Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2010 May 7;76(13):4346–4353. doi: 10.1128/AEM.00359-10

Fluorescent Reporters for Studies of Cellular Localization of Proteins in Staphylococcus aureus ▿

Pedro M Pereira 1,†, Helena Veiga 1,†, Ana M Jorge 1, Mariana G Pinho 1,*
PMCID: PMC2897443  PMID: 20453129

Abstract

We have constructed a set of plasmids that allow expression, from their native chromosomal loci, of Staphylococcus aureus proteins fused to one of four different fluorescent proteins (green fluorescent protein [GFP], cyan fluorescent protein [CFP], yellow fluorescent protein [YFP], and mCherry), using two different resistance markers (kanamycin and erythromycin). We have also constructed a plasmid that allows expression of proteins from the ectopic spa locus in the S. aureus chromosome. This toolbox can be used for studies of the localization of proteins in S. aureus, a prominent pathogen in both health care and community settings.


Studies of the subcellular localization of proteins, which initially focused on the model organisms Escherichia coli and Bacillus subtilis, revolutionized the way we think about the bacterial cell by showing that many essential cellular processes, such as cell division or DNA replication, are precisely regulated not only in time but also in space. Knowledge regarding specific and dynamic localization of proteins in live bacterial cells was obtained mainly by looking at cells expressing fusions of proteins of interest to different fluorescent proteins, such as green fluorescent protein (GFP) (21). There is an increasing interest in expanding cell biology studies to other bacterial species, with different morphologies, different developmental processes, or more clinical relevance, but this interest in many cases is impaired by the lack of availability of appropriate tools.

Staphylococcus aureus is a Gram-positive pathogen capable of causing diseases ranging from minor infections to life-threatening ones with high morbidity and mortality rates (20). Besides its virulence, S. aureus is well known due to its increasing resistance to virtually all classes of antibiotics (18). Methicillin-resistant S. aureus (MRSA) strains, the most important cause of antibiotic-resistant nosocomial infections worldwide, have recently emerged in the community as well, emphasizing the growing importance of this pathogenic bacterium (4). Besides its interest as a clinical pathogen, S. aureus is also a very interesting model for the study of cell division because it has a different (round) shape and mode of division (in three consecutive perpendicular division planes over three division cycles [22]) from those of the model organisms E. coli and B. subtilis (25). The availability of vectors which allow expression of staphylococcal proteins fused to fluorescent reporters would therefore be of great interest for S. aureus studies in different areas.

Over the last decade, there have been some reports of the use of GFP in S. aureus, either to fluorescently label whole cells, mainly for in vivo studies, or as a reporter protein for transcriptional fusions (3, 5, 19). A recent report thoroughly describes a set of S. aureus vectors that allow cell labeling with different fluorescent proteins (13). However, all of these vectors were designed to allow for the expression of fluorescent proteins which were not fused to staphylococcal proteins in the cytoplasm of S. aureus cells. In this report, we describe the construction of a toolkit of eight plasmids, containing either an erythromycin or a kanamycin resistance marker, which allow the expression, from their native chromosomal loci, of S. aureus proteins fused to GFP, yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), or mCherry. Fusions of fluorescent proteins can be expressed either from replicative plasmids or from the chromosome. We chose to construct integrative plasmids that allow expression of fusion proteins from their native loci in the chromosome, under the control of their native promoters, so that the biology of the cell is altered as little as possible during localization studies. We have constructed an additional plasmid which enables the expression of proteins from the ectopic spa locus in the S. aureus chromosome, which can be used when introduction of a construct in the native chromosomal locus of a specific gene causes polar effects on downstream genes of the same operon.

MATERIALS AND METHODS

Bacterial strains, media, and growth conditions.

All strains used and constructed during this study are listed in Table 1. E. coli strain DH5α was grown on Luria-Bertani agar or in Luria-Bertani broth (Difco), supplemented with ampicillin (100 μg/ml) as required. S. aureus strains were grown on tryptic soy agar (TSA; Difco) at 37°C or in tryptic soy broth (TSB; Difco) at 37°C, with aeration. The medium was supplemented, when necessary, with erythromycin (10 μg/ml; Sigma), kanamycin and neomycin (50 μg/ml [each]; Sigma), 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal) (100 μg/ml; BDH Prolabo), or isopropyl-β-d-thiogalactopyranoside (IPTG) (various concentrations [indicated below]; BDH Prolabo).

TABLE 1.

Plasmids and strains used in this study

Plasmid or strain Relevant characteristics Source or reference
Plasmids
    pMutinCFP B. subtilis integrative vector for C-terminal CFP fusions; Ampr Eryr 11
    pMutinGFP+ B. subtilis integrative vector for C-terminal GFP fusions; Ampr Eryr 11
    pMutinYFP B. subtilis integrative vector for C-terminal YFP fusions; Ampr Eryr 11
    pROD17 Plasmid containing the mCherry gene D. Sherratt
    pDG792 Plasmid containing a kanamycin resistance gene 8
    pBCB1-GE S. aureus integrative vector for N- and C-terminal GFP fusions; Ampr Eryr This study
    pBCB2-YE S. aureus integrative vector for N- and C-terminal YFP fusions; Ampr Eryr This study
    pBCB3-CE S. aureus integrative vector for N- and C-terminal CFP fusions; Ampr Eryr This study
    pBCB4-ChE S. aureus integrative vector for N- and C-terminal mCherry fusions; Ampr Eryr This study
    pBCB5-YK S. aureus integrative vector for N- and C-terminal YFP fusions; Ampr Kanr This study
    pBCB6-CK S. aureus integrative vector for N- and C-terminal CFP fusions; Ampr Kanr This study
    pBCB7-ChK S. aureus integrative vector for N- and C-terminal mCherry fusions; Ampr Kanr This study
    pBCB8-GK S. aureus integrative vector for N- and C-terminal GFP fusions; Ampr Kanr This study
    pMAD E. coli-S. aureus shuttle vector with a thermosensitive origin of replication for Gram-positive bacteria; Ampr EryrlacZ 2
    pDH88 Plasmid containing the Pspac promoter and the lacI gene 10
    pMAD-spa pMAD derivative with the up- and downstream regions of spa This study
    pBCB13 pMAD-spa derivative with Pspac-lacI region from pDH88; Ampr EryrlacZ This study
    pGEreporter pBCB1-GE with an intergenic region between pbpB and SACOL1491 cloned downstream of the gfp gene; Ampr Eryr This study
    pPBP4t-YFP pBCB5-YK encoding a YFP fusion to the C terminus of truncated PBP4; Ampr Kanr This study
    pPBP4-mCh pBCB7-ChK encoding an mCherry fusion to the C terminus of PBP4; Ampr Kanr This study
    pEzrA-CFP pBCB3-CE encoding a CFP fusion to the C terminus of EzrA; Ampr Eryr This study
    pHM232 Plasmid containing the tetR-mCherry fusion 14
    pBCB13-TetRmCh pBCB13 derivative with tetR-mCherry; Ampr EryrlacZ This study
Strains
    E. coli strain
        DH5α recA endA1 gyrA96 thi-1 hsdR17 supE44 relA1 f80dlacZDM15 Gibco-BRL
    S. aureus strains
        RN4220 Restriction-deficient derivative of NCTC8325-4 R. Novick
        NCTC8325-4 Methicillin-sensitive S. aureus strain R. Novick
        COL MRSA strain 7
        RNpGEreporter RN4220 with integrated pGEreporter plasmid expressing GFP in the cytoplasm, under the control of Pspac; Eryr This study
        RNpPBP4t-YFP RN4220 with integrated pPBP4t-YFP plasmid encoding C-terminal PBP4-YFP fusion; Kanr This study
        RNpPBP4-mCh RN4220 with integrated pPBP4-mCh plasmid encoding C-terminal PBP4-mCherry fusion; Kanr This study
        RNpEzrA-CFP RN4220 with integrated pEzrA-CFP plasmid encoding C-terminal EzrA-CFP fusion; Eryr This study
        RNpPBP4t-YFP pEzrA-CFP RNpPBP4t-YFP with integrated pEzrA-CFP plasmid encoding C-terminal EzrA-CFP fusion; Eryr Kanr This study
        RN pBCB13-TetRmCh RN4220 with integrated pBCB13-TetRmCh; EryrlacZ This study
        NCTCΔspaTetRmCh NCTC8325-4 derivative with spa gene replaced by Pspac-tetR-mCherry-lacI This study

General procedures.

S. aureus RN4220 cells were transformed by electroporation as previously described (23). Constructs were transduced from RN4220 strains into S. aureus NCTC8325-4 by using the phage 80α, as previously described (16). Restriction enzymes were purchased from New England Biolabs, PCR was performed using Phusion high-fidelity DNA polymerase (Finnzymes), and sequencing reactions were carried out at Macrogen.

Construction of pBCB1-8 plasmids.

A set of eight integrative plasmids for N- and C-terminal fusions of fluorescent proteins to staphylococcal proteins was constructed using a series of pMUTIN plasmids as backbones (11).

We first amplified plasmid pMutinCFP by using primers BCBP1 and BCBP2 (see Table 2 for primer sequences) in order to remove the cfp stop codon and to introduce a multiple cloning site (MCS), containing StuI, NsiI, SphI, XhoI, NotI, NaeI, and SpeI restriction sites, at the 3′ end of the cfp gene. The SpeI restriction site carries a stop codon in frame with the cfp gene. The resulting PCR fragment was autoligated and used to transform DH5α. The Pspac promoter region, the cfp gene, and the new MCS were sequenced, and the resulting plasmid was named pBCB3-CE.

TABLE 2.

Primers used in this study

Primer Sequence (5′-3′)a
BCBP1 CTCGAGGCGGCCGCGCCGGCTGAGCACTAGTGCAGCCCGCC
BCBP2 TGGTTGAGCATGCATCAGGCCTCTTGTACAGCTCGTCCATGCCG
BCBP3 GACTACGCCATGGGTTCATGTAATCACTCCTTC
BCBP4 GCGAGATCTGGAAATAATTCTATGAGTCGC
BCBP5 CCTAACAGCACAAGAGCGG
BCBP6 GCATCAGGCCTTTTGTAGAGCTCATCCATG
BCBP7 GCATCAGGCCTCTTGTACAGCCGTCCATGCC
BCBP8 CTCGAGGCGGCCGCGCCGGCTGAGCACTAGTGCAGCCCGCC
BCBP9 CGATGGTACCGGCGCGCCGCTAGCATGGCTATCATTAAAGAGTTC
BCBP10 TGAGGATCCCTGGTTCAGTTGTAAATAACAATAC
BCBP11 GTATTAATGCAGCGCTAGCGACGAGAATTCACGTTCAAACAAACAATACACAACG
BCBP12 GTTTGAACGTGAATTCTCGTCGCTAGCGCTGCATTAATACCCCCTGTATG
BCBP13 TGCAGTCCATGGGTTAGAGCTCTCAATAATTTAAAAAAGC
BCBP14 GCTGAATTCTTCTACACAGCCCAGTCCAGAC
BCBP15 CAAATCGCCTAGCTGCGGCCGCCTCGGAGCGACTCGAGCTAGGCTCTAGAAACCCGGGAAAAGC
BCBP16 CTAGAGCCTAGCTCGAGTCGCTCCGAGGCGGCCGCAGCTAGGCGATTTGTTAACTTAGATCTTTATC
BCBP17 GCATGGCTAGCGACCTAACTCACATTAATTGCG
BCBP18 GCGCCCGAGGCCTTAATCCACTCAACATAAAATC
BCBP19 CGTGACACTAGTACAAGATTGATCATTTCC
BCBP20 CGCGGTACCGTTACGTATTACACATTCAAC
BCBP21 GCTGCGGTACCGGAGGCGCCGCAGGATTTTCTTTTTCTAAATAAACG
BCBP22 CGCGGTACCGGAAAAGGGAAGATTAACGC
BCBP23 CGCCGGTACCGGGAGGCGCCGCAGGATTTTCTTTTTCTAAATAAACG
BCBP24 CGGGTACCCGATATAGCGAGGTTCAGG
BCBP25 GGCGGTACCTTGCTTAATAACTTCTTCTTC
BCBP26 TACTCCCCGGGCTTACAATATGACATAAAATGC
BCBP27 TACTCCCCGGGCTTACTTGTACAGCTCGTCCATG
BCBP28 TGAGGATCCCCAGGCTTGTTGTTGTCTT
BCBP29 TGCAGTCCATGGTTGAAAAAGAAAAACATTTATTC
a

Restriction sites are underlined.

To allow for the use of more than one resistance marker, the erythromycin resistance cassette of pBCB3-CE was replaced by a kanamycin resistance cassette obtained from the pDG792 plasmid (8). For that purpose, we used primers BCBP3 and BCBP4 to amplify the entire pBCB3-CE plasmid by PCR, excluding the erythromycin marker, and the resulting product was digested with NcoI and BglII. Plasmid pDG792 was also digested with NcoI and BglII, and a 1.5-kb band containing the kanamycin resistance marker was isolated, ligated with the previous PCR product, and used to transform DH5α, resulting in plasmid pBCB6-CK.

Plasmids pBCB3-CE and pBCB6-CK were digested with KpnI and StuI to remove the cfp gene, which was replaced by the gfp, yfp, or mCherry gene without a stop codon, obtained from pMUTINGFP+ (11) (using primers BCBP5 and BCBP6), pMUTINYFP (11) (using primers BCBP5 and BCBP7), or pROD17 (a gift of D. Sherratt) (using primers BCBP8 and BCBP9), respectively, by PCR amplification. The resulting plasmids were named pBCB1-GE, pBCB8-GK, pBCB2-YE, pBCB5-YK, pBCB4-ChE, and pBCB7-ChK, for gfp (G), yfp (Y), or mCherry (Ch) insertion and for erythromycin (E) or kanamycin (K) resistance (Fig. 1). The primer BCBP9, which was used to amplify the mCherry gene, contained an extra NheI site that was added to the MCS upstream of the gene. The integrity of the Pspac promoter region, the gene encoding the fluorescent protein, and the MCS was confirmed by sequencing each plasmid.

FIG. 1.

FIG. 1.

Map and nomenclature of pBCB series of plasmids. (A) Map of pBCB1 to -8 plasmids. Genes that vary among plasmids, namely, those encoding the fluorescent proteins GFP, YFP, CFP, and mCherry and erythromycin and kanamycin resistance markers, are indicated by white arrows. Unique restriction sites in the multiple cloning sites are shown; asterisks indicate restriction sites which are not available/unique in all plasmids. Features common to all plasmids are indicated by gray arrows and boxes and include the inducible Pspac promoter (Pspac), the LacI repressor gene (lacI), the origin of replication in E. coli (oriColE1), an ampicillin resistance gene (bla), and terminators (t1t2, t0, and trpA). (B) Table indicating the fluorescent protein and resistance marker encoded by each pBCB plasmid (pBCB1 to pBCB8).

Construction of pBCB13 plasmid.

The pBCB13 plasmid was constructed by cloning a fragment containing the Pspac promoter, an MCS, and the lacI gene between the downstream and upstream regions of the spa gene into the thermosensitive plasmid pMAD (2). For that purpose, the downstream and upstream regions of spa, each of approximately 0.6 kb, were amplified from NCTC8325-4 genomic DNA by using the primer pairs BCBP10-BCBP11 and BCBP12-BCBP13, respectively. The two PCR products were joined in a second PCR, using primers BCBP10 and BCBP13, which also introduced two restriction sites (EcoRI and NheI) between the downstream and upstream regions. The resulting fragment was cloned into the pMAD vector by using BamHI and NcoI restriction enzymes, giving plasmid pMAD-spa, which was subjected to sequencing to confirm its integrity. Subsequently, a 1.7-kb DNA fragment containing the Pspac promoter followed by the MCS (with a new XhoI restriction site) and the lacI gene under the control of the constitutive Ppcn promoter was obtained from the pDH88 plasmid (10) by overlap PCR, firstly using primer pairs BCBP14-BCBP15 and BCBP16-BCBP17 and secondly using primer pair BCBP14-BCBP17. The final fragment was cloned into pMAD-spa by using the EcoRI and NheI restriction enzymes, giving rise to the vector pBCB13 (Fig. 2 A). The correct sequence of the cloned fragment was confirmed. It should be noted that the upstream and downstream regions of spa may vary among different strains. For example, the upstream region of spa in strain COL has a 63-bp insertion compared to that of the gene in NCTC8325-4.

FIG. 2.

FIG. 2.

Map and mode of use of pBCB13. (A) Map of the pBCB13 plasmid showing the upstream (UPspa) and downstream (DOWNspa) regions of the spa gene locus; the Pspac inducible promoter; the lacI gene under the control of a constitutive promoter; the lacZ gene, encoding a thermostable β-galactosidase; the erythromycin resistance marker (ermC); and an ampicillin resistance gene expressed in E. coli (bla). (B) Schematic representation of a two-step procedure for gene replacement using pBCB13. Integration of pBCB13 via homologous recombination can take place via the upstream (example shown in the figure) or downstream region. After a second recombination event, the spa gene will either remain in the chromosome (if the second recombination occurs through the upstream region, as in the given example) or be excised along with the plasmid (if the second recombination occurs through the downstream region) and replaced, in the example shown, by the tetR-mCherry construct.

Construction of RNpGEreporter.

A fragment of 0.6 kb containing an intergenic region of the S. aureus chromosome between the pbpB and SACOL1491 genes was amplified from S. aureus strain NCTC8325-4 by a PCR using primers BCBP18 and BCBP19. The PCR product was cloned into the pBCB1-GE plasmid by using the StuI and SpeI restriction enzymes. The resulting plasmid, which is nonreplicative in S. aureus, was named pGEreporter and was electroporated into S. aureus strain RN4220, where it integrated into the chromosome, generating strain RNpGEreporter, which expressed GFP not fused to any staphylococcal protein from the chromosome, under the control of the Pspac promoter.

Construction of RNpPBP4t-YFP.

A 3′ 0.7-kb fragment of the pbpD gene, which encodes penicillin-binding protein 4 (PBP4), was amplified from S. aureus strain COL by a PCR using primers BCBP20 and BCBP21 and then cloned into KpnI-digested pBCB5-YK, upstream of and in frame with the yfp gene. After confirmation of the correct orientation of the insert, the resulting plasmid, named pPBP4t-YFP, was sequenced and electroporated into S. aureus strain RN4220, where it integrated into the pbpD locus of the chromosome. The resulting strain, RNpPBP4t-YFP, expressed a full copy of pbpD fused to yfp under the control of the pbpD native promoter, while a truncated copy of the pbpD gene was placed under the control of the Pspac promoter.

Construction of RNpPBP4-mCh.

A fragment of 1.3 kb containing a full copy of the pbpD gene was amplified from S. aureus strain COL by a PCR using primers BCBP22 and BCBP23 and then cloned into KpnI-digested pBCB7-CHK, upstream of and in frame with the mCherry gene. The resulting plasmid, with a correctly oriented insert, was named pPBP4-mCh, sequenced, and electroporated into RN4220, where it integrated into the pbpD locus of the chromosome. The resulting strain, RNpPBP4-mCh, expressed the pbpD-mCherry fusion under the control of the native pbpD promoter, while the native pbpD gene was placed under the control of the Pspac promoter.

Construction of RNpEzrA-CFP.

A 3′ 0.56-kb fragment of the ezrA gene was amplified from S. aureus strain COL by a PCR using primers BCBP24 and BCBP25 and then cloned into KpnI-digested pBCB3-CE, upstream of and in frame with the cfp gene. After confirmation of the correct orientation of the insert, the resulting plasmid, named pEzrA-CFP, was sequenced and electroporated into RN4220, where it integrated into the ezrA locus of the chromosome. The resulting strain, RNpEzrA-CFP, expressed the ezrA-cfp fusion under the control of the native ezrA promoter, while a truncated copy of the ezrA gene was placed under the control of the Pspac promoter.

Construction of RNpPBP4t-YFP pEzrA-CFP.

The genomic region containing ezrA-cfp was transduced from S. aureus RNpEzrA-CFP into S. aureus RNpPBP4t-YFP by using phage 80α. Colonies were selected using erythromycin, kanamycin, and neomycin. The resulting strain, RNpPBP4t-YFP pEzrA-CFP, simultaneously expressed EzrA-CFP and PBP4-YFP, both from their native loci and under the control of their native promoters.

Construction of NCTCΔspaTetRmCh.

A 1.395-kb DNA fragment containing tetR-mCherry was amplified from plasmid pHM232 (14) by using primers BCBP26 and BCBP27, digested with XmaI, and cloned into pBCB13. After the correct orientation of the insert was confirmed, the resulting vector, pBCB13-TetRmCh, was sequenced and introduced into RN4220 by electroporation. The plasmid was then transferred to S. aureus NCTC8325-4 by transduction (selection at 30°C with 10 μg/ml of erythromycin). The exchange of the spa gene for the tetR-mCherry construct was obtained after a two-step homologous recombination process. In the first step, recombinants in which the pBCB13-TetRmCh plasmid had integrated into the chromosome were selected at the nonpermissive temperature of 43°C, using erythromycin (10 μg/ml). In the second step, cells were incubated at the permissive temperature of 30°C in the absence of antibiotic selection, and white, erythromycin-sensitive colonies in which the vector (and consequently the lacZ and erm genes) had been excised were selected for further screening (Fig. 2B). Screening for replacement of the spa gene by the tetR-mCherry construct was performed by PCR, using primer pairs BCBP28-BCBP29 and BCBP10-BCBP27.

Fluorescence microscopy.

S. aureus strains were grown overnight in TSB at 37°C with appropriate antibiotic selection. Cells were diluted 1:200 in fresh TSB (without antibiotic). For analysis of the RNpGEreporter strain, increasing concentrations of IPTG (ranging from 0 mM to 1 mM) were added to the culture. NCTCΔspaTetRmCh cultures were supplemented with 0.5 mM IPTG. After reaching an optical density at 600 nm (OD600) of 0.8, 1 ml of culture was pelleted and resuspended in 20 μl of phosphate-buffered saline (PBS). Cell suspension (1 μl) was placed on a thin layer of 1% agarose in PBS mounted on a microscope slide. Phase-contrast and fluorescence visualization of the live cells was performed using a Zeiss Axio Observer.Z1 microscope equipped with a Plan-Apochromat objective (100×/1.4 Oil Ph3; Zeiss). Semrock GFP, CFP, YFP, and Texas Red filters were used. Image acquisition was done using a Photometrics CoolSNAP HQ2 camera (Roper Scientific) attached to the microscope and Metamorph v. 7.5 software (Molecular Devices). ImageJ software (1) was used for the quantification of total fluorescence per cell in strain RNpGEreporter grown in the presence of different concentrations of IPTG. For this purpose, the mean fluorescence per pixel of each cell was measured. This value was corrected by subtracting the mean fluorescence of the background per pixel. The average for at least 400 cells was calculated for cells grown at each IPTG concentration used.

RESULTS AND DISCUSSION

Construction of integration vectors for chromosomal expression of fluorescent derivatives of staphylococcal proteins.

A set of eight integrative plasmids for expression of staphylococcal proteins from their native chromosomal loci was constructed, using a series of pMUTIN plasmids constructed by M. Kaltwasser and colleagues as backbones (11). We first introduced a multiple cloning site (with StuI, NsiI, SphI, XhoI, NotI, NaeI, and SpeI restriction sites) downstream of the cfp gene in plasmid pMUTIN-CFP, generating plasmid pBCB3-CE (Table 1 and Fig. 1). Introduction of this multiple cloning site resulted in the deletion of the stop codon from the cfp gene and the introduction of a new, in-frame stop codon, included in the SpeI restriction site. The pMUTIN-CFP plasmid already had a multiple cloning site (with Acc65I, KpnI, AfeI, and ClaI restriction sites) upstream of cfp to allow fusion of the fluorescent protein to the C terminus of a protein of interest. The additional multiple cloning site which we introduced in pBCB3-CE makes it possible to fuse the fluorescent protein to the N terminus of a protein of interest. We then replaced the erythromycin resistance marker present in pBCB3-CE with a kanamycin resistance marker, which was excised from plasmid pDG792 (8), generating plasmid pBCB6-CK (Table 1 and Fig. 1). The availability of two different resistance markers allows for the possibility of coexpressing fluorescent derivatives of two different proteins in the same staphylococcal cell for colocalization studies. The cfp gene in plasmids pBCB3-CE and pBCB6-CK was subsequently replaced with gfp (from pMUTIN-GFP+ [11]), yfp (from pMUTIN-YFP [11]), and mCherry (from pROD17 [a gift of D. Sherratt]), generating the set of plasmids described in Table 1 and Fig. 1. An additional NheI restriction site was introduced into the multiple cloning site upstream of mCherry during the cloning process.

Genes encoding proteins of interest can be cloned downstream or upstream of the genes encoding the fluorescent proteins on plasmids pBCB1 to -8. When the resulting plasmids are introduced into S. aureus and integrated into the chromosome, fusions to the N termini of proteins of interest are placed under the control of the Pspac promoter, while fusions to the C termini of proteins of interest remain under the control of their native promoters. In the latter case, if the gene of interest is part of an operon, the downstream genes will be placed under the control of the IPTG-inducible Pspac promoter.

Interruption of an operon by integration of a plasmid can often disrupt normal expression of different proteins encoded by that operon. For that reason, it may be useful to express a fluorescent derivative of a protein of interest from an ectopic locus in the chromosome. We constructed plasmid pBCB13 to allow insertion of DNA fragments into the spa locus of the S. aureus chromosome. The spa gene encodes the nonessential, cell-wall-attached protein A (15). Although protein A has a role in S. aureus virulence (6), in vitro studies are often done using spa mutants, as protein A is an IgG binding protein (15) and thus can interfere in assays that require the use of antibodies.

Plasmid pBCB13 was constructed based on the backbone of the pMAD plasmid (2) by cloning the Pspac promoter, followed by an MCS and the lacI gene, between the down- and upstream regions of the spa gene (Table 1 and Fig. 2A). DNA fragments encoding fusions of fluorescent proteins with a protein of interest can be subcloned from the pBCB1 to -8 plasmids into pBCB13, downstream of the Pspac promoter. The chromosomal spa gene can then be exchanged, by homologous recombination, for the fluorescent fusion present in the plasmid (Fig. 2B). Plasmid pBCB13 can also be used to place genes encoding wild-type (nonfluorescent) proteins in the spa locus, namely, for complementation of mutants which require a low copy number of the gene and therefore cannot be complemented successfully from replicative plasmid vectors.

Expression of fluorescent proteins by use of the pBCB series of plasmids.

We tested the constructed pBCB plasmids by expressing the four fluorescent proteins, GFP, YFP, CFP, and mCherry, using either the erythromycin or the kanamycin resistance marker. We chose to express two of the fluorescent proteins in the cytoplasm of S. aureus, either alone (GFP) or fused to the heterologous protein TetR (mCherry). We also fused mCherry, YFP, and CFP to native staphylococcal proteins (PBP4 and EzrA) expected to have a specific cellular localization, namely, at the division septum. In order to express free GFP in the cytoplasm of S. aureus under the control of the IPTG-inducible promoter Pspac, we cloned the intergenic region downstream of pbpB into pBCB1-GE. The resulting plasmid, pGEreporter, was introduced into RN4220, where it recombined into the chromosome through the intergenic region, leading to the expression of GFP not fused to any protein, under the control of Pspac. Figure 3 A shows that green fluorescence was present in the cytoplasm of the RNpGEreporter strain and was indeed dependent on the concentration of IPTG added to the growth medium (Fig. 3B). This fluorescence varied between 20-fold (0.1 mM IPTG) and 40-fold (1 mM IPTG) higher than the autofluorescence of wild-type cells not expressing GFP (data not shown).

FIG. 3.

FIG. 3.

Expression of fluorescent proteins from the pBCB series of plasmids. (A) S. aureus RNpGEreporter strain (constructed using pBCB1-GE) expressing free GFP in the cytoplasm under the control of the IPTG-inducible Pspac promoter, grown in the presence of increasing concentrations of IPTG (from 0 to 1 mM). (B) Quantification of GFP fluorescence in at least 400 cells for each IPTG concentration used showed that expression of gfp increases with increasing IPTG concentrations. (C) S. aureus RNpEzrA-CFP strain (constructed using pBCB3-CE) expressing EzrA-CFP, which localized to the division septum. (D) S. aureus RNpPBP4t-YFP strain (constructed using pBCB5-YK) expressing PBP4-YFP, which localized to the septum. (E) S. aureus RNpPBP4-mCh strain (constructed using pBCB7-ChK) expressing PBP4-mCherry, which localized to the septum. (F) S. aureus NCTCΔspaTetRmCh strain (constructed using pBCB13) expressing TetR-mCherry in the cytoplasm under the control of the IPTG-inducible Pspac promoter, grown in the presence of 0.5 mM IPTG. All images are false colored. Bars, 1 μm.

Plasmids pBCB3-CE, pBCB5-YK, and pBCB7-ChK were used to clone the genes encoding the S. aureus homologue of the B. subtilis EzrA protein (a protein involved in cell division [12]), a truncated version of PBP4 (a cell wall synthetic enzyme [24]), and a full version of PBP4 (resulting in the expression of the fluorescent derivative of PBP4 under the control of the native promoter and the wild-type copy of PBP4 under the control of Pspac), respectively. Figures 3C, D, and E show that the three vectors led to the expression of fluorescent derivatives of the staphylococcal proteins that localized at the division septum. These results corresponded to the expected localization for both EzrA and PBP4, as the first interacts with the division ring in B. subtilis (9) and the latter is involved in cell wall synthesis, a process that takes place at the septum in S. aureus (17).

In order to test plasmid pBCB13, we cloned tetR, encoding the repressor of the tetracycline-inducible promoter, fused to mCherry downstream of the Pspac promoter, between the down- and upstream regions of the spa gene. The resulting plasmid, pBCB13-TetRmCh, was introduced into NCTC8325-4 and used to promote the allelic exchange of the spa gene for the terR-mCherry construct. The resulting strain, NCTCΔspaTetRmCh, does not have any resistance marker left in the chromosome, allowing the easy introduction of additional constructs encoding other mutations or fluorescent derivatives in other chromosomal loci. In the absence of operators of the tetracycline-inducible promoter, TetR is expected to localize in the cytoplasm, as observed (Fig. 3F). The fluorescence obtained was 50-fold higher than the autofluorescence of RN4220 cells not expressing mCherry (data not shown).

Covisualization of different fluorescent proteins expressed in S. aureus cells.

The availability of different fluorescent proteins that can be expressed in S. aureus, together with the possibility of inserting genes for protein fusions into the chromosome by use of either a kanamycin or erythromycin resistance marker (using pBCBs 1 to 8), or even leaving no residual antibiotic resistance marker in the chromosome (using pBCB13), allows the construction of S. aureus strains simultaneously expressing protein fusions to more than one fluorescent protein. In order to show that different fluorescent proteins could be covisualized in the same microscopy image, without overlap of the fluorescence emitted from one fluorescent protein with the channel used to detect a second fluorescent protein, we mixed cultures of S. aureus cells expressing TetR-mCherry, PBP4-YFP, and EzrA-CFP (Fig. 4 A) or TerR-mCherry and GFP (Fig. 4B). In both cases, the autofluorescence from S. aureus cells, as well as the overlap between different channels, was negligible, showing that mCherry, YFP, and CFP can be used in a single experiment for colocalization studies, and the same applies to mCherry and GFP. GFP fluorescence overlaps with the channels used to detect CFP and YFP (data not shown) and therefore is not ideal for use in combination with these two proteins.

FIG. 4.

FIG. 4.

Covisualization of S. aureus cells labeled with different fluorescent reporters. Exponentially growing cultures of cells expressing different fluorescent proteins were mixed and placed on the same microscope slide. (A) (Left to right) Phase-contrast image of a mixed culture of S. aureus strains expressing TetR-mCherry (NCTCΔspaTetRmCh), EzrA-CFP (RNpEzrA-CFP), and PBP4-YFP (RNpPBP4t-YFP) fusion proteins; overlay of mCherry, CFP, and YFP fluorescence from the same strains; mCherry fluorescence from NCTCΔspaTetRmCh cells; CFP fluorescence from RNpEzrA-CFP cells; and YFP fluorescence from RNpPBP4t-YFP cells. (B) (Left to right) Phase-contrast image of a mixed culture of S. aureus strains expressing free GFP (RNpGEreporter) or TetR-mCherry (NCTCΔspaTetRmCh) in the cytoplasm; overlay of mCherry and GFP fluorescence from the same strains; mCherry fluorescence from NCTCΔspaTetRmCh cells; and GFP fluorescence from RNpGEreporter cells. (C) (Left to right) Phase-contrast image of S. aureus RNpPBP4t-YFP pEzrA-CFP, which expresses both PBP4t-YFP and EzrA-CFP fusion proteins; overlay of YFP and CFP fluorescence; YFP fluorescence from PBP4-YFP; and CFP fluorescence from EzrA-CFP. Arrowheads point to examples of cells in which PBP4 and EzrA do not colocalize. All images are false colored. Bars, 1 μm.

We also generated strain RNpPBP4t-YFP pEzrA-CFP, which simultaneously expresses both PBP4-YFP and EzrA-CFP fusions (Fig. 4C). This strain exemplifies the advantage of visualizing different proteins in the same cell. Although both EzrA-CFP and PBP4-YFP localized to the division septa, EzrA (an early cell division protein) was seen arriving at the septum before PBP4 (involved in the last stages of cell wall synthesis).

Final remarks.

The fluorescent reporter systems described in this work allow studies of the cellular localization of S. aureus proteins fused to one of four different fluorescent proteins (GFP, CFP, YFP, or mCherry), using one of two different resistance markers (kanamycin or erythromycin), and expressed either from their native chromosomal locus or from the ectopic spa locus. We have shown that GFP and mCherry or CFP, YFP, and mCherry can be covisualized in a single image and that these fluorescent proteins can be used for studies of the colocalization of at least two proteins in a single staphylococcal cell.

It is worth mentioning that plasmid pBCB13 can be used not only for the ectopic expression of fluorescent derivatives of proteins of interest, as described above, but also to complement different mutants of S. aureus. Complementation of various mutants with the corresponding genes expressed from a replicative plasmid may not lead to full recovery of the affected phenotypes. The lack of success in complementation experiments using plasmid-borne genes may be due to the fact that the genes are not under the control of their native promoters or that the gene dosage is too high. Having a single copy of the complementing gene in the chromosome under the control of an inducible promoter should enable us to more accurately reproduce the wild-type gene dosage.

The toolbox described in this paper should facilitate future cell biology studies of the pathogenic bacterium S. aureus.

Acknowledgments

We thank Simon Foster (pDG792), Wolfgang Schumann (who made the pMUTIN series available at the Bacillus Genetic Stock Center), David Sherratt (pROD17), and Jeff Errington (pHM232) for the generous gifts of plasmids. We also thank D.-J. Scheffers, S. Filipe, and P. Reed for helpful comments.

This work was funded by grant PTDC/BIA-MIC/67845/2006 from the Fundação para a Ciência e Tecnologia (FCT) to M.G.P. P.M.P. was supported by FCT fellowship SFRH/BD/41119/2007, H.V. was supported by FCT fellowship SFRH/BD/38732/2007, and A.M.J. was supported by FCT fellowship SFRH/BD/28480/2006.

Footnotes

▿

Published ahead of print on 7 May 2010.

REFERENCES

  • 1.Abramoff, M. D., P. J. Magelhaes, and S. J. Ram. 2004. Image processing with ImageJ. Biophoton Int. 11:36-42. [Google Scholar]
  • 2.Arnaud, M., A. Chastanet, and M. Debarbouille. 2004. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, Gram-positive bacteria. Appl. Environ. Microbiol. 70:6887-6891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bateman, B. T., N. P. Donegan, T. M. Jarry, M. Palma, and A. L. Cheung. 2001. Evaluation of a tetracycline-inducible promoter in Staphylococcus aureus in vitro and in vivo and its application in demonstrating the role of sigB in microcolony formation. Infect. Immun. 69:7851-7857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chambers, H. F. 2001. The changing epidemiology of Staphylococcus aureus? Emerg. Infect. Dis. 7:178-182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cheung, A. L., C. C. Nast, and A. S. Bayer. 1998. Selective activation of sar promoters with the use of green fluorescent protein transcriptional fusions as the detection system in the rabbit endocarditis model. Infect. Immun. 66:5988-5993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Foster, T. J. 2005. Immune evasion by staphylococci. Nat. Rev. Microbiol. 3:948-958. [DOI] [PubMed] [Google Scholar]
  • 7.Gill, S. R., D. E. Fouts, G. L. Archer, E. F. Mongodin, R. T. Deboy, J. Ravel, I. T. Paulsen, J. F. Kolonay, L. Brinkac, M. Beanan, R. J. Dodson, S. C. Daugherty, R. Madupu, S. V. Angiuoli, A. S. Durkin, D. H. Haft, J. Vamathevan, H. Khouri, T. Utterback, C. Lee, G. Dimitrov, L. Jiang, H. Qin, J. Weidman, K. Tran, K. Kang, I. R. Hance, K. E. Nelson, and C. M. Fraser. 2005. Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing methicillin-resistant Staphylococcus epidermidis strain. J. Bacteriol. 187:2426-2438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Guerout-Fleury, A. M., K. Shazand, N. Frandsen, and P. Stragier. 1995. Antibiotic-resistance cassettes for Bacillus subtilis. Gene 167:335-336. [DOI] [PubMed] [Google Scholar]
  • 9.Haeusser, D. P., R. L. Schwartz, A. M. Smith, M. E. Oates, and P. A. Levin. 2004. EzrA prevents aberrant cell division by modulating assembly of the cytoskeletal protein FtsZ. Mol. Microbiol. 52:801-814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Henner, D. J. 1990. Inducible expression of regulatory genes in Bacillus subtilis. Methods Enzymol. 185:223-228. [DOI] [PubMed] [Google Scholar]
  • 11.Kaltwasser, M., T. Wiegert, and W. Schumann. 2002. Construction and application of epitope- and green fluorescent protein-tagging integration vectors for Bacillus subtilis. Appl. Environ. Microbiol. 68:2624-2628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Levin, P. A., I. G. Kurtser, and A. D. Grossman. 1999. Identification and characterization of a negative regulator of FtsZ ring formation in Bacillus subtilis. Proc. Natl. Acad. Sci. U. S. A. 96:9642-9647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Malone, C. L., B. R. Boles, K. J. Lauderdale, M. Thoendel, J. S. Kavanaugh, and A. R. Horswill. 2009. Fluorescent reporters for Staphylococcus aureus. J. Microbiol. Methods 77:251-260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Murray, H., and J. Errington. 2008. Dynamic control of the DNA replication initiation protein DnaA by Soj/ParA. Cell 135:74-84. [DOI] [PubMed] [Google Scholar]
  • 15.Navarre, W. W., and O. Schneewind. 1999. Surface proteins of gram-positive bacteria and mechanisms of their targeting to the cell wall envelope. Microbiol. Mol. Biol. Rev. 63:174-229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Oshida, T., and A. Tomasz. 1992. Isolation and characterization of a Tn551-autolysis mutant of Staphylococcus aureus. J. Bacteriol. 174:4952-4959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Pinho, M. G., and J. Errington. 2003. Dispersed mode of Staphylococcus aureus cell wall synthesis in the absence of the division machinery. Mol. Microbiol. 50:871-881. [DOI] [PubMed] [Google Scholar]
  • 18.Projan, S. 2006. Antibiotic resistance in the staphylococci, p. 587-597. In V. A. Fischetti, R. P. Novick, J. J. Ferretti, D. A. Portnoy, and J. I. Rood (ed.), Gram-positive pathogens. ASM Press, Washington, DC.
  • 19.Schneider, W. P., S. K. Ho, J. Christine, M. Yao, A. Marra, and A. E. Hromockyj. 2002. Virulence gene identification by differential fluorescence induction analysis of Staphylococcus aureus gene expression during infection-simulating culture. Infect. Immun. 70:1326-1333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tenover, F. C., and R. J. Gorwitz. 2006. The epidemiology of Staphylococcus infections, p. 526-534. In V. A. Fischetti, R. P. Novick, J. J. Ferretti, D. A. Portnoy, and J. I. Rood (ed.), Gram-positive pathogens. ASM Press, Washington, DC.
  • 21.Tsien, R. Y. 1998. The green fluorescent protein. Annu. Rev. Biochem. 67:509-544. [DOI] [PubMed] [Google Scholar]
  • 22.Tzagoloff, H., and R. Novick. 1977. Geometry of cell division in Staphylococcus aureus. J. Bacteriol. 129:343-350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Veiga, H., and M. G. Pinho. 2009. Inactivation of the SauI type I restriction-modification system is not sufficient to generate Staphylococcus aureus strains capable of efficiently accepting foreign DNA. Appl. Environ. Microbiol. 75:3034-3038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wyke, A. W., J. B. Ward, M. V. Hayes, and N. A. Curtis. 1981. A role in vivo for penicillin-binding protein-4 of Staphylococcus aureus. Eur. J. Biochem. 119:389-393. [DOI] [PubMed] [Google Scholar]
  • 25.Zapun, A., T. Vernet, and M. G. Pinho. 2008. The different shapes of cocci. FEMS Microbiol. Rev. 32:345-360. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES