Abstract
Insufficient diagnostic sensitivity and specificity coupled with the potential for cross-reactivity among closely related Anaplasma species has made the accurate determination of infection status problematic. A method for the development of simplex and duplex real-time quantitative reverse transcriptase PCR (qRT-PCR) assays for the detection of A. marginale and A. phagocytophilum 16S rRNA in plasma-free bovine peripheral blood samples is described. The duplex assay was able to detect as few as 100 copies of 16S rRNA of both A. marginale and A. phagocytophilum in the same reaction. The ratio of 16S rRNA to 16S DNA copies for A. marginale was determined to be 117.9:1 (95% confidence interval [95% CI], 100.7:1, 135.2:1). Therefore, the detection limit is the minimum infective unit of one A. marginale bacterium. The duplex assay detected nonequivalent molar ratios as high as 100-fold. Additionally, the duplex assay and a competitive enzyme-linked immunosorbent assay (cELISA) were used to screen 237 samples collected from herds in which anaplasmosis was endemic. When the cELISA was evaluated by the results of the qRT-PCR, its sensitivity and specificity for the detection of A. marginale infection were found to be 65.2% (95% CI, 55.3%, 75.1%) and 97.3% (95% CI, 94.7%, 99.9%), respectively. A. phagocytophilum infection was not detected in the samples analyzed. One- and two-way receiver operator characteristic curves were constructed in order to recommend the optimum negative cutoff value for the cELISA. Percentages of inhibition of 20 and 15.3% were recommended for the one- and two-way curves, respectively. In conclusion, the duplex real-time qRT-PCR assay is a highly sensitive and specific diagnostic tool for the accurate and precise detection of A. marginale and A. phagocytophilum infections in cattle.
Many species of the genus Anaplasma induce different and distinct forms of anaplasmosis in cattle. The Office International des Epizooties (OIE) Animal Health Code categorizes anaplasmosis as a notifiable disease due to its socioeconomic impact and international trade restrictions (22). However, the significance of anaplasmosis is frequently underestimated due to seasonal outbreaks and stability in areas of endemicity (28). Anaplasmosis, caused by Anaplasma marginale, is one of the most prevalent tick-transmitted rickettsial diseases of cattle worldwide (18). Vaccination with Anaplasma centrale is a common practice used to reduce morbidity in cattle subsequently infected with A. marginale (21). Infection with one Anaplasma species does not confer immunity from infection with other Anaplasma species. Coinfection with two or more Anaplasma species occurs in cattle due to ubiquitous disease susceptibility and animal husbandry practices such as vaccination with live A. centrale bacteria in countries and regions such as Israel, Africa, Australia, and parts of South America (17).
Although A. marginale has significant economic and health impacts for infected cattle worldwide, A. phagocytophilum also causes self-limiting, economically significant disease (within 9 days postinfection), and persistent infection of cattle with this pathogen has also been reported (14, 24, 26, 35). Cattle that survive acute infection by A. marginale and A. phagocytophilum progress to become subclinical carriers of infection. The carrier animals can serve as reservoirs of infection for naïve cattle despite vaccination with live A. centrale bacteria and treatment in countries where domestic ruminants are vaccinated (3, 4, 17, 18). In the absence of effective treatment strategies and vaccine availability, and in areas where vector control is problematic, anaplasmosis control strategies are focused primarily on the determination of infection status and the prevention of transmission (27a).
Disease prevention strategies are centered on reliable diagnostic tests for accurately and precisely identifying infected cattle. The subinoculation of whole blood into splenectomized cattle has served as the gold standard for the determination of A. marginale infection status. Currently, one of the most common diagnostic techniques used in commercial lab settings, the competitive enzyme-linked immunosorbent assay (cELISA), relies on the identification of bovine anti-major surface protein 5 (anti-MSP5) antibodies, which recognize the MSP5 protein epitope of A. marginale (16). Due to the establishment of carrier states in infected animals, the cELISA is regarded as a reliable screening test for identifying A. marginale-infected cattle. However, cross-reactivity among Anaplasma species has been reported when the cELISA is used to classify cattle infected with A. marginale and A. phagocytophilum (9, 34). Additionally, the lag time between infection and the anti-MSP5 antibody response may allow for the misclassification of cattle subacutely infected with Anaplasma species (5, 27a).
The selection of an appropriate target for the accurate and precise determination of infection status is critical for the development of a robust diagnostic method. Due to their role in the translation of genetic code, ribosomes, as well as rRNA, are present at high copy numbers, in contrast to a single copy of DNA. The extensive conservation of the primary and secondary structures of rRNA implies an ancient origin of these macromolecules (13). The 16S rRNA gene segment is a common structure of bacterial rRNA genes, including that of the genus Anaplasma (29). Isolates of A. marginale and A. phagocytophilum have been shown to have identical 16S rRNA gene sequences, but this sequence differs considerably among closely related Anaplasma species (7, 10). However, sequence analysis has shown that there are highly conserved and specific regions of the 16S rRNA gene segment of the family Anaplasmataceae (32).
In this study, methods are described for the development of simplex real-time quantitative reverse transcriptase PCR (qRT-PCR) assays to detect the 16S rRNA gene sequences of A. marginale and A. phagocytophilum and of a duplex assay for the simultaneous detection of the 16S rRNA gene sequences of these two organisms in plasma-free bovine peripheral blood samples. The duplex real-time qRT-PCR assay and a cELISA were also used to screen field samples from cattle originating from herds in which anaplasmosis is endemic. This analysis aided in evaluating the differences between the duplex assay and the cELISA as anaplasmosis diagnostic tools.
MATERIALS AND METHODS
This study was approved by the Kansas State University (KSU) Institutional Animal Care and Use Committee (protocol 2517) and the Institutional Biosafety Committee (protocol 524).
Design of primers and probes for the RT-PCR assays.
The 16S rRNA gene sequences for A marginale (accession no. M60313) and A. phagocytophilum (accession no. M73220) were downloaded from the GenBank nucleotide sequence database and were aligned with those of other related species of the genera Anaplasma and Ehrlichia by use of the University of Wisconsin Genetics Computer Group programs PileUp and Pretty (32). Anaplasma and Ehrlichia genus-specific regions were identified for the design of PCR primers. Species-specific regions were used to design TaqMan probes in support of real-time pathogen detection. TaqMan probes were designed with specific fluorescent reporter dyes and quencher molecules to facilitate the duplex assay (Table 1).
TABLE 1.
TaqMan primers and probes used in the development of the simplex and duplex qRT-PCR assays
| TaqMan primer/probea | Base sequence | Length (nt) | Tmc (°C) |
|---|---|---|---|
| Anaplasma forward primer | 5′-CTCAGAACGAACGCTGG-3′ | 17 | 53.3 |
| Anaplasma reverse primer | 5′-CATTTCTAGTGGCTATCCC-3′ | 19 | 49.7 |
| A. marginale probe | 5′-/56-FAM/CGCAGCTTGCTGCGTGTATGGT/3BHQ_1/-3′b | 22 | 62.8 |
| A. phagocytophilum probe | 5′-/5TexRd-XN/TTGCTATAAAGAATAATTAGTGGCAGACG/3BHQ_2/-3′b | 29 | 55.4 |
Primers and probes were synthesized by Integrated DNA Technologies Inc.; Coralville, IA.
The base sequence is recorded with reporter and quencher molecules. FAM, 6-carboxyfluorescein.
Tm, melting temperature in 50 mM NaCl.
A. marginale and A. phagocytophilum positive-control plasmids.
A whole-blood sample collected from a cow infected with the Florida isolate of A. marginale was previously stored at −80°C in a 16.7% glycerol solution. Genomic DNA was isolated from 300 μl of this sample by use of a Puregene DNA purification kit (Gentra Systems, Minneapolis, MN) according to the manufacturer's recommendations. The isolated DNA pellet was rehydrated with 100 μl of the kit-supplied DNA hydration solution and was stored at −80°C.
A. marginale genomic DNA was used as the template to amplify a 0.48-kb 16S rRNA gene segment. The PCR was performed with 200 ng of genomic DNA by use of the AmpliTaq PCR reagent kit (Applied Biosystems, Foster City, CA). Thermal cycles were defined by an initial denaturation cycle for 3 min at 94°C, followed by 45 cycles of 94°C for 30 s, 52°C for 30 s, and 72°C for 3 min. The PCR product was resolved on a 1% agarose gel in 1× Tris-acetate EDTA buffer (40 mmol/liter Tris-acetate, 1 mmol/liter EDTA [pH 8.0]) containing 0.1 μg/ml of ethidium bromide and was visualized under UV light (31). The amplicon was ligated into chemically competent Escherichia coli by use of a PCR product cloning kit (TOPO TA cloning kit with TOP10 and pCR 2.1; TOPO version U; Invitrogen Corp., Carlsbad, CA). The E. coli strain was streaked onto LB medium plates containing ampicillin (100 μg/ml) and 20 μl of kanamycin (50 μg/ml), which had been applied to the surfaces of the plates. Transformants containing the A. marginale recombinant plasmid were isolated and propagated at 37°C in an LB medium solution containing kanamycin (50 μg/ml).
An A. phagocytophilum positive-control plasmid was used in the development of this qRT-PCR assay as previously described (32). Similarly, transformants of the A. phagocytophilum plasmid were reestablished by growth in the LB medium solution. A boiling preparation method (31) was used to extract plasmid DNA from the transformants. Plasmid DNA was linearized by restriction enzyme digestion using SpeI and BamHI for A. marginale and A. phagocytophilum, respectively (31). The sites for these restriction enzymes are located at the 3′ ends of the insert in the multiple-cloning-site regions of the plasmids but are absent within the cloned inserts. This allowed the plasmids to linearize downstream of the inserts for use in the synthesis of in vitro transcripts with T7 polymerase. The A. marginale plasmid insert was verified by sequencing with a thermosequencing reaction kit (USB Corp., Cleveland, OH) according to the manufacturer's recommendations. The nucleotide sequences reported in the GenBank database were compared with the nucleotide sequence results for the plasmid insert of A. marginale and, as previously reported, for the plasmid insert of A. phagocytophilum (32).
In vitro transcripts.
In vitro transcripts were prepared for use in the development of the qRT-PCR assay according to the following procedures. Linearized inserts of A. marginale and A. phagocytophilum were purified with a phenol-chloroform extraction technique (30). Two micrograms of each of the purified linear inserts was used to generate recombinant in vitro transcripts by using a T7 polymerase kit as recommended by the manufacturer (MEGAscript kit; Ambion, Inc., Austin, TX). The recombinant in vitro transcripts were purified from plasmid DNA by treatment with DNase I and by use of an RNA purification kit (MEGAclear kit; Ambion, Inc., Austin, TX).
Real-time qRT-PCR.
TaqMan-based real-time amplification (15, 20) assays were performed by use of a SmartCycler II system (Cepheid, Sunnyvale, CA). Simplex and duplex real-time qRT-PCR assays were developed by use of previously designed forward and reverse primers (32) and TaqMan probes designed as part of this study (Table 1). A commercially available RT-PCR assay kit (SuperScript III reverse transcriptase; Invitrogen Corporation, Carlsbad, CA) was used for development of the simplex and duplex assays. Standard curves of RNA concentrations were made from 10-fold serial dilutions of known quantities of the in vitro transcripts (ranging from 1 billion molecules to 1 molecule) and were analyzed in triplicate in order to optimize these assays for sensitivity in each simplex reaction and for species specificity for duplex pathogen detection. The temperature cycles used for the qRT-PCR assay were an initial cDNA generation cycle at 48°C for 30 min and 94°C for 3 min, followed by 45 cycles of 94°C for 15 s, 50°C for 30 s, and 60°C for 60 s. RT-PCR product formation was monitored in real time by measuring the emitted fluorescence associated with exponential growth of the PCR product during the log-linear phase. A reaction was qualified as positive for the presence of a template when 7 fluorescent units for the emission channel of the fluorescent probe were detected. The PCR cycle at which fluorescence occurred, which was template concentration dependent in the reaction, was regarded as the cycle threshold (CT). Linear regression was used to correlate the reported CT with the number of 16S rRNA template molecules in the 25-μl reaction mixture.
Evaluation of blood samples from herds in which anaplasmosis is endemic.
Field sample collection was arranged during phone consultation with producers seeking recommendations for the control of anaplasmosis. The collection of samples from herds in which anaplasmosis is endemic resulted in the screening of 237 cattle from northeastern and southeastern Kansas during September and October of 2008. These samples were collected from adult cows and bulls of Bos taurus ancestry. Samples were collected in evacuated tubes without additives and in evacuated tubes containing EDTA during 2008. Typically, the samples were collected on site, transported on ice, and processed within 48 h. However, some samples were shipped overnight on ice packs and were processed within 48 h of receipt.
Anaplasmosis cELISA.
Serum was collected from evacuated tubes without additives and was analyzed by cELISA. A commercially available cELISA (Anaplasma antibody test kit, cELISA; VMRD Inc., Pullman, WA) was used in accordance with the method described by the OIE and recommended by the manufacturer (22, 39). The optical density (OD) of each well was measured by use of an ELISA plate reader at a wavelength of 620 nm. The percentage of inhibition of each sample was calculated as 100 − [(sample OD × 100)/(mean OD of the negative-control sample)].
A binary reporting format was used to report cELISA results. A percentage of inhibition of <30% was recorded as negative (0), whereas ≥30% inhibition was recorded as positive (1) (22, 34, 39).
RNA extraction.
Samples collected in evacuated tubes containing EDTA were centrifuged at 2,750 × g and 4°C for 5 min. Plasma was removed by a single-use pipette without disturbing the buffy coat and red blood cell fraction. The plasma-free sample was vortexed to mix the cell fractions. RNA was extracted from the homogenous, plasma-free sample according to the manufacturer's recommendations for a commercially available product (TRI reagent; Sigma-Aldrich, St. Louis, MO). The RNA pellet was resolubilized with 50 μl of nuclease-free water. Samples from a known A. marginale carrier and a naïve cow were extracted and analyzed simultaneously for monitoring of the qRT-PCR assay performance and the quality of the RNA extraction technique. Samples were stored in a −80°C freezer until analysis by qRT-PCR. Extracted samples were not subjected to DNase treatment; however, contamination was assessed by comparing qRT-PCR and qPCR assay results when reverse transcriptase (SuperScript III reverse transcriptase; Invitrogen Corporation, Carlsbad, CA) was replaced with Taq polymerase (Platinum Taq DNA polymerase; Invitrogen Corporation, Carlsbad, CA) in the optimized A. marginale simplex assay.
Ratio of 16S rRNA to 16S DNA of A. marginale.
The number of 16S rRNA molecules present in Anaplasma species is unknown. This results in uncertainty in determining the minimum detection sensitivity of the assay in a 250-μl plasma-free sample of bovine peripheral blood. A comparison was made by extracting RNA and DNA from a 200-μl sample of 10 plasma-free blood samples preserved in 50% glycerol as described in this paper. The extraction of RNA proceeded as described above. DNA was extracted by use of a Wizard SV genomic DNA purification system (Promega Corporation, Madison, WI) according to the manufacturer's instructions with a protocol modification for blood products (23). The extracted DNA and RNA were each rehydrated in 500 μl of nuclease-free water.
Stability of RNA in plasma-free blood samples stored in 50% glycerol.
The stability of RNA from whole-blood samples stored in glycerol is unknown. Ten samples were processed on the day of sampling with the RNA extraction method described above and the optimized A. marginale simplex assay. Aliquots of these samples were stored in 50% glycerol at −80°C (as described) for an extended time. Samples were thawed and underwent extraction and analysis procedures similar to those for the fresh samples. The percentage of difference between frozen RNA recovery and fresh RNA recovery was determined following correction of the total RNA count of the frozen sample due to dilution during storage.
Nonequivalent molar ratios.
Nonequivalent molar ratios of RNA may be encountered during analysis. This may preclude the duplex assay from detecting both pathogens during concurrent infection due to template competition for reaction components. The optimized duplex assay was used to compare the detection of 100,000 molecules of A. marginale in vitro transcripts to that of A. phagocytophilum in vitro transcripts ranging from 100,000 to 1,000 molecules in triplicate.
Data analysis.
Statistical analysis was conducted utilizing one-way analysis of variance (ANOVA) (Microsoft Excel 2007; Microsoft Corporation, Redmond, WA). This statistical procedure analyzed variance for a quantitative dependent variable by a single independent variable in order to test the null hypothesis that several means are equal. An alpha level of ≤0.05 was designated a priori for the determination of statistical significance. The ANOVA procedure was used to determine statistically significant differences in the number of 16S rRNA molecules recovered from fresh samples versus samples preserved in 16.7% glycerol at −80°C.
Diagnostic test results were also converted to a binary format (0 for negative, 1 for positive). Epidemiologic sensitivity and specificity with 95% confidence intervals (95% CIs) were calculated for the cELISA by using RT-PCR assay results as the determinant of infection status. Additionally, one- and two-way receiver operator characteristic (ROC) curves were constructed to illustrate the optimal negative cutoff values for the cELISA based on RT-PCR assay results (19). This was accomplished by evaluating the cELISA percentage-of-inhibition results in 10% increments beginning and ending at 0 and 90% inhibition, respectively.
Agreement between diagnostic results was assessed by calculating a κ statistic at 95% confidence (19). Results were compared by use of a software program (Win Episcope, version 2.0; CLIVE, Edinburgh, United Kingdom) in a 2 × 2 contingency table to calculate κ with the equations EP = [(a + b)/n·(a + c)/n] + [(c + d)/n·(b + d)/n] and κ = [(a + d)/n − EP] (1 − EP), where EP is the expected proportion of equal outcomes according to chance; (a + d)/n − EP is the observed proportion of equal outcomes beyond chance; and 1 − EP is the maximal proportion of agreement not due to chance. The κ statistic measures the agreement between tests on a scale from 0 to 1 (19).
RESULTS
Target selection for the molecular diagnostic methods for A. marginale and A. phagocytophilum was based on the expected high intracellular copy number of 16S rRNA molecules. Real-time qRT-PCR methods were developed for the simplex detection of A. marginale and A. phagocytophilum and for a duplex assay for the simultaneous detection of both species in a 250-μl plasma-free bovine peripheral blood sample. In 25-μl reaction mixtures assembled with templates from 10-fold serial dilutions of in vitro transcripts, the linear dynamic range of all assays ranged from 100 to 1 billion molecules (Fig. 1). The number of reagent molecules used in the 25-μl RT-PCR assay mixtures is provided in Table 2. Linear regression was used to correlate the reported CT value with the number of 16S rRNA template molecules in the 25-μl reaction mixture (Table 3). Additionally, the correlation coefficient (R2) of each regression equation and the efficiencies of the RT-PCR assays are reported (12).
FIG. 1.
Target detection sensitivity and linearity with RNA concentrations for the simplex and duplex qRT-PCR assays. Standard curves of RNA concentrations were made from 10-fold serial dilutions of known quantities of the in vitro transcripts (ranging from 1 billion molecules to 1 molecule) and were analyzed in triplicate. (a and b) Mean CT values were plotted against the log number of rRNA molecules for optimized simplex assays detecting A. marginale (a) and A. phagocytophilum (b) (Insets) Fluorescent emissions from serial dilutions of templates for A. marginale (a) and A. phagocytophilum (b). (c) Equivalent molar concentrations of in vitro transcripts were used to optimize a real-time duplex qRT-PCR assay from mean CT values plotted against the log numbers of A. marginale (squares) and A. phagocytophilum (diamonds) RNA molecules.
TABLE 2.
RT-PCR assay reaction mixture componentsa for each of the simplex qRT-PCR assays and for the duplex qRT-PCR assay
| Component | Amt of component |
||
|---|---|---|---|
| Simplex RT-PCR assay |
Duplex RT-PCR assay | ||
| A. marginale | A. phagocytophilum | ||
| MgSO4 | 187.5 nmol | 187.5 nmol | 187.5 nmol |
| Each dNTPb | 5 pmol | 5 pmol | 5 pmol |
| Anaplasma forward primer | 10 pmol | 10 pmol | 10 pmol |
| Anaplasma reverse primer | 10 pmol | 10 pmol | 10 pmol |
| A. marginale probe | 11.3 pmol | 11.3 pmol | |
| A. phagocytophilum probe | 9.4 pmol | 9.4 pmol | |
Each 25-μl RT-PCR mixture consisted of 23 μl of master mix from a kit (SuperScript III Platinum one-step quantitative RT-PCR system; Invitrogen Corporation, Carlsbad, CA), 8 U of an RNase inhibitor (recombinant RNAsin; Promega Corporation, Madison, WI), and 2 μl of template. DNA contamination of RNA samples was assessed by replacing reverse transcriptase (SuperScript III reverse transcriptase) with 2 U of Taq polymerase (Platinum Taq DNA polymerase; Invitrogen Corporation, Carlsbad, CA).
dNTP, deoxynucleoside triphosphate.
TABLE 3.
Results of qRT-PCR assay optimization criteria and regression equations for the quantification of the template in a 25-μl reaction mixture
| Assay | Regression equationa | Correlation coefficient (R2) | Efficiency (%)b |
|---|---|---|---|
| Simplex | |||
| A. marginale | y = −3.4324x + 40.38 | 0.9973 | 95.59 |
| A. phagocytophilum | y = −3.532x + 41.815 | 0.9986 | 91.92 |
| Duplex | |||
| A. marginale | y = −3.5014x + 40.744 | 0.9950 | 93.02 |
| A. phagocytophilum | y = −3.5571x + 41.392 | 0.9965 | 91.04 |
y is the reported CT value, and x is the number of template molecules.
Calculated as −1 + [10(−1/slope)].
The species-specific probes accurately and precisely detected the respective template molecules without cross-reactivity during assay development. To examine whether nonequivalent molar ratios can be similarly detected, the detection of a fixed concentration of the A. marginale recombinant transcript and differing concentrations of the A. phagocytophilum recombinant transcript was assayed throughout a range of 1,000 to 100,000 molecules. The assay identified the recombinant transcripts when the difference in concentration between the templates was as high as 100-fold. Beyond this, only the A. marginale recombinant transcript was detected.
The mean ratio of A. marginale 16S rRNA to 16S DNA, determined with 10 field samples from herds in which anaplasmosis is endemic, was 117.9:1 (95% confidence interval, 100.7:1, 135.2:1). Therefore, the minimum detection sensitivity would be equal to the minimum infective unit of one A. marginale bacterium in 250 μl of plasma-free bovine peripheral blood. Because the RNA samples were not DNase treated prior to analysis, an experiment was conducted to assess the level of 16S DNA contamination. The mean ratio of 16S rRNA to 16S DNA of A. marginale following extraction of RNA from field samples was 1,252:1 (95% CI, 641.4:1, 1,863.8:1). This ratio and the data gathered during nonequivalent molar ratio experiments did not demonstrate the need for DNase treatment of extracted RNA. The stability of 16S rRNA in 10 plasma-free blood samples stored at −80°C in 16.7% glycerol for 311 days was compared to the level of RNA in the original samples processed on the day of collection. There was 32.1% (95% CI, 19.8%, 44.5%) less total RNA extracted from frozen samples than RNA extracted from fresh samples; however, this difference was not statistically significant (P, 0.27).
The duplex qRT-PCR assay determined the prevalence of A. marginale to be 37.6% in field samples; however, A. phagocytophilum was not detected (Table 4). The prevalence determined by the cELISA was 26.1%. The A. phagocytophilum simplex qRT-PCR assay was performed on a total of 14 randomly selected samples. Likewise, A. phagocytophilum was not detected in these samples. The epidemiologic sensitivity and specificity of the cELISA for detecting A. marginale was evaluated by the infection status of these cattle determined by the duplex RT-PCR assay (36). The cumulative epidemiologic sensitivity and specificity of the cELISA were 65.2% (95% CI, 55.3%, 75.1%) and 97.3% (95% CI, 94.7%, 99.9%), respectively. The cumulative agreement between the cELISA and the duplex qRT-PCR assay was 0.655 (95% CI, 0.542, 0.788).
TABLE 4.
Comparison of diagnostic method results during the screening of field samples from cattle for infection by A. marginale
| Group | No. of samples |
cELISA sensitivity (%) (95% CI) | cELISA specificity (%) (95% CI) | Agreement (κ)a (95% CI) | |
|---|---|---|---|---|---|
| RT-PCR positive | RT-PCR negative | ||||
| Northeast Kansas | 57.7 (38.7, 76.7) | 97.4 (92.3, 100) | 0.586 (0.356, 0.816) | ||
| cELISA positive | 15 | 1 | |||
| cELISA negative | 11 | 37 | |||
| Southeast Kansas | 68.3 (56.8, 79.7) | 97 (93.7, 100) | 0.695 (0.55, 0.841) | ||
| cELISA positive | 43 | 3 | |||
| cELISA negative | 20 | 107 | |||
| Cumulative | 65.2 (55.3, 75.1) | 97.3 (94.7, 99.9) | 0.655 (0.542, 0.788) | ||
| cELISA positive | 58 | 4 | |||
| cELISA negative | 31 | 144 | |||
A κ result where 0 < κ < 0.4, 0.4 < κ < 0.75, or κ > 0.75 indicates poor, good, or excellent reproducibility, respectively.
One- and two-way ROC curves were constructed to evaluate the percentage of inhibition of cELISA negative cutoff values for the detection of A. marginale based on RT-PCR assay results (Fig. 2 a and b). A one-way ROC curve determined the percentage of inhibition for the optimal negative cutoff value to be 20%. For a 20% negative cutoff value, the epidemiologic sensitivity and specificity of the cELISA were 73 and 91.2%, respectively. A percentage of inhibition of 15.3% was determined to be the optimal negative cutoff value by intersection of the plots for epidemiologic sensitivity and specificity in a two-way ROC curve. For a negative cutoff value of 15.3% inhibition, the epidemiologic sensitivity and specificity of the cELISA were 74.2 and 81.2%, respectively. The negative cutoff values recommended by the ROC curve analyses enhanced the epidemiologic sensitivity of the cELISA by 7.8 to 9% while adversely affecting the epidemiologic specificity by 6.1 to 16.1%.
FIG. 2.
Determination of the optimal negative cutoff value of the cELISA through the construction of ROC curves. (a) A one-way ROC curve was constructed by plotting the true-positive rate (sensitivity) against the true-negative rate (1 − specificity). The corresponding percentage of inhibition is recorded adjacent to each data point. The recommended negative cutoff value for the one-way ROC is represented as the data point located near the upper left portion of the graph (20%) (b) A two-way ROC curve was constructed by plotting the sensitivity (squares) and specificity (diamonds) of the cELISA against the corresponding percentage of inhibition (%I). The recommended negative cutoff value for the two-way ROC is represented by the intersection of the sensitivity and specificity plots (15.3%).
DISCUSSION
Real-time RT-PCR methods that combine reverse transcriptase, PCR chemistry, and fluorescent-probe detection of the amplified product have greatly enhanced the ability to determine the infection status of a pathogen. In this study, we described the development of real-time qRT-PCR assays for the detection of A. marginale and A. phagocytophilum alone or in combination. Duplex methods have been described for the simultaneous detection of A. marginale-A. centrale and A. phagocytophilum-Borrelia burgdorferi (6, 8). To our knowledge, this is the first study to describe a duplex method for the detection of A. marginale and A. phagocytophilum infections in the same sample.
The selection of an appropriate target for the accurate and precise determination of infection status is critical for the development of diagnostic methods for anaplasmosis pathogens. The selection of the16S rRNA gene segments enhanced the analytical sensitivity of the assay due to the high ratio of 16S rRNA to 16S DNA. Furthermore, the extraction of RNA from a plasma-free blood sample ensured that the maximum number of cells were available for analysis in a 250-μl sample. These real-time assays provided the sensitivity and specificity of conventional methods without the risk of environmental contamination that is present with an amplified product. Furthermore, 48 samples can be analyzed in fewer than 6 h, from the start of RNA extraction to the completion of analysis, by the real-time system.
Real-time assays for the detection of A. marginale have been developed previously (1, 8). However, there are key differences between those assays and the method described here. Simplex assays that target the DNA gene sequences encoding a major surface protein (MSP1b) and GroEL of A. marginale have been described (1, 8). The high analytical sensitivities of both methods provided for the detection of 10 DNA copies or 10 infective A. marginale bacteria; however, our qRT-PCR methods were able to detect as few as 100 copies of 16S rRNA, a value equivalent to the minimum infective unit of a single A. marginale bacterium. Similarity was observed in the selection of the fluorescent probe (6-carboxyfluorescein [FAM]) and quencher molecule (BHQ) during TaqMan probe development for the assay detecting GroEL (8) and our assay.
The detection of A. phagocytophilum by multiplex real-time methods has recently been limited to the determination of infection status in dogs and humans (6, 32). However, a simplex assay for detecting A. phagocytophilum was described in cattle (26). Similarities exist due to the use of TaqMan probes in the development of the assays; nevertheless, the assay described in 1999 by Pusterla et al. (26) differs by its improved analytical sensitivity in detecting as few as 10 16S rRNA molecules. The significance of this enhanced sensitivity is unknown due to the current lack of information regarding the ratio of 16S rRNA to 16S DNA in A. phagocytophilum. Therefore, serial sampling and reporting of results from cattle experimentally infected with A. phagocytophilum alone and from those coinfected with A. marginale and A. phagocytophilum would improve our understanding of the detection of nonequivalent molar concentrations in vivo.
The accurate and precise determination of infection status is important for the collection of epidemiologic information and the improvement of free-trade policy between countries where anaplasmosis is endemic and those where it is not. The development of a real-time method for the detection of A. marginale and A. phagocytophilum was influenced by the insufficient specificity of the cELISA due to cross-reactivity among closely related Anaplasma species (9, 34). Furthermore, A. centrale was not selected due to the fact that vaccination with this species does not occur in the United States. Our method described the capability of detecting as few as 100 16S rRNA molecules in the same reaction tube. Since these Anaplasma species infect different types of blood cells, the ability to detect only nonequivalent molar concentrations up to 100-fold may be problematic (6, 32). However, this could not be accurately assessed during this study. Red blood cells, which are the site of infection for A. marginale, and leukocytes, which are the site of infection for A. phagocytophilum, typically constitute 24% to 46% and <3%, respectively, of the circulating cells in blood collected from apparently healthy cattle. The detection of circulating A. phagocytophilum bacteria by light microscopy in experimentally infected cattle was not possible after 19 days postinfection (24). Thus, the number of circulating A. phagocytophilum bacteria in carrier cattle not showing symptoms of clinical disease is likely to be minimal.
The simplex and duplex assays could serve as effective diagnostic tools for the epidemiologic study of A. phagocytophilum. Even though anaplasmosis caused by A. phagocytophilum has been identified as an economically important disease (14, 24, 25), the prevalence of this pathogen in cattle in the United States is unknown (14). Furthermore, the zoonotic potential of A. phagocytophilum, also known as human granulocytic anaplasmosis, places cattle in the role of sentinel animals for monitoring the spread of this anaplasmosis disease form from regions where it is endemic to those where it is not.
In the present study, A. phagocytophilum was not detected in field samples. The absence of A. phagocytophilum in the samples analyzed in the present study was not likely the result of sequence variations in 16S rRNA genes. Furthermore, this gene is extensively conserved in widely different geographical isolates of A. phagocytophilum recovered from different host species (10). However, free trade within the United States and the interstate movement of cattle potentiates the introduction of both A. marginale and A. phagocytophilum into herds where anaplasmosis is not endemic. Our previous evaluation of ticks in Kansas revealed a low prevalence of Ixodes scapularis ticks (33). Despite the possibility of A. phagocytophilum transmission by other ticks, the prevalence of A. phagocytophilum may be significantly lower in cattle located in Kansas because of the low distribution of I. scapularis. Cattle that recover from acute anaplasmosis caused by A. marginale commonly develop persistent infections characterized by a cyclic rickettsemia of 5-week intervals (11). The ability to quantify the genetic template by regression analysis of the CT value reported by the real-time simplex and duplex assays can further supplement the study of cyclic rickettsemias. This is further substantiated by the findings of our study of the mean ratio of 16S rRNA to 16S DNA (117.9:1 [95% CI, 100.7:1, 135.2:1]). Therefore, the number of A. marginale bacteria would be equal to 1 bacterium per 118 molecules of 16S rRNA detected.
The evaluation of the cELISA as a diagnostic tool by the results of the duplex qRT-PCR assay may be controversial, because this qRT-PCR is not a gold-standard test (36). However, our group has previously demonstrated 100% sensitivity and specificity of the qRT-PCR method described here in cattle with experimental A. marginale infections (27a) and in carrier cattle chemosterilized with tetracycline antimicrobials (27). In these studies A. marginale infection status was confirmed by use of the gold-standard method (subinoculation of splenectomized calves). Furthermore, the approach to validation described in this study was similar to the interpretation of in-house data by a nested PCR that was submitted to the United States Department of Agriculture in support of licensure of the cELISA by Veterinary Medical Research & Development, Inc. (16, 36, 38). In these studies, the sensitivity and specificity of the cELISA were reported at 95% and 98%, respectively. However, the OIE does not recommend the use of this nested PCR due to the potential for nonspecific amplification (22). Furthermore, nonspecific amplification is not a disadvantage of our qRT-PCR assays.
It is noteworthy that the sensitivity and specificity of the cELISA when evaluated by the duplex real-time qRT-PCR assay were 65.2% (95% CI, 55.3%, 75.1%) and 97.3% (95% CI, 94.7%, 99.9%), respectively. A similar number of cattle were screened in our study and the study used for attaining USDA licensure for the commercially available cELISA (36). Disease prevalence in the sample populations of our study versus the cELISA licensure study were 37.6 and 64.3%, respectively. The measure of agreement (κ) calculated in the licensure study was 0.91, whereas κ was only 0.655 (95% CI, 0.542, 0.788) in our study. Furthermore, the licensure study used a negative-cutoff value set at 28% inhibition. In order to achieve similar sensitivity results, the percentage of inhibition used as the negative cutoff value in our study would have needed to be set at 40%. With regard to the two-way ROC curve constructed in Fig. 2b, 100% sensitivity was achieved at 40% inhibition. However, the specificity at this percentage of inhibition was approximately 60%. The one-and two-way ROC curves constructed from the results of this study (Fig. 2a and b) determined the optimal negative cutoff values to be set at 20% and 15.3% inhibition, respectively. However, 42% inhibition was recommended as the negative cutoff value in Canada (2, 37). Beyond the effects of the percentage of inhibition used for the negative cutoff value, as well as random and systematic error, differences in epidemiologic sensitivity and specificity are attributable to the reference populations and sampling strategy. Therefore, conflicting reports of method performance should be critically evaluated.
In conclusion, a highly sensitive and specific duplex real-time qRT-PCR assay was developed for the detection of as few as 100 copies of 16S rRNA molecules of A. marginale and A. phagocytophilum in the same reaction. The ability of this assay to correctly determine the infection status of cattle is critical for the development of anaplasmosis disease control programs. Furthermore, the correct classification of anaplasmosis infection status prior to export may prove to be an important tool for improving the free trade of cattle between countries and regions where anaplasmosis is endemic and those where it is not. Finally, this novel duplex assay may improve epidemiologic studies of anaplasmosis in cattle populations of unknown infection status.
Acknowledgments
This study was supported by grant AI070908 from the National Institute of Allergy and Infectious Diseases, NIH, and USDA CREES grant 1433 (AES project 481851).
We thank Chuanmin Cheng for invaluable technical assistance during the development of these assays.
Footnotes
Published ahead of print on 12 May 2010.
REFERENCES
- 1.Carelli, G., N. Decaro, A. Lorusso, G. Elia, E. Lorusso, V. Mari, L. Ceci, and C. Buonavoglia. 2007. Detection and quantification of Anaplasma marginale DNA in blood samples of cattle by real-time PCR. Vet. Microbiol. 124:107-114. [DOI] [PubMed] [Google Scholar]
- 2.CFIA. 3 January 2007, revision date. Consultation paper: an overview of anaplasmosis and assessing the risks for Canada. Canadian Food Inspection Agency, Ottawa, Ontario, Canada. http://www.inspection.gc.ca/english/anima/heasan/disemala/anaplasmos/consult2007/indexe.shtml.
- 3.Coetzee, J. F., M. D. Apley, and K. M. Kocan. 2006. Comparison of the efficacy of enrofloxacin, imidocarb, and oxytetracycline for clearance of persistent Anaplasma marginale infections in cattle. Vet. Ther. 7:347-360. [PubMed] [Google Scholar]
- 4.Coetzee, J. F., M. D. Apley, K. M. Kocan, F. R. Rurangirwa, and J. Van Donkersgoed. 2005. Comparison of three oxytetracycline regimes for the treatment of persistent Anaplasma marginale infections in beef cattle. Vet. Parasitol. 127:61-73. [DOI] [PubMed] [Google Scholar]
- 5.Coetzee, J. F., P. L. Schmidt, M. D. Apley, J. B. Reinbold, and K. M. Kocan. 2007. Comparison of the complement fixation test and competitive ELISA for serodiagnosis of Anaplasma marginale infection in experimentally infected steers. Am. J. Vet. Res. 68:872-878. [DOI] [PubMed] [Google Scholar]
- 6.Courtney, J. W., L. M. Kostelnik, N. S. Zeidner, and R. F. Massung. 2004. Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol. 42:3164-3168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Dame, J. B., S. M. Mahan, and C. A. Yowell. 1992. Phylogenetic relationship of Cowdria ruminantium, agent of heartwater, to Anaplasma marginale and other members of the order Rickettsiales determined on the basis of 16S rRNA sequence. Int. J. Syst. Bacteriol. 42:270-274. [DOI] [PubMed] [Google Scholar]
- 8.Decaro, N., G. Carelli, E. Lorusso, M. S. Lucente, G. Greco, A. Lorusso, A. Radogna, L. Ceci, and C. Buonavoglia. 2008. Duplex real-time polymerase chain reaction for simultaneous detection and quantification of Anaplasma marginale and Anaplasma centrale. J. Vet. Diagn. Invest. 20:606-611. [DOI] [PubMed] [Google Scholar]
- 9.Dreher, U. M., J. de la Fuente, R. Hofmann-Lehmann, M. L. Meli, N. Pusterla, K. M. Kocan, Z. Woldehiwet, U. Braun, G. Regula, K. D. Staerk, and H. Lutz. 2005. Serologic cross-reactivity between Anaplasma marginale and Anaplasma phagocytophilum. Clin. Diagn. Lab. Immunol. 12:1177-1183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Dumler, J. S., A. F. Barbet, C. P. Bekker, G. A. Dasch, G. H. Palmer, S. C. Ray, Y. Rikihisa, and F. R. Rurangirwa. 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51:2145-2165. [DOI] [PubMed] [Google Scholar]
- 11.Eriks, I. S., G. H. Palmer, T. C. McGuire, D. R. Allred, and A. F. Barbet. 1989. Detection and quantitation of Anaplasma marginale in carrier cattle by using a nucleic acid probe. J. Clin. Microbiol. 27:279-284. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ginzinger, D. G. 2002. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp. Hematol. 30:503-512. [DOI] [PubMed] [Google Scholar]
- 13.Gutell, R. R., B. Weiser, C. R. Woese, and H. F. Noller. 1985. Comparative anatomy of 16-S-like ribosomal RNA. Prog. Nucleic Acid Res. Mol. Biol. 32:155-216. [DOI] [PubMed] [Google Scholar]
- 14.Hoar, B. R., N. C. Nieto, D. M. Rhodes, and J. E. Foley. 2008. Evaluation of sequential coinfection with Anaplasma phagocytophilum and Anaplasma marginale in cattle. Am. J. Vet. Res. 69:1171-1178. [DOI] [PubMed] [Google Scholar]
- 15.Huang, Y., L. A. Babiuk, and S. van Drunen Littel-van den Hurk. 2005. Immunization with a bovine herpesvirus 1 glycoprotein B DNA vaccine induces cytotoxic T-lymphocyte responses in mice and cattle. J. Gen. Virol. 86:887-898. [DOI] [PubMed] [Google Scholar]
- 16.Knowles, D., S. Torioni de Echaide, G. Palmer, T. McGuire, D. Stiller, and T. McElwain. 1996. Antibody against an Anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle. J. Clin. Microbiol. 34:2225-2230. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kocan, K. M., J. de la Fuente, E. F. Blouin, J. F. Coetzee, and S. A. Ewing. 2010. The natural history of Anaplasma marginale. Vet. Parasitol. 167:95-107. [DOI] [PubMed] [Google Scholar]
- 18.Kocan, K. M., J. de la Fuente, A. A. Guglielmone, and R. D. Melendez. 2003. Antigens and alternatives for control of Anaplasma marginale infection in cattle. Clin. Microbiol. Rev. 16:698-712. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Le, C. T. 2003. Introductory biostatistics, 1st ed. John Wiley and Sons, Inc., Hoboken, NJ.
- 20.Manoj, S., P. J. Griebel, L. A. Babiuk, and S. van Drunen Littel-van den Hurk. 2004. Modulation of immune responses to bovine herpesvirus-1 in cattle by immunization with a DNA vaccine encoding glycoprotein D as a fusion protein with bovine CD154. Immunology 112:328-338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Molad, T., M. L. Mazuz, L. Fleiderovitz, L. Fish, I. Savitsky, Y. Krigel, B. Leibovitz, J. Molloy, F. Jongejan, and V. Shkap. 2006. Molecular and serological detection of A. centrale- and A. marginale-infected cattle grazing within an endemic area. Vet. Microbiol. 113:55-62. [DOI] [PubMed] [Google Scholar]
- 22.Office International des Épizooties. 17 July 2008, posting date. Manual of standards for diagnostic tests and vaccines for terrestrial animals, 6th ed., p. 599-610. Office International des Épizooties, Paris, France. http://www.oie.int/eng/normes/mmanual/2008/pdf/2.04.01_BOVINE_ANAPLASMOSIS.pdf.
- 23.Promega. November 2002, posting date. Promega application notes: genomic DNA purification from blood. Wizard SV genomic DNA purification systems. 10351-AN-PU. Promega Corporation, Madison, WI. http://www.promega.com/appnotes/an101/an101.pdf.
- 24.Pusterla, N., and U. Braun. 1997. Clinical findings in cows after experimental infection with Ehrlichia phagocytophila. Zentralbl. Veterinarmed. A 44:385-390. [DOI] [PubMed] [Google Scholar]
- 25.Pusterla, N., J. Huder, C. Wolfensberger, U. Braun, and H. Lutz. 1997. Laboratory findings in cows after experimental infection with Ehrlichia phagocytophila. Clin. Diagn. Lab. Immunol. 4:643-647. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Pusterla, N., J. B. Huder, C. M. Leutenegger, U. Braun, J. E. Madigan, and H. Lutz. 1999. Quantitative real-time PCR for detection of members of the Ehrlichia phagocytophila genogroup in host animals and Ixodes ricinus ticks. J. Clin. Microbiol. 37:1329-1331. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Reinbold, J. B., J. F. Coetzee, L. C. Hollis, J. S. Nickell, C. Riegel, K. C. Olson, and R. R. Ganta. 2009. The efficacy of three chlortetracycline regimens in the treatment of persistent Anaplasma marginale infection. Vet. Microbiol. doi: 10.1016/j.vetmic.2010.02.031. [DOI] [PMC free article] [PubMed]
- 27a.Reinbold, J. B., J. F. Coetzee, L. C. Hollis, J. S. Nickell, C. Riegel, J. Christopher-Huff, and R. R. Ganta. Comparison of iatrogenic transmission of Anaplasma marginale in Holstein steers via needle and needle-free injection techniques. Am. J. Vet. Res., in press. [DOI] [PMC free article] [PubMed]
- 28.Rogers, R. J., and I. A. Shiels. 1979. Epidemiology and control of anaplasmosis in Australia. J. S. Afr. Vet. Assoc. 50:363-366. [PubMed] [Google Scholar]
- 29.Rurangirwa, F. R., K. A. Brayton, T. C. McGuire, D. P. Knowles, and G. H. Palmer. 2002. Conservation of the unique rickettsial rRNA gene arrangement in Anaplasma. Int. J. Syst. Evol. Microbiol. 52:1405-1409. [DOI] [PubMed] [Google Scholar]
- 30.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed., vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 31.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed., vol. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 32.Sirigireddy, K. R., and R. R. Ganta. 2005. Multiplex detection of Ehrlichia and Anaplasma species pathogens in peripheral blood by real-time reverse transcriptase-polymerase chain reaction. J. Mol. Diagn. 7:308-316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Sirigireddy, K. R., D. C. Mock, and R. R. Ganta. 2006. Multiplex detection of Ehrlichia and Anaplasma pathogens in vertebrate and tick hosts by real-time RT-PCR. Ann. N. Y. Acad. Sci. 1078:552-556. [DOI] [PubMed] [Google Scholar]
- 34.Strik, N. I., A. R. Alleman, A. F. Barbet, H. L. Sorenson, H. L. Wamsley, F. P. Gaschen, N. Luckschander, S. Wong, F. Chu, J. E. Foley, A. Bjoersdorff, S. Stuen, and D. P. Knowles. 2007. Characterization of Anaplasma phagocytophilum major surface protein 5 and the extent of its cross-reactivity with A. marginale. Clin. Vaccine Immunol. 14:262-268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Stuen, S. 2007. Anaplasma phagocytophilum—the most widespread tick-borne infection in animals in Europe. Vet. Res. Commun. 31(Suppl. 1):79-84. [DOI] [PubMed] [Google Scholar]
- 36.Torioni de Echaide, S., D. P. Knowles, T. C. McGuire, G. H. Palmer, C. E. Suarez, and T. F. McElwain. 1998. Detection of cattle naturally infected with Anaplasma marginale in a region of endemicity by nested PCR and a competitive enzyme-linked immunosorbent assay using recombinant major surface protein 5. J. Clin. Microbiol. 36:777-782. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Van Donkersgoed, J., T. F. Linfield, M. Bridges, D. Raths, D. Dargatz, B. Wagner, J. Block, D. Knoop, and T. E. Walton. 2006. Prevalence of antibodies to serotypes of bluetongue virus and Anaplasma marginale in Montana feeder cattle: 2002-2003. Can. Vet. J. 47:692-694. [PMC free article] [PubMed] [Google Scholar]
- 38.VMRD. 4 September 2009, accession date. Product information sheet: Anaplasma antibody test kit, cELISA. Veterinary Medical Research & Development (VMRD), Inc., Pullman, WA. www.vmrd.com/docs/tk/Anaplasma/Anaplasma_Flyer_050113.pdf.
- 39.VMRD. 4 September 2009, accession date. Anaplasma antibody test kit, cELISA. Assay instructions for catalog numbers: 282-2 and 282-5, version 060505. Veterinary Medical Research & Development (VMRD), Inc., Pullman, WA. http://www.vmrd.com/docs/tk/Anaplasma/Anaplasma_2_and_5-plate_circular_060505.pdf.