma factors. Adv Microb Physiol. 2002;46:47–110. doi: 10.1016/s0065-2911(02)46002-x. full_text. [DOI] [PubMed] [Google Scholar]
  9. Ades SE. Regulation by destruction: design of the sigmaE envelope stress response. Curr Opin Microbiol. 2008;11:535–540. doi: 10.1016/j.mib.2008.10.004. [DOI] [PubMed] [Google Scholar]
  10. Hayden JD, Ades SE. The extracytoplasmic stress factor, sigmaE, is required to maintain cell envelope integrity in Escherichia coli. PLoS One. 2008;3:e1573. doi: 10.1371/journal.pone.0001573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Ando M, Yoshimatsu T, Ko C, Converse PJ, Bishai WR. Deletion of Mycobacterium tuberculosis sigma factor E results in delayed time to death with bacterial persistence in the lungs of aerosol-infected mice. Infect Immun. 2003;71:7170–7172. doi: 10.1128/IAI.71.12.7170-7172.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Bashyam MD, Hasnain SE. The extracytoplasmic function sigma factors: role in bacterial pathogenesis. Infect Genet Evol. 2004;4:301–308. doi: 10.1016/j.meegid.2004.04.003. [DOI] [PubMed] [Google Scholar]
  13. Carlsson KE, Liu J, Edqvist PJ, Francis MS. Influence of the Cpx extracytoplasmic-stress-responsive pathway on Yersinia sp.-eukaryotic cell contact. Infect Immun. 2007;75:4386–4399. doi: 10.1128/IAI.01450-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Carlsson KE, Liu J, Edqvist PJ, Francis MS. Extracytoplasmic-stress-responsive pathways modulate type III secretion in Yersinia pseudotuberculosis. Infect Immun. 2007;75:3913–3924. doi: 10.1128/IAI.01346-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Craig JE, Nobbs A, High NJ. The extracytoplasmic sigma factor, final sigma(E), is required for intracellular survival of nontypeable Haemophilus influenzae in J774 macrophages. Infect Immun. 2002;70:708–715. doi: 10.1128/IAI.70.2.708-715.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. De Las PA, Connolly L, Gross CA. SigmaE is an essential sigma factor in Escherichia coli. J Bacteriol. 1997;179:6862–6864. doi: 10.1128/jb.179.21.6862-6864.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Humphreys S, Stevenson A, Bacon A, Weinhardt AB, Roberts M. The alternative sigma factor, sigmaE, is critically important for the virulence of Salmonella typhimurium. Infect Immun. 1999;67:1560–1568. doi: 10.1128/iai.67.4.1560-1568.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kovacikova G, Skorupski K. The alternative sigma factor sigma(E) plays an important role in intestinal survival and virulence in Vibrio cholerae. Infect Immun. 2002;70:5355–5362. doi: 10.1128/IAI.70.10.5355-5362.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Manganelli R, Voskuil MI, Schoolnik GK, Smith I. The Mycobacterium tuberculosis ECF sigma factor sigmaE: role in global gene expression and survival in macrophages. Mol Microbiol. 2001;41:423–437. doi: 10.1046/j.1365-2958.2001.02525.x. [DOI] [PubMed] [Google Scholar]
  20. Martin DW, Schurr MJ, Yu H, Deretic V. Analysis of promoters controlled by the putative sigma factor AlgU regulating conversion to mucoidy in Pseudomonas aeruginosa: relationship to sigma E and stress response. J Bacteriol. 1994;176:6688–6696. doi: 10.1128/jb.176.21.6688-6696.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Redford P, Roesch PL, Welch RA. DegS is necessary for virulence and is among extraintestinal Escherichia coli genes induced in murine peritonitis. Infect Immun. 2003;71:3088–3096. doi: 10.1128/IAI.71.6.3088-3096.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Testerman TL, Vazquez-Torres A, Xu Y, Jones-Carson J, Libby SJ, Fang FC. The alternative sigma factor sigmaE controls antioxidant defences required for Salmonella virulence and stationary-phase survival. Mol Microbiol. 2002;43:771–782. doi: 10.1046/j.1365-2958.2002.02787.x. [DOI] [PubMed] [Google Scholar]
  23. Rhodius VA, Suh WC, Nonaka G, West J, Gross CA. Conserved and variable functions of the sigmaE stress response in related genomes. PLoS Biol. 2006;4:e2. doi: 10.1371/journal.pbio.0040002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gunesekere IC, Kahler CM, Ryan CS, Snyder LA, Saunders NJ, Rood JI, Davies JK. Ecf, an alternative sigma factor from Neisseria gonorrhoeae, controls expression of msrAB, which encodes methionine sulfoxide reductase. J Bacteriol. 2006;188:3463–3469. doi: 10.1128/JB.188.10.3463-3469.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Brown KL, Hughes KT. The role of anti-sigma factors in gene regulation. Mol Microbiol. 1995;16:397–404. doi: 10.1111/j.1365-2958.1995.tb02405.x. [DOI] [PubMed] [Google Scholar]
  26. Campbell EA, Greenwell R, Anthony JR, Wang S, Lim L, Das K, Sofia HJ, Donohue TJ, Darst SA. A conserved structural module regulates transcriptional responses to diverse stress signals in bacteria. Mol Cell. 2007;27:793–805. doi: 10.1016/j.molcel.2007.07.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Helmann JD. Anti-sigma factors. Curr Opin Microbiol. 1999;2:135–141. doi: 10.1016/S1369-5274(99)80024-1. [DOI] [PubMed] [Google Scholar]
  28. Hughes KT, Mathee K. The anti-sigma factors. Annu Rev Microbiol. 1998;52:231–286. doi: 10.1146/annurev.micro.52.1.231. [DOI] [PubMed] [Google Scholar]
  29. Paget MS, Bae JB, Hahn MY, Li W, Kleanthous C, Roe JH, Buttner MJ. Mutational analysis of RsrA, a zinc-binding anti-sigma factor with a thiol-disulphide redox switch. Mol Microbiol. 2001;39:1036–1047. doi: 10.1046/j.1365-2958.2001.02298.x. [DOI] [PubMed] [Google Scholar]
  30. de Souza AL, Seguro AC. Two centuries of meningococcal infection: from Vieusseux to the cellular and molecular basis of disease. J Med Microbiol. 2008;57:1313–1321. doi: 10.1099/jmm.0.47599-0. [DOI] [PubMed] [Google Scholar]
  31. Basler M, Linhartova I, Halada P, Novotna J, Bezouskova S, Osicka R, Weiser J, Vohradsky J, Sebo P. The iron-regulated transcriptome and proteome of Neisseria meningitidis serogroup C. Proteomics. 2006;6:6194–6206. doi: 10.1002/pmic.200600312. [DOI] [PubMed] [Google Scholar]
  32. Delany I, Rappuoli R, Scarlato V. Fur functions as an activator and as a repressor of putative virulence genes in Neisseria meningitidis. Mol Microbiol. 2004;52:1081–1090. doi: 10.1111/j.1365-2958.2004.04030.x. [DOI] [PubMed] [Google Scholar]
  33. Grifantini R, Sebastian S, Frigimelica E, Draghi M, Bartolini E, Muzzi A, Rappuoli R, Grandi G, Genco CA. Identification of iron-activated and -repressed Fur-dependent genes by transcriptome analysis of Neisseria meningitidis group B. Proc Natl Acad Sci USA. 2003;100:9542–9547. doi: 10.1073/pnas.1033001100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Grifantini R, Frigimelica E, Delany I, Bartolini E, Giovinazzi S, Balloni S, Agarwal S, Galli G, Genco C, Grandi G. Characterization of a novel Neisseria meningitidis Fur and iron-regulated operon required for protection from oxidative stress: utility of DNA microarray in the assignment of the biological role of hypothetical genes. Mol Microbiol. 2004;54:962–979. doi: 10.1111/j.1365-2958.2004.04315.x. [DOI] [PubMed] [Google Scholar]
  35. Ieva R, Roncarati D, Metruccio MM, Seib KL, Scarlato V, Delany I. OxyR tightly regulates catalase expression in Neisseria meningitidis through both repression and activation mechanisms. Mol Microbiol. 2008;70:1152–1165. doi: 10.1111/j.1365-2958.2008.06468.x. [DOI] [PubMed] [Google Scholar]
  36. Pannekoek Y, Schuurman IG, Dankert J, van Putten JP. Immunogenicity of the meningococcal stress protein MSP63 during natural infection. Clin Exp Immunol. 1993;93:377–381. doi: 10.1111/j.1365-2249.1993.tb08188.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Archibald FS, Duong MN. Superoxide dismutase and oxygen toxicity defenses in the genus Neisseria. Infect Immun. 1986;51:631–641. doi: 10.1128/iai.51.2.631-641.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Pericone CD, Overweg K, Hermans PW, Weiser JN. Inhibitory and bactericidal effects of hydrogen peroxide production by Streptococcus pneumoniae on other inhabitants of the upper respiratory tract. Infect Immun. 2000;68:3990–3997. doi: 10.1128/IAI.68.7.3990-3997.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Bentley SD, Vernikos GS, Snyder LA, Churcher C, Arrowsmith C, Chillingworth T, Cronin A, Davis PH, Holroyd NE, Jagels K, Maddison M, Moule S, Rabbinowitsch E, Sharp S, Unwin L, Whitehead S, Quail MA, Achtman M, Barrell B, Saunders NJ, Parkhill J. Meningococcal genetic variation mechanisms viewed through comparative analysis of serogroup C strain FAM18. PLoS Genet. 2007;3:e23. doi: 10.1371/journal.pgen.0030023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Parkhill J, Achtman M, James KD, Bentley SD, Churcher C, Klee SR, Morelli G, Basham D, Brown D, Chillingworth T, Davies RM, Davis P, Devlin K, Feltwell T, Hamlin N, Holroyd S, Jagels K, Leather S, Moule S, Mungall K, Quail MA, Rajandream MA, Rutherford KM, Simmonds M, Skelton J, Whitehead S, Spratt BG, Barrell BG. Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491. Nature. 2000;404:502–506. doi: 10.1038/35006655. [DOI] [PubMed] [Google Scholar]
  41. Peng J, Yang L, Yang F, Yang J, Yan Y, Nie H, Zhang X, Xiong Z, Jiang Y, Cheng F, Xu X, Chen S, Sun L, Li W, Shen Y, Shao Z, Liang X, Xu J, Jin Q. Characterization of ST-4821 complex, a unique Neisseria meningitidis clone. Genomics. 2008;91:78–87. doi: 10.1016/j.ygeno.2007.10.004. [DOI] [PubMed] [Google Scholar]
  42. Tettelin H, Saunders NJ, Heidelberg J, Jeffries AC, Nelson KE, Eisen JA, Ketchum KA, Hood DW, Peden JF, Dodson RJ, Nelson WC, Gwinn ML, DeBoy R, Peterson JD, Hickey EK, Haft DH, Salzberg SL, White O, Fleischmann RD, Dougherty BA, Mason T, Ciecko A, Parksey DS, Blair E, Cittone H, Clark EB, Cotton MD, Utterback TR, Khouri H, Qin H, Vamathevan J, Gill J, Scarlato V, Masignani V, Pizza M, Grandi G, Sun L, Smith HO, Fraser CM, Moxon ER, Rappuoli R, Venter JC. Complete genome sequence of Neisseria meningitidis serogroup B strain MC58. Science. 2000;287:1809–1815. doi: 10.1126/science.287.5459.1809. [DOI] [PubMed] [Google Scholar]
  43. Anthony JR, Newman JD, Donohue TJ. Interactions between the Rhodobacter sphaeroides ECF sigma factor, sigma(E), and its anti-sigma factor, ChrR. J Mol Biol. 2004;341:345–360. doi: 10.1016/j.jmb.2004.06.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Campbell EA, Muzzin O, Chlenov M, Sun JL, Olson CA, Weinman O, Trester-Zedlitz ML, Darst SA. Structure of the bacterial RNA polymerase promoter specificity sigma subunit. Mol Cell. 2002;9:527–539. doi: 10.1016/S1097-2765(02)00470-7. [DOI] [PubMed] [Google Scholar]
  45. Campbell EA, Tupy JL, Gruber TM, Wang S, Sharp MM, Gross CA, Darst SA. Crystal structure of Escherichia coli sigmaE with the cytoplasmic domain of its anti-sigma RseA. Mol Cell. 2003;11:1067–1078. doi: 10.1016/S1097-2765(03)00148-5. [DOI] [PubMed] [Google Scholar]
  46. Li W, Bottrill AR, Bibb MJ, Buttner MJ, Paget MS, Kleanthous C. The Role of zinc in the disulphide stress-regulated anti-sigma factor RsrA from Streptomyces coelicolor. J Mol Biol. 2003;333:461–472. doi: 10.1016/j.jmb.2003.08.038. [DOI] [PubMed] [Google Scholar]
  47. Song T, Dove SL, Lee KH, Husson RN. RshA, an anti-sigma factor that regulates the activity of the mycobacterial stress response sigma factor SigH. Mol Microbiol. 2003;50:949–959. doi: 10.1046/j.1365-2958.2003.03739.x. [DOI] [PubMed] [Google Scholar]
  48. Zdanowski K, Doughty P, Jakimowicz P, O'Hara L, Buttner MJ, Paget MS, Kleanthous C. Assignment of the zinc ligands in RsrA, a redox-sensing ZAS protein from Streptomyces coelicolor. Biochemistry. 2006;45:8294–8300. doi: 10.1021/bi060711v. [DOI] [PubMed] [Google Scholar]
  49. Newman JD, Falkowski MJ, Schilke BA, Anthony LC, Donohue TJ. The Rhodobacter sphaeroides ECF sigma factor, sigma(E), and the target promoters cycA P3 and rpoE P1. J Mol Biol. 1999;294:307–320. doi: 10.1006/jmbi.1999.3263. [DOI] [PubMed] [Google Scholar]
  50. Newman JD, Anthony JR, Donohue TJ. The importance of zinc-binding to the function of Rhodobacter sphaeroides ChrR as an anti-sigma factor. J Mol Biol. 2001;313:485–499. doi: 10.1006/jmbi.2001.5069. [DOI] [PubMed] [Google Scholar]
  51. Bae JB, Park JH, Hahn MY, Kim MS, Roe JH. Redox-dependent changes in RsrA, an anti-sigma factor in Streptomyces coelicolor: zinc release and disulfide bond formation. J Mol Biol. 2004;335:425–435. doi: 10.1016/j.jmb.2003.10.065. [DOI] [PubMed] [Google Scholar]
  52. Kang JG, Paget MS, Seok YJ, Hahn MY, Bae JB, Hahn JS, Kleanthous C, Buttner MJ, Roe JH. RsrA, an anti-sigma factor regulated by redox change. EMBO J. 1999;18:4292–4298. doi: 10.1093/emboj/18.15.4292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Anthony JR, Warczak KL, Donohue TJ. A transcriptional response to singlet oxygen, a toxic byproduct of photosynthesis. Proc Natl Acad Sci USA. 2005;102:6502–6507. doi: 10.1073/pnas.0502225102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Hertz GZ, Stormo GD. Escherichia coli promoter sequences: analysis and prediction. Methods Enzymol. 1996;273:30–42. doi: 10.1016/s0076-6879(96)73004-5. full_text. [DOI] [PubMed] [Google Scholar]
  55. Huerta AM, Collado-Vides J. Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals. J Mol Biol. 2003;333:261–278. doi: 10.1016/j.jmb.2003.07.017. [DOI] [PubMed] [Google Scholar]
  56. Staden R. Computer methods to locate signals in nucleic acid sequences. Nucleic Acids Res. 1984;12:505–519. doi: 10.1093/nar/12.1Part2.505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Crooks GE, Hon G, Chandonia JM, Brenner SE. WebLogo: a sequence logo generator. Genome Res. 2004;14:1188–1190. doi: 10.1101/gr.849004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Blatter EE, Ross W, Tang H, Gourse RL, Ebright RH. Domain organization of RNA polymerase alpha subunit: C-terminal 85 amino acids constitute a domain capable of dimerization and DNA binding. Cell. 1994;78:889–896. doi: 10.1016/S0092-8674(94)90682-3. [DOI] [PubMed] [Google Scholar]
  59. Estrem ST, Gaal T, Ross W, Gourse RL. Identification of an UP element consensus sequence for bacterial promoters. Proc Natl Acad Sci USA. 1998;95:9761–9766. doi: 10.1073/pnas.95.17.9761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Ross W, Gosink KK, Salomon J, Igarashi K, Zou C, Ishihama A, Severinov K, Gourse RL. A third recognition element in bacterial promoters: DNA binding by the alpha subunit of RNA polymerase. Science. 1993;262:1407–1413. doi: 10.1126/science.8248780. [DOI] [PubMed] [Google Scholar]
  61. Mutalik V, Nonaka G, Ades S, Rhodius VA, Gross CA. Promoter Strength Properties of the Complete Sigma E regulon of E. coli and Salmonella. J Bacteriol. 2009. [DOI] [PMC free article] [PubMed]
  62. Fantappie L, Metruccio MM, Seib KL, Oriente F, Cartocci E, Ferlicca F, Giuliani MM, Scarlato V, Delany I. The RNA chaperone Hfq is involved in stress response and virulence in Neisseria meningitidis and is a pleiotropic regulator of protein expression. Infect Immun. 2009;77:1842–1853. doi: 10.1128/IAI.01216-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Metruccio MM, Fantappie L, Serruto D, Muzzi A, Roncarati D, Donati C, Scarlato V, Delany I. The Hfq-Dependent Small Non-Coding (s) RNA NrrF Directly Mediates Fur-Dependent Positive Regulation of Succinate Dehydrogenase in Neisseria meningitidis. J Bacteriol. 2008. [DOI] [PMC free article] [PubMed]
  64. Pannekoek Y, Huis in t'Veld V, Hopman CT, Langerak AA, Speijer D, Ende van der A. Molecular characterization and identification of proteins regulated by Hfq in Neisseria meningitidis. FEMS Microbiol Lett. 2009;294:216–224. doi: 10.1111/j.1574-6968.2009.01568.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Mellin JR, Goswami S, Grogan S, Tjaden B, Genco CA. A novel fur- and iron-regulated small RNA, NrrF, is required for indirect fur-mediated regulation of the sdhA and sdhC genes in Neisseria meningitidis. J Bacteriol. 2007;189:3686–3694. doi: 10.1128/JB.01890-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Johansen J, Rasmussen AA, Overgaard M, Valentin-Hansen P. Conserved small non-coding RNAs that belong to the sigmaE regulon: role in down-regulation of outer membrane proteins. J Mol Biol. 2006;364:1–8. doi: 10.1016/j.jmb.2006.09.004. [DOI] [PubMed] [Google Scholar]
  67. Johansen J, Eriksen M, Kallipolitis B, Valentin-Hansen P. Down-regulation of outer membrane proteins by noncoding RNAs: unraveling the cAMP-CRP- and sigmaE-dependent CyaR-ompX regulatory case. J Mol Biol. 2008;383:1–9. doi: 10.1016/j.jmb.2008.06.058. [DOI] [PubMed] [Google Scholar]
  68. Papenfort K, Pfeiffer V, Mika F, Lucchini S, Hinton JC, Vogel J. SigmaE-dependent small RNAs of Salmonella respond to membrane stress by accelerating global omp mRNA decay. Mol Microbiol. 2006;62:1674–1688. doi: 10.1111/j.1365-2958.2006.05524.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Valentin-Hansen P, Johansen J, Rasmussen AA. Small RNAs controlling outer membrane porins. Curr Opin Microbiol. 2007;10:152–155. doi: 10.1016/j.mib.2007.03.001. [DOI] [PubMed] [Google Scholar]
  70. Vogel J, Papenfort K. Small non-coding RNAs and the bacterial outer membrane. Curr Opin Microbiol. 2006;9:605–611. doi: 10.1016/j.mib.2006.10.006. [DOI] [PubMed] [Google Scholar]
  71. Eiamphungporn W, Helmann JD. Extracytoplasmic function sigma factors regulate expression of the Bacillus subtilis yabE gene via a cis-acting antisense RNA. J Bacteriol. 2009;191:1101–1105. doi: 10.1128/JB.01530-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Muller FH, Bandeiras TM, Urich T, Teixeira M, Gomes CM, Kletzin A. Coupling of the pathway of sulphur oxidation to dioxygen reduction: characterization of a novel membrane-bound thiosulphate:quinone oxidoreductase. Mol Microbiol. 2004;53:1147–1160. doi: 10.1111/j.1365-2958.2004.04193.x. [DOI] [PubMed] [Google Scholar]
  73. Purschke WG, Schmidt CL, Petersen A, Schafer G. The terminal quinol oxidase of the hyperthermophilic archaeon Acidianus ambivalens exhibits a novel subunit structure and gene organization. J Bacteriol. 1997;179:1344–1353. doi: 10.1128/jb.179.4.1344-1353.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Kang JG, Hahn MY, Ishihama A, Roe JH. Identification of sigma factors for growth phase-related promoter selectivity of RNA polymerases from Streptomyces coelicolor A3(2) Nucleic Acids Res. 1997;25:2566–2573. doi: 10.1093/nar/25.13.2566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Paget MS, Kang JG, Roe JH, Buttner MJ. sigmaR, an RNA polymerase sigma factor that modulates expression of the thioredoxin system in response to oxidative stress in Streptomyces coelicolor A3(2) EMBO J. 1998;17:5776–5782. doi: 10.1093/emboj/17.19.5776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Ezraty B, Aussel L, Barras F. Methionine sulfoxide reductases in prokaryotes. Biochim Biophys Acta. 2005;1703:221–229. doi: 10.1016/j.bbapap.2004.08.017. [DOI] [PubMed] [Google Scholar]
  77. Lourenco RF, Gomes SL. The transcriptional response to cadmium, organic hydroperoxide, singlet oxygen and UV-A mediated by the sigmaE-ChrR system in Caulobacter crescentus. Mol Microbiol. 2009;72:1159–1170. doi: 10.1111/j.1365-2958.2009.06714.x. [DOI] [PubMed] [Google Scholar]
  78. Stohl EA, Criss AK, Seifert HS. The transcriptome response of Neisseria gonorrhoeae to hydrogen peroxide reveals genes with previously uncharacterized roles in oxidative damage protection. Mol Microbiol. 2005;58:520–532. doi: 10.1111/j.1365-2958.2005.04839.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Ende van der A, Hopman CT, Dankert J. Deletion of porA by recombination between clusters of repetitive extragenic palindromic sequences in Neisseria meningitidis. Infect Immun. 1999;67:2928–2934. doi: 10.1128/iai.67.6.2928-2934.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Ali SA, Steinkasserer A. PCR-ligation-PCR mutagenesis: a protocol for creating gene fusions and mutations. Biotechniques. 1995;18:746–750. [PubMed] [Google Scholar]
  81. Zhou D, Apicella MA. Plasmids with erythromycin resistance and catechol 2,3-dioxygenase- or beta-galactosidase-encoding gene cassettes for use in Neisseria spp. Gene. 1996;171:133–134. doi: 10.1016/0378-1119(96)00103-5. [DOI] [PubMed] [Google Scholar]
  82. Bos MP, Tefsen B, Voet P, Weynants V, van Putten JP, Tommassen J. Function of neisserial outer membrane phospholipase a in autolysis and assessment of its vaccine potential. Infect Immun. 2005;73:2222–2231. doi: 10.1128/IAI.73.4.2222-2231.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Lowry O, Rosebrough N, Farr A, randall rj. Protein measurement with the Folin phemol reagent. J. Biol. Chem. 1951;193:265–275. Ref Type: Generic. [PubMed] [Google Scholar]
  84. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680–685. doi: 10.1038/227680a0. [DOI] [PubMed] [Google Scholar]

Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES