Abstract
A novel viral responsive protein, namely hemocyte homeostasis-associated protein (HHAP), was characterized for its role in the response of shrimp to white spot syndrome virus infection. The full-length cDNAs of HHAP from the black tiger shrimp (PmHHAP), Penaeus monodon, and the fresh water crayfish (PlHHAP), Pacifastacus leniusculus, were obtained and showed high sequence identity to a hypothetical protein from various organisms, with the highest identity to the hypothetical protein TcasGA2_TC006773 from the red flour beetle, Tribolium castaneum (54% amino acid sequence identity). Transcripts of PmHHAP were expressed in various shrimp tissues with the highest expression in hematopoietic tissue, whereas the transcripts of PlHHAP were found in the hematopoietic and nerve tissues. Upon white spot syndrome virus infection, a high up-regulation level of shrimp hemocytic HHAP mRNA and protein was observed by real-time reverse transcription-PCR and immunofluorescence microscopy, respectively. Gene silencing of PmHHAP by RNA interference resulted in a significant decrease in the number of circulating hemocytes and 100% shrimp mortality within 30 h of the double-stranded PmHHAP RNA injection (but not in control shrimp), indicating that HHAP is essential for shrimp survival. Interestingly, severe damage of hemocytes was observed in vivo in the PmHHAP knockdown shrimp and in vitro in shrimp primary hemocyte cell culture, suggesting that PmHHAP plays an important role in hemocyte homeostasis. Thus, it is speculated that the up-regulation of PmHHAP is an important mechanism to control circulating hemocyte levels in crustaceans during viral infection.
Keywords: Blood, Gene Silencing, Humoral Response, Innate Immunity, RNA Interference (RNAi), Antiviral Immunity, Crustacean, Hemocyte, Penaeus monodon, White Spot Syndrome Virus
Introduction
White spot syndrome virus (WSSV),2 a major shrimp pathogen, critically affects the shrimp aquaculture worldwide, causing white spot syndrome with the onset of a rapid and mass mortality within 2–7 days post infection (1, 2). A clinical sign of white spot syndrome typically is the development of many white spots on the carapace of the infected shrimp (2). It has a broad host range (3) and can infect various tissues (4, 5). WSSV is the type species of the genus Whispovirus in the family Nimaviridae (6). It contains a circular double-stranded DNA of ∼305 kb and is an enveloped rod-shaped particle with a single filamentous appendage-like tail at one end of the nucleocapsid (6, 7). The average size of the virus is ∼298 ± 21 nm long and 107 ± 8 nm in diameter (4).
Invertebrates, including crustaceans, rely on an effective innate immune system to fight against invading pathogens, which is composed of cellular and humoral immune responses. The cellular responses include phagocytosis, nodule formation, and encapsulation, whereas the humoral responses involve the prophenoloxidase-activating system, the clotting cascade, and activity of immune-related proteins such as antimicrobial peptides, antiviral peptides, proteases, and protease inhibitors (8–10). So far, several research reports on the viral defense mechanisms in crustaceans have identified some potential molecules as likely to be involved in the antiviral immunity (see Liu et al. (11), for a review). Nevertheless, the information concerning viral infection and antiviral mechanisms in crustaceans is still mostly unknown.
The hemocyte is a major immune-responsive cell in crustaceans, because it produces many immune effectors, and participates in a number of immune activities (8). Crustacean hemocytes are generally classified into three types: hyaline (agranular), semigranular (small granular), and granular (large granular) hemocytes (12, 13). It is believed that the hyaline hemocyte is associated with phagocytosis (14, 15), whereas the granular cells principally function in apoptosis, melanization, encapsulation, and nodulation (16–19). Apoptosis, which occurs after viral infections, plays an important role in the antiviral mechanism of crustaceans. However, this also leads to a significant reduction in the number of circulating hemocytes, probably resulting in a decline of antiviral immunity as well as mortality of crustaceans (20–24). Therefore, maintenance of the hemocyte level in the blood-circulating system, including the rapid production of new hemocytes from hematopoietic tissue, is essential for the survival of the animals as is the capacity to protect against pathogenic invaders.
To gain more insight into viral infection and/or antiviral mechanisms in crustaceans, we applied suppression subtractive hybridization (SSH) to identify viral responsive genes in the hemocytes of WSSV-challenged Penaeus monodon at the early and late phases of the infection (our unpublished data). Among these genes, a gene encoding a protein with significant similarity to the hypothetical protein TcasGA2_TC006773 from the red flour beetle, Tribolium castaneum (GenBankTM accession number EFA09058), was further investigated, because it was one of the highly up-regulated genes found in the SSH libraries. In this report, we characterize this novel viral responsive gene/protein that was found for the first time in crustaceans, which appears to be involved in hemocyte homeostasis. Therefore, it was named as “hemocyte homeostasis-associated protein (HHAP).”
EXPERIMENTAL PROCEDURES
Shrimp and Crayfish Cultivation
Specific pathogen-free (SPF) black tiger shrimp, P. monodon, of ∼20 g bodyweight were obtained from a farm in Nakhon Si Thammarat Province, Thailand. The animals were reared in laboratory tanks at ambient temperature (28 ± 4 °C) and maintained in aerated water with a salinity of 20 ppt for at least 7 days before use. For RNAi experiments, P. monodon of ∼5 g in weight were purchased from local farms in Thailand, and were maintained as above. Fresh water crayfish, Pacifastacus leniusculus, of ∼30 g bodyweight were purchased from Torsäng, lake Vättern, Sweden, and maintained in laboratory tanks with aerated water at 10 °C.
Identification of a Full-length cDNA of Shrimp and Crayfish HHAP
The hemolymph of shrimp of ∼20 g body weight was drawn from the ventral sinus using a sterile 1-ml syringe with 150 μl of 10% (w/v) sodium citrate solution. The hemolymph was immediately centrifuged at 5000 × g for 5 min at 4 °C to separate the hemocytes from the plasma. Total RNA was isolated from the hemocytes using the TRI Reagent® (Molecular Research Center) according to the manufacturer's protocol. A full-length cDNA of shrimp HHAP (PmHHAP) was determined using The SMARTTM RACE cDNA amplification kit (Clontech) with the PmHHAP (5′RACE) primers (Table 1) according to the manufacturer's instruction. The RACE product was purified using NucleoSpin® Extract II kit (Clontech) according to the manufacturer's protocol, and cloned into the RBC T & A Cloning Vector (RBC Bioscience). Then the recombinant plasmid was transformed into Escherichia coli DH5α-competent cells (RBC Bioscience). The positive clones were commercially sequenced by Macrogen Inc., Seoul, South Korea.
TABLE 1.
Primers used for PCR amplification
| Primer name | Primer sequence (5′ to 3′) | Usage |
|---|---|---|
| PmHHAP-1 | Forward: GCAACAGGAGAACCTGTGGATA | RT-PCR |
| Reverse: GGTTCCAGAATCGCCTCCTATA | ||
| PmHHAP-2 | Forward: ATGAGCGCCGAAATGAAAACC | RT-PCR |
| Reverse: GGTTCCAGAATCGCCTCCTATA | ||
| PmHHAP (expression) | Forward: CATATGAGCGCCGAAATGAAAACC | Protein production |
| Reverse: CTCGAGGCGTTTATAGGAGGCGATTCT | ||
| PmHHAP (5′ RACE) | Forward: 10× Universal Primer A Mix (Clontech) | Full-length cDNA identification |
| Reverse: CCACAGGTTCTCCTGTTGCCCTGGTATG | ||
| PmHHAP (real-time PCR) | Forward: GCAACAGGAGAACCTGTGGATA | Real-time PCR |
| Reverse: GGTTCCAGAATCGCCTCCTATA | ||
| PmHHAP1 (RNAi) | Forward: TAATACGACTCACTATAGGGCAACAGGAGAACCTGTGGATA | Gene silencing |
| Reverse: GGCCTTGTGACGTTCTTCCATT | ||
| PmHHAP2 (RNAi) | Forward: GCAACAGGAGAACCTGTGGATA | Gene silencing |
| Reverse: TAATACGACTCACTATAGGGGCCTTGTGACGTTCTTCCATT | ||
| GFP1 (RNAi) | Forward: TAATACGACTCACTATAGGATGGTGAGCAAGGGCGAGGA | Gene silencing |
| Reverse: TTACTTGTACAGCTCGTCCA | ||
| GFP2 (RNAi) | Forward: ATGGTGAGCAAGGGCGAGGA | Gene silencing |
| Reverse: TAATACGACTCACTATAGGTTACTTGTACAGCTCGTCCA | ||
| VP28 | Forward: TCACTCTTTCGGTCGTGTCG | RT-PCR |
| Reverse: CCACACACAAAGGTGCCAAC | ||
| β-Actin | Forward: GCTTGCTGATCCACATCTGCT | RT-PCR |
| Reverse: ATCACCATCGGCAACGAGA | ||
| β-Actin (real-time PCR) | Forward: GAACCTCTCGTTGCCGATGGTG | Real-time PCR |
| Reverse: GAAGCTGTGCTACGTGGCTCTG | ||
| PlHHAP (degenerate) | Forward: AARACNCCNTAYCARGG | Degenerate PCR |
| Reverse: RCAYTTYTGRCACATYTCYTG | ||
| PlHHAP (5′ RACE) | Forward: Abridged Anchor Primer (Invitrogen) | Full-length cDNA identification |
| Reverse: CAGGAGTTAGCAGAGAACCA | ||
| PlHHAP (Nested 5′ RACE) | Forward: Abridged Universal Amplification Primer (Invitrogen) | Full-length cDNA identification |
| Reverse: TGGAACATTCCACACGCTCTCCTCTTGC | ||
| PlHHAP (3′ RACE) | Forward: ATAGACAGTTTCGACCCTGGCAAGGGAGT | Full-length cDNA identification |
| Reverse: Abridged Universal Amplification Primer (Invitrogen) | ||
| PlHHAP (Nested 3′ RACE) | Forward: AGCGGTCGTGGAGGTGCACCCCAACATC | Full-length cDNA identification |
| Reverse: Abridged Universal Amplification Primer (Invitrogen) | ||
| PlHHAP (RT-PCR) | Forward: AGTGCAGTTTAGGAACACAT | RT-PCR |
| Reverse: ACACATACATTCTTGCAGTC | ||
| 40 S ribosomal protein | Forward: GACGAATGGCATACACCTGAGAGG | RT-PCR |
| Reverse: CAGGACTCTGCAGTTCAAGCTGATG |
The full-length cDNA of crayfish HHAP (PlHHAP) was identified using degenerate primers and the 5′ and 3′ RACE kit (Invitrogen). Briefly, PlHHAP (degenerate) primers (Table 1) were designed from the conserved region of PmHHAP using the available sequences of shrimp and insect HHAP genes from the BLAST result. A hemocyte cDNA sample from WSSV-challenged crayfish was used as the template in a 25-μl PCR reaction containing the primer pair (0.2 μm each), dNTP (100 μm), PCR buffer (1×), and TaqDNA polymerase (1.0 unit, Fermentas). The PCR conditions consisted of heat denature at 94 °C for 2 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 2 min, and then a final extension at 72 °C for 5 min. The PCR product was cloned and sequenced by a commercial service. The full-length cDNA of PlHHAP was acquired using a 5′ and 3′ RACE kit (Invitrogen) with the specific primers of PlHHAP as shown in Table 1. The design of these primers was based upon the obtained partial cDNA sequence. The 5′ and 3′ RACE reactions were performed according to the manufacturer's instruction. The RACE PCR products were purified, cloned, and sequenced.
Analysis of HHAP Gene Expression in Shrimp and Crayfish Tissues
Tissues of shrimp and crayfish, such as the antennal gland, epipodite, eye stalk, gill, heart, hemocytes, hematopoietic tissue, hepatopancreas, intestine, nerve, and lymphoid tissues, were collected from normal shrimp and crayfish, and then total RNA was extracted from each tissue using the TRI Reagent® (Molecular Research Center). After DNase (Fermentas) treatment, the total RNA (1 μg) was converted to single-stranded cDNA with the ImPromp-IITM reverse transcription system (Promega, Madison, WI) according to the manufacturer's instruction. The HHAP gene expression level in each tissue was identified by RT-PCR using 1 μl of cDNA template with either the PmHHAP-1 primers or PlHHAP (RT-PCR) primers (Table 1) for the PmHHAP and PlHHAP genes, respectively. The β-actin and 40 S ribosomal protein partial gene fragments were amplified using the β-actin and 40 S ribosomal protein-specific primers (Table 1), respectively, as internal controls for shrimp and crayfish, respectively. The PCR conditions consisted of 94 °C for 3 min, followed by 31 (for PmHHAP), 40 (for PlHHAP), and 25 (for β-actin and 40 S ribosomal protein) cycles of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s, and then a final extension at 72 °C for 5 min. The PCR product was analyzed by 1.5% (w/v) agarose gel electrophoresis.
Production of Recombinant PmHHAP and Anti-PmHHAP Polyclonal Antibody
The open reading frame of PmHHAP conjugated with a 5′ XhoI and a 3′ NdeI restriction site was amplified from the PmHHAP-recombinant plasmid by PCR with the PmHHAP (expression) primers (Table 1) for the following: 94 °C for 3 min, 30 cycles of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 30 s, and then a final extension at 72 °C for 5 min. The PCR product was purified using a NucleoSpin® Extract II kit (Clontech), and cloned into the pET-22b(+) expression vector (Novagen). The recombinant plasmid was transformed into E. coli Rosetta (DE3)-competent cells by electroporation. The transformed E. coli was grown in Luria-Bertani (LB) medium, and the protein expression was induced with 1 mm isopropyl 1-thio-β-d-galactopyranoside. The overexpression of recombinant PmHHAP (rPmHHAP) was analyzed by SDS-PAGE (18% (w/v) acrylamide) followed by Coomassie Brilliant Blue staining. The rPmHHAP was found to be principally located in inclusion bodies, and so it was solubilized with 20 mm sodium phosphate buffer, pH 7.4, containing 8 m urea, 500 mm sodium chloride, and 20 mm imidazole at room temperature overnight. The solubilized protein was purified using the affinity column containing nickel-SepharoseTM 6 Fast Flow (Amersham Biosciences) according to the manufacturer's suggestion, and, subsequently, the protein was refolded by dialyzing with 20 mm Tris-HCl, pH 8.0, containing 4, 2, and 0 m urea, respectively, for 3 h in each step. The purity of the recombinant protein was analyzed by SDS-PAGE as above. The purified rPmHHAP was used to generate rabbit polyclonal antibodies by a commercial service at Biomedical Technology Research Unit, Chiang Mai University, Thailand.
Western Blot Analysis of PmHHAP
Total protein was extracted from the hematopoietic tissue of each shrimp using the TRI Reagent® (Molecular Research Center). The purified rPmHHAP, and the total protein from hematopoietic tissue, were separated by SDS-PAGE (18% (w/v) acrylamide) and transferred onto a PROTRANTM nitrocellulose transfer membrane (Whatman) by a semi-dry blotter. The membrane was immersed in blocking buffer (1× phosphate-buffered saline (PBS), pH 7.4, containing 5% (w/v) skim milk and 0.05% (v/v) Tween 20) at room temperature overnight and then incubated with a 1:1,000 dilution of rabbit anti-rPmHHAP antibody in blocking buffer at 37 °C for 2 h. The membrane was washed three times with washing buffer (PBS, pH 7.4, containing 0.05% (v/v) Tween 20) and incubated with a 1:10,000 dilution of alkaline phosphatase-conjugated goat anti-rabbit IgG antibody in blocking buffer at room temperature for 1 h. Then the membrane was washed three times with washing buffer, and the color was developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate solution (Fermentas) according to the manufacturer's protocol.
PmHHAP mRNA Expression in Unchallenged and WSSV-challenged Shrimp Hemocytes
WSSV was prepared from the gills of WSSV-challenged P. monodon according to the method described by Du et al. (25) and then diluted in lobster hemolymph medium, prepared as described by Paterson and Stewart (26). 100 μl of the diluted WSSV solution (∼80 viral copies/μl) was injected into each shrimp (∼20 g body weight), a viral dose that had been previously determined as that which would induce a cumulative mortality of ∼50% within 3 days post injection (data not shown). Control shrimp were injected with 100 μl of virus-free lobster hemolymph medium. Hemocytes of shrimp (three individuals each) were collected at 24, 48, and 72 h post injection, and total RNA was extracted from the hemocytes using the TRI Reagent® (Molecular Research Center) followed by DNase (Fermentas) treatment, and used to synthesize single-stranded cDNA with the ImPromp-IITM reverse transcription system (Promega). Real-time RT-PCR was performed using an equal amount of cDNAs in iCycler iQTM Real-Time detection system using an iQTM SYBR Green Supermix (Bio-Rad) with the following conditions: 95 °C for 9 min, 40 cycles of 95 °C for 30 s, 58 °C (for PmHHAP) or 60 °C (for β-actin) for 30 s, and 72 °C for 45 s. The PmHHAP and β-actin (real-time PCR) primers were used in the experiment (Table 1). The results are presented as the average relative expression ratio of PmHHAP expressed in the hemocytes of the sample (WSSV-challenged) shrimp versus the control (unchallenged) shrimp, with normalization to the reference gene (β-actin). The relative expression ratios of PmHHAP were calculated as described by Pfaffl (27).
Isolation and Tissue Culture Pretreatment of Primary Hemocyte Cultures
Hemolymph was drawn from each shrimp (∼20 g body weight) using a sterile 1-ml syringe with 500 μl of anticoagulant, pH 5.6 (0.82% (w/v) sodium chloride, 0.55% (w/v) citric acid, 1.98% (w/v) glucose and 0.88% (w/v) sodium citrate; adjusted to pH 5.6 with sodium hydroxide solution). The hemolymph-anticoagulant mixture was then centrifuged at 200 × g for 10 min at room temperature to separate the hemocytes from the plasma. The hemocyte pellet was resuspended in 1 ml of L-15 culture medium (1.6× Leibovitz L-15 medium (Invitrogen) supplemented with 20% (v/v) fetal bovine serum, 1% (w/v) glucose, 0.4% (w/v) sodium chloride, 100 IU/ml penicillin, and 100 μg/ml streptomycin (pH 7.6); adjusting the osmotic pressure to 750 ± 15 mosm/kg with sodium chloride solution). The hemocyte number was counted under a light microscope and then distributed into the wells of a 96-well plate at 105 cells per well. The total volume in each well was adjusted to 150 μl with L-15 culture medium, and the culture plate was incubated at 28 °C for 24 h, whereupon the pretreated hemocytes were ready to be used in experiments.
PmHHAP mRNA Expression in Unchallenged and WSSV-challenged Shrimp Primary Hemocyte Cultures
After the pretreatment of primary hemocyte cultures as described above, 50 μl of L-15 culture medium was removed from each well and replaced with 50 μl of L-15 culture medium with (WSSV-challenged hemocytes) or without (SPF control hemocytes) ∼106 WSSV viral copies, and reincubated at 28 °C for a further 24 h. Total RNA was extracted from the hemocytes using the TRI Reagent® (Molecular Research Center) followed by DNase (Fermentas) treatment, and then used to synthesize single-stranded cDNA. RT-PCR was performed as described above using the PmHHAP-1 and β-actin primers (Table 1). The PCR product was analyzed by 1.5% (w/v) agarose gel electrophoresis, and the differential expression level was reported as relative to that of β-actin.
Protein Expression and Subcellular Localization Analysis of PmHHAP in Shrimp Hemocytes
The diluted WSSV solution (100 μl, ∼8 × 103 WSSV copies) was injected into shrimp (∼20 g body weight) while unchallenged shrimp were injected with 100 μl of virus-free lobster hemolymph medium. Sixty hours post injection, hemolymph was drawn from each shrimp using a sterile 1-ml syringe with 500 μl of anticoagulant, pH 5.6. The anticoagulant-hemolymph (50 μl) mixture was added into a 24-well plate containing a coverslip and 200 μl of L-15 culture medium in each well, and the mixture was incubated at room temperature for 2 h. Subsequently, the medium was removed, and then 300 μl of 4% (w/v) paraformaldehyde in PBS, pH 7.4, was added instead. The plate was incubated at room temperature for 20 min, washed three times with PBS, pH 7.4, and then immersed in PBS, pH 7.4, and kept at 4 °C until the next treatment.
The fixed hemocytes were incubated with a 1:500 dilution of rabbit anti-rPmHHAP polyclonal antibody in PBS, pH 7.4, containing 1% (v/v) fetal bovine serum, at 37 °C for 1 h while the negative control (non-infected) hemocytes were incubated with PBS, pH 7.4 containing 1% (v/v) fetal bovine serum. Blots were then washed three times with PBS, pH 7.4, and then incubated with a 1:500 dilution of secondary antibody solution (Alexa Fluor 488 goat anti-rabbit IgG antibody) in PBS, pH 7.4, at room temperature for 1 h in the dark and washed three times with PBS, pH 7.4. Subsequently, the nucleus was stained with a 1:500 dilution of TO-PRO-3 iodide (Invitrogen) in PBS, pH 7.4, at room temperature for 1 h in the dark, and washed three times with PBS, pH 7.4. The coverslips containing the stained and fixed hemocyte samples were then coated with Prolong Gold Antifade Reagent (Invitrogen) before detecting the fluorescent signal by confocal microscopy.
Production of PmHHAP and GFP dsRNA
Two types of PmHHAP DNA templates with a single T7 promoter at the 5′ ends were PCR-amplified from the PmHHAP-recombinant plasmid by two separate PCR reactions using the PmHHAP1 and PmHHAP2 (RNAi) primer sets (Table 1) with the following conditions: 94 °C for 3 min, 30 cycles of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 30 s, and then a final extension at 72 °C for 5 min. The two types of PCR product templates were in vitro transcribed using T7 RiboMAXTM Express Large Scale RNA Production System (Promega) to produce two complementary single-stranded RNAs according to the manufacturer's instruction. Then, equal amounts of each of the complementary single-stranded RNAs were mixed together and incubated at 70 °C for 10 min, and then slowly cooled down at room temperature to allow annealing to form dsRNA. The PmHHAP dsRNA solution was treated with 2 units of RQ1 RNase-free DNase (Promega) at 37 °C for 15 min, and then purified by standard phenol-chloroform extraction.
Green fluorescent protein (GFP) DNA templates with a single T7 promoter at the 5′ ends were PCR-amplified from the pd2EGFP-1 vector (Clontech) using the GFP1 and GFP2 (RNAi) primers (Table 1) with the following conditions: 94 °C for 3 min, 30 cycles of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 1 min, and then a final extension at 72 °C for 5 min. Subsequently, GFP dsRNA was produced as above.
Analysis of PmHHAP Gene Silencing Mediated by RNAi
Shrimp were separated into four groups with three shrimp per group. 25 μl of 150 mm sodium chloride solution alone (group 1) or containing 10 μg of GFP dsRNA (group 2) or 5 and 10 μg of PmHHAP dsRNA (groups 3 and 4, respectively) was injected into each shrimp (∼5 g body weight) of each respective group. Twenty-four hours post injection, hemocytes were collected, and total RNA was extracted from them using the TRI Reagent® (Molecular Research Center) followed by DNase (Fermentas) treatment, and then single-stranded cDNA was synthesized with the ImPromp-IITM reverse transcription system (Promega). RT-PCR was performed to evaluate the degree of gene transcript silencing using the PmHHAP-1 and β-actin primers (Table 1), as mentioned above. The PCR product was analyzed by 1.5% (w/v) agarose gel electrophoresis, and PmHHAP gene expression level was reported as relative to that of β-actin.
Investigation of Shrimp Mortality after PmHHAP Gene Knockdown
Shrimp were separated into four groups with 10 shrimp per group. Twenty-five μl of 150 mm sodium chloride solution alone (group 1) or containing 8 μg of GFP dsRNA (group 2) or 4 and 8 μg of PmHHAP dsRNA (groups 3 and 4, respectively) was injected into each shrimp (∼4 g body weight) in each respective group. Shrimp mortality was observed and recorded every 6 h post injection for 36 h, and the results are reported as average cumulative percent mortality + 1 S.D. from three experiments.
Identification of Shrimp Circulating Hemocyte Numbers after PmHHAP Gene Knockdown
Shrimp were separated into three groups with 15 shrimp per group. Twenty-five μl of 150 mm sodium chloride solution (group 1) and 150 mm sodium chloride solution containing 4 μg of GFP dsRNA (group 2) or 4 μg of PmHHAP dsRNA (group 3) was injected into each shrimp (∼4 g body weight) in each group. At 12 and 24 h post injection, 50 μl of hemolymph was drawn from three to five shrimp using a sterile 0.5-ml syringe with 50 μl of anticoagulant, pH 5.6. The total hemocyte number in the hemolymph was counted with a hemocytometer under a light microscope, and the average total hemocyte number of each group at each time point was calculated and recorded. The experiment was done in triplicate, and the results are shown as the average total hemocyte number ± 1 S.D. from triplicate samples.
Morphological Analysis of PmHHAP-depleted Hemocytes by Scanning Electron Microscopy
25 μl of 150 mm sodium chloride solution containing 5 μg of PmHHAP dsRNA or GFP dsRNA was injected into each shrimp (∼5 g body weight), and after either 12 or 24 h, the hemolymph was drawn from each group of shrimp using a sterile 1-ml syringe without anticoagulant, and immediately dropped onto a coverslip. Proteins in the hemolymph were washed out with 0.1 m sodium phosphate buffer, pH 7.2, and the coverslip was then immersed in 0.1 m sodium phosphate buffer, pH 7.2, containing 2.5% (w/v) glutaraldehyde at room temperature for 1 h to fix the cells. The coverslip was then washed with 0.1 m sodium phosphate buffer, pH 7.2, followed by distilled water, and then dehydrated through immersion for 3 min each in a series of 30, 50, 70, 90, 100, 100, and 100% (v/v) ethanol. Finally, the samples were dried using a critical point dryer and coated with gold using ion sputter. The hemocyte morphology was then observed by scanning electron microscopy.
RNAi-mediated PmHHAP Transcript Knockdown in Vitro in Primary Hemocyte Cultures
After pretreatment of primary hemocyte cultures, as described above, the L-15 culture medium was completely removed from the wells and replaced with 100 μl of serum-free L-15 transfection reagent (1.6× Leibovitz L-15 medium (Invitrogen) supplemented with 1% (w/v) glucose, 0.4% (w/v) sodium chloride, 0.25% (v/v) LipofectamineTM 2000 (Invitrogen), pH 7.6, and the osmotic pressure was adjusted to 750 ± 15 mosm/kg with sodium chloride solution) containing 1 μg of either PmHHAP or GFP dsRNA, respectively. The culture plate was incubated at 28 °C for 48 h, and then the hemocyte morphology was observed by light microscopy. To evaluate the degree of PmHHAP gene knockdown, PmHHAP transcript levels were evaluated. Total RNAs were extracted from the hemocytes using the TRI Reagent® (Molecular Research Center), followed by DNase (Fermentas) treatment, and then used to synthesize single-stranded cDNA with the ImPromp-IITM reverse transcription system (Promega). The gene knockdown was analyzed by RT-PCR using the PmHHAP-2 and β-actin primers (Table 1). PCR conditions for the PmHHAP-2 primers consisted of 94 °C for 3 min, 33 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s, and then a final extension at 72 °C for 5 min. The PCR product was analyzed by 1.5% (w/v) agarose gel electrophoresis, and PmHHAP gene expression level was reported as relative to that of β-actin.
RESULTS
The Full-length cDNA of Shrimp and Crayfish HHAP and Sequence Analysis
The partial sequence of the P. monodon shrimp HHAP (PmHHAP) cDNA was previously obtained from the SSH library of WSSV-challenged P. monodon hemocytes. Full-length cDNA was then identified using 5′ RACE (Fig. 1A), and the size of the PmHHAP mRNA obtained was confirmed by Northern blot analysis showing the corresponding size of ∼650 bp (data not shown). The BLAST homology search (28) indicated that the putative predicted protein sequence encoded by PmHHAP had a significant amino acid sequence similarity (54%) to the hypothetical protein TcasGA2_TC006773 from the red flour beetle, T. castaneum. From a protein-structural analysis, the protein is expected to be a DNA-binding protein (99.2% possibility; DBS-Pred, available on-line) (29), and potentially can form four disulfide bridges (DiANNA 1.1 web server) (30), but it has no predicted signaling domain (Simple Modular Architecture Research Tool (SMART) available on-line) (31). The full HHAP sequence was also determined from the freshwater crayfish, P. leniusculus (Fig. 1B). The pairwise alignment of shrimp and crayfish HHAP amino acid sequences exhibited 47% identity, and they share the eight conserved cysteine residues (Fig. 1C).
FIGURE 1.
Nucleotide and deduced amino acid sequences of PmHHAP (A) and PlHHAP (B). An asterisk indicates the stop codon. The polyadenylation site is underlined. C, pairwise alignments of deduced amino acid sequences of PmHHAP and PlHHAP were performed using EMBOSS Pairwise Alignment (available on-line). The conserved eight Cys residues are in boxes. The symbols ( , :, and .) indicate amino acid identity, similarity, and unrelated, respectively.
HHAP Expression in Shrimp and Crayfish Tissues
The tissue distribution of the HHAP transcripts in shrimp and crayfish were examined by RT-PCR using the respective gene-specific primers. The shrimp PmHHAP was transcribed in all tested tissues but was highly expressed in the heart, hematopoietic, and intestine tissues (Fig. 2A). Transcript levels in hemocytes were at relative low levels. For the freshwater crayfish, P. leniusculus, PlHHAP transcript profiles were different, being found in hematopoietic and nerve tissues, but at very low levels compared with that found in P. monodon shrimp tissues and not at detectable levels in the other tissues, including hemocytes (Fig. 2B).
FIGURE 2.
mRNA expression analysis of P. monodon HHAP (PmHHAP) (A) and P. leniusculus HHAP (PlHHAP) (B) in various tissues by RT-PCR. The figure shows antennal gland (AN), epipodite (EP), eye stalk (ES), gill (G), heart (H), hemocyte (HC), hematopoietic tissue (HE), hepatopancreas (HP), intestine (I), lymphoid (L), muscle (M), and nerve tissue (NT). β-Actin and 40 S ribosomal protein were used as an internal reference gene for PmHHAP and PlHHAP, respectively. Gels shown are representative of two independent amplifications.
PmHHAP Is Found among Hematopoietic Proteins
To detect PmHHAP protein levels in hematopoietic tissues, a polyclonal antibody against the recombinant protein, rPmHHAP, was produced. Firstly, the rPmHHAP with histidine tag (-Leu-Glu-His6) at the C terminus was expressed in a bacterial expression system by using isopropyl 1-thio-β-d-galactopyranoside induction for 4 h (Fig. 3, lane 1). After affinity chromatography purification, a purified rPmHHAP was obtained (Fig. 3, lane 2), and this was used to generate an anti-rPmHHAP antibody in immunized rabbits. Western blot analysis indicated that the antibody reacted specifically with the rPmHHAP (Fig. 3, lane 4). The crude protein extracted from the shrimp hematopoietic tissue is shown in Fig. 3, lane 3. Western blot analysis with anti-rPmHHAP antibody identified the endogenous PmHHAP as one of the proteins in the hematopoietic tissue of P. monodon shrimp (Fig. 3, lane 5) with an of ∼1 kDa lower molecular mass than the recombinant protein.
FIGURE 3.
SDS-PAGE and Western blot analysis of recombinant HHAP (rPmHHAP) and native PmHHAP from P. monodon shrimp hematopoietic tissue. The crude protein extracted from PmHHAP-transformed E. coli after isopropyl 1-thio-β-d-galactopyranoside induction for 4 h (lane 1), the purified rPmHHAP (lane 2), and the crude protein extracted from shrimp hematopoietic tissue (lane 3) were separated by SDS-PAGE resolution (18% (w/v) acrylamide) followed by Coomassie Brilliant Blue staining. The purified rPmHHAP and the crude protein from P. monodon hematopoietic tissue were transferred onto PROTRANTM nitrocellulose transfer membrane (Whatman) for Western blot analysis probing with rabbit anti-rPmHHAP antibody: lane 4, rPmHHAP; lane 5, native PmHHAP. Lane M is the protein marker. Gels and blots shown are representative of at least two independent repeats.
PmHHAP mRNA Is Up-regulated in Response to WSSV Infection
PmHHAP was previously identified as a highly up-regulated gene in the hemocytes of WSSV-infected P. monodon by SSH. To confirm the differential expression of PmHHAP mRNA upon WSSV infection, PmHHAP transcript levels were evaluated by real-time RT-PCR. The results clearly demonstrated that PmHHAP mRNA expression was highly up-regulated in shrimp hemocytes after WSSV challenge, increasing by ∼3.0-, 8.3-, and 33.3-fold at 24, 48, and 72 h post infection, respectively, as compared with the gene expression in non-infected SPF hemocytes (Fig. 4A). Likewise, in the shrimp primary hemocyte cell culture, up-regulation of PmHHAP transcript levels in WSSV-infected in vitro hemocytes was also detected when compared with non-infected SPF hemocyte cells (Fig. 4B). These results strongly suggest that PmHHAP transcripts are significantly up-regulated in the mature P. monodon shrimp hemocytes in response to WSSV infection.
FIGURE 4.
A, relative expression ratios, as determined by real-time RT-PCR, of PmHHAP transcript levels in the hemocytes of WSSV-infected P. monodon compared with that of the control (non-infected) shrimp and standardized against β-actin as the internal reference, at 24, 48, and 72 h post WSSV infection. The data represent the mean (±1 S.D.) relative expression of PmHHAP (solid bar) and the control (open bar), derived from three independent experiments. Means with an asterisk are significantly different (p < 0.05, analyzed by paired samples t test). Relative expression ratio <1, 1, and >1 mean that the target gene expression is down-regulated, the same or up-regulated, respectively, in the hemocytes of WSSV-infected shrimp compared with the control. B, differential expression of PmHHAP mRNA in shrimp primary hemocyte cultures after WSSV infection compared with non-infected cells when examined by RT-PCR at 24 h post WSSV infection. β-Actin was used as internal reference. PCR amplicon profiles are representative of two independent trials.
Differential Expression and Subcellular Localization of PmHHAP in Shrimp Hemocytes
The expression of PmHHAP protein in hemocytes was evaluated with immunofluorescence and confocal microscopy. The hemocyte nucleus was stained with TO-PRO-3 iodide (blue fluorescent dye) while PmHHAP were recognized with anti-rPmHHAP antibody and visualized as a green (Alexa Fluor 488) fluorescent dye (Fig. 5). The PmHHAP signal in the WSSV-infected hemocytes was much stronger than that in the non-infected hemocytes, whereas the control where primary antibodies were not added had no signal (Fig. 5). Taken together, the results reveal that the hemocytic PmHHAP is not only up-regulated at the mRNA level but also at the protein level following a WSSV infection. Moreover, it was also found that PmHHAP was mainly distributed in the cytoplasm, and only partly located in a nuclear compartment of the hemocytes (Fig. 5).
FIGURE 5.
PmHHAP protein expression analysis in non-infected and WSSV-infected P. monodon hemocytes by immunofluorescence microscopy. The hemocytes from non-infected and WSSV-infected shrimp were stained with anti-rPmHHAP (green) and nuclei (blue) as detailed under “Experimental Procedures.” The fluorescent signal was detected by confocal microscopy. Images shown are representative of at least three such fields of view per sample and three independent samples.
Double Strand RNAi-mediated Knockdown of PmHHAP Gene Expression Resulted in Shrimp Mortality
RNAi has become a powerful tool to identify gene function by silencing the expression of specific genes with dsRNA and then analyzing their loss-of-function phenotype. Here, the systemic injection of 5.0 μg (1 μg of dsRNA/g of shrimp) and 10.0 μg (2 μg of dsRNA/g of shrimp) of PmHHAP dsRNA into shrimp of ∼5 g of body weight could knock down PmHHAP gene expression by ∼46 and 80%, respectively, whereas an injection of sodium chloride solution or GFP dsRNA had no effect on the gene silencing (Fig. 6A). Surprisingly, the knocked down shrimp displayed a very rapid mortality, 12 h post PmHHAP dsRNA injection (Fig. 6B). The shrimp challenged with 1 and 2 μg of PmHHAP dsRNA per gram of shrimp displayed a cumulative mortality of ∼20 and 70% at 18 h post dsRNA injection, respectively, and reached 100% mortality within 36 and 30 h post injection, respectively. In contrast, the control groups had no shrimp deaths over the 36-h time course studied (Fig. 6B). Accordingly, the results indicate that PmHHAP is indispensable for the survival of shrimp.
FIGURE 6.
A, gene-specific knockdown of PmHHAP transcript levels in WSSV-uninfected P. monodon hemocytes. The hemocytes from shrimp injected with 150 mm sodium chloride solution alone (NaCl) or containing GFP dsRNA (2 μg/g of shrimp) or PmHHAP dsRNA (1 and 2 μg/g of shrimp) for 24 h were collected and used to analyze PmHHAP gene expression levels by RT-PCR with β-actin as the internal reference. B, cumulative mortality analysis of PmHHAP-depleted shrimp. Shrimp were injected with NaCl alone or containing GFP dsRNA (2 μg/g of shrimp) or PmHHAP dsRNA (1 and 2 μg/g of shrimp), and their mortality was recorded every 6 h thereafter for 36 h. Data are reported as the average ± 1 S.D. and are derived from three independent trials.
Significant Decrease in Circulating Mature Hemocyte Numbers after PmHHAP Gene Knockdown
After PmHHAP dsRNA injection, peripheral (circulating) hemocytes in the shrimp hemolymph were reduced following dsRNA injection, whereas an injection of GFP dsRNA did not lead to any decrease in the hemocyte number (Fig. 7A), and this affect was more marked at 24 h after injection than after 12 h suggesting a possible continuous decline in levels until death. Evaluation of these data in terms of the concentration of circulating hemocytes in the knocked down shrimp reveals the same pattern, namely a 2- and 4-fold lower level of circulating hemocytes, compared with the control shrimp, at 12 and 24 h post PmHHAP dsRNA injection, respectively (Fig. 7B).
FIGURE 7.
Reduction of P. monodon hemocyte numbers after PmHHAP knockdown. The hemocyte numbers of shrimp injected with 150 mm sodium chloride solution (NaCl), PmHHAP dsRNA, or GFP dsRNA were examined at 0, 12, and 24 h post injection. A, the hemocyte density in “as extracted and seen” hemolymph. Photographs shown are representative of at least two such fields of view per sample and three different samples. B, the hemocyte density in the shrimp hemolymph. Data are reported as the average ± 1 S.D., derived from three independent trials. Means with an asterisk are significantly different (p < 0.05, analyzed by one-way analysis of variance and Scheffe post hoc test).
Morphology Changes in PmHHAP-depleted Hemocytes
All the observed hemocytes from the control group of shrimp, that is those that were injected with NaCl alone or containing GFP dsRNA for 12 and 24 h, were completely normal, and no morphological changes were observed. In contrast, clear changes in the morphology of the hemocytes were detected in the hemolymph of shrimp after PmHHAP dsRNA-mediated gene knockdown (Fig. 8). At 12 h post PmHHAP dsRNA injection, some hemocytes appeared abnormal and deformation was initiated, and by 24 h after the dsRNA injection, cell lysis and fragmentation into apoptotic-like bodies were observed (Fig. 8). Moreover, in vitro PmHHAP knockdown in the shrimp primary hemocyte cell culture corroborated the above in vivo results, with severe cell damage occurring in the PmHHAP-depleted hemocytes while most of the control hemocytes still looked healthy (Fig. 9). Altogether, our results reveal an essential function of PmHHAP in hemocyte homeostasis.
FIGURE 8.
Morphological analysis of P. monodon hemocytes in PmHHAP-knocked down and control (GFP dsRNA-injected) shrimp. The hemocytes were collected from shrimp 12 and 24 h after injection with GFP dsRNA or PmHHAP dsRNA at 1 μg of dsRNA/g of shrimp, fixed in 2.5% (w/v) glutaraldehyde solution, and subsequently prepared for and analyzed by scanning electron microscopy. Micrographs shown are representative of at least five fields of view per sample and three independent samples. Control samples after injection with NaCl alone (not shown) were the same as in GFP dsRNA, shown above.
FIGURE 9.
Severe cell damage occurred in the PmHHAP-depleted primary hemocyte cell culture. Hemocytes from WSSV-uninfected SPF P. monodon were collected and precultured in L-15 culture medium before in vitro transfection with 1 μg of PmHHAP or GFP dsRNA for 48 h. The hemocyte morphology was then observed by light microscopy. Total RNA was extracted from the transfected hemocytes, and subjected to RT-PCR for analysis of PmHHAP gene knockdown, with β-actin as internal reference (inset). Photographs shown are representative of at least two such fields of view per sample and three different samples, whereas PCR amplicon profiles shown in the inset are representative of two independent assays.
DISCUSSION
From our previous study, several WSSV-responsive genes were identified from an SSH cDNA library of P. monodon hemocytes, several of which were of unknown function.3 Among these genes, a novel viral responsive protein, named here HHAP, was highly up-regulated. A BLASTX search of the NCBI GenBankTM database revealed that the deduced amino acid sequence of PmHHAP significantly matched a hypothetical protein homolog from various invertebrates and vertebrates, with the highest similarity to the hypothetical protein TcasGA2_TC006773 from the red flour beetle, T. castaneum, with 54% amino acid sequence identity. In this study, the full HHAP sequence was determined from two crustacean species; the black tiger shrimp, P. monodon (PmHHAP), and the freshwater crayfish, P. leniusculus (PlHHAP). These two sequences exhibited 47% amino acid sequence identity to each other and shared eight conserved cysteine residues. Moreover, protein-structure analysis suggested that HHAP is likely to be a DNA-binding protein (99.2% possibility). The high predicted amino acid sequence identity of the HHAP sequences found in various organisms, and thus the potentially conserved function, and the possible DNA-binding properties, imply the potential importance of the HHAP protein.
The tissue distribution of HHAP transcripts in SPF P. monodon and P. leniusculus shrimp were different. Within P. monodon, PmHHAP mRNA expression was detectable in a wide variety of tissues, but mainly in the hematopoietic tissue and a low expression level in hemocytes. However, in P. leniusculus crayfish PlHHAP transcripts were only detected in nerve and hemopoietic tissues at low levels, and not at all in other tissues, including hemocytes. Moreover, the endogenous PmHHAP was also detected as one of the major proteins in the shrimp hematopoietic tissue (but not in circulating (mature) hemocytes themselves). In crustaceans, the hematopoietic tissue is reported to be an organ in which hemocyte proliferation and maturation take place (32–34). Hemocytes are produced and partially differentiated into young hemocytes in the hematopoietic tissue, and then became functional or mature hemocytes as they are released into circulation (33, 34). The high expression levels of HHAP transcripts in hematopoietic tissue may suggest a possible role in hemocyte production or maturation (hematopoiesis). Formerly, a new function of transglutaminase in crayfish was disclosed, in that it participates in preventing differentiation of hematopoietic stem cells (35). In addition, an endogenous cytokine-like factor, astakine, first described in crayfish (36), was required for cell proliferation and differentiation in the hematopoietic tissue of two crustaceans (36, 37), and ATP synthase in the plasma membrane of hematopoietic cells possibly functions as a receptor for astakine (38). Although there are some recent attempts to unveil crustacean hematopoiesis, the mechanisms regarding hemocyte synthesis and differentiation, the release of hemocytes into the circulation, and the maintenance of circulating hemocytes in crustaceans are still very indistinct.
To uncover the functions of HHAP, RNAi knockdown of the PmHHAP transcript expression in P. monodon shrimp was performed. The resultant partial average down-regulation (46 and 80% for the two doses tested) of PmHHAP transcript levels in circulating hemocyte cells correlated with a significant (2- to 4-fold) depletion of circulating hemocytes and a rapid mortality in the knocked down shrimp. The damage to hemocytes was demonstrated by scanning electron microscope (Fig. 8), and also observed in vitro in the shrimp primary hemocyte cell cultures (Fig. 9). These results suggest that PmHHAP plays an important role in hemocyte homeostasis, at least in P. monodon, because its knockdown initiates the deformation and lysis of hemocytes and a greatly decreased number of circulating hemocytes, as well as subsequent increased shrimp mortality. Notably in shrimp, the reduced hemocyte number is unlikely to be a direct cause of the significant increase in shrimp mortality, because depletion of up to 95% circulating hemocytes usually does not affect shrimp survival as new hemocytes are rapidly produced and released into the circulation. Therefore, we speculated that death in the HHAP knockdown shrimp might result from an inability of shrimp to recover circulating hemocytes due to loss of a critical function of HHAP that remains unclear and needs further investigation. Nevertheless, HHAP is clearly important in both shrimp viability and hemocyte homeostasis.
Hemocytes are widely admitted as a major cell type that plays several essential roles in the innate immunity (8). The number of circulating hemocytes in various crustaceans has been observed to decrease after viral infection (20, 21), or after challenge with bacterial components (34, 39), but this leads to a rapid recovery in the circulating hemocyte level by the induction of hemocytic maturation in hematopoietic tissue and the release of new hemocytes into the circulation (32, 34). From our results in P. monodon shrimp primary cell culture, the up-regulation of PmHHAP in WSSV-infected cultured hemocytes (Fig. 4B) clearly indicates that the increase of HHAP expression in the hemocytes of WSSV-infected shrimp is a result of gene up-regulation in the mature hemocytes, not from gene expression of HHAP in new hemocytes released from the hematopoietic tissue.
The high up-regulation level of hemocytic PmHHAP, both at the mRNA and at the protein level, in response to WSSV infection may suggest that PmHHAP is involved in the shrimp's immune response against viral infections. In the past, a few reports have proposed possible mechanisms for maintaining circulating hemocyte levels and protecting the infected shrimp from death, such as the rapid production and release of new hemocytes from hematopoietic tissue after infection (32, 34) and the control of over viral-triggered apoptosis by the action of the translationally controlled tumor protein (40). Our data clearly indicate that PmHHAP has a direct role in hemocyte persistence; thus, it is reasonable to speculate that the up-regulation of PmHHAP is a mechanism for maintaining the hemocyte level in the circulation by preventing too rapid hemocyte degradation and is also a way to control immune homeostasis in crustaceans during a viral infection.
Acknowledgments
We thank Prof. Timothy W. Flegel, Dr. Kallaya Sritunyalucksana, and Piyachat Sanguanrut for their help in immunofluorescence microscopy and Robert D. J. Butcher for critically reading the manuscript.
This work was supported by grants from The Commission on Higher Education, and the Thailand National Center for Genetic Engineering and Biotechnology and by a student fellowship (to A. P. and T. V.) from the Royal Golden Jubilee PhD Program, Thailand Research Fund. This work was also supported by the Thai Government Stimulus Package2 (TKK2555), under the Project for Establishment of Comprehensive Center for Innovative Food, Health Products, and Agriculture.
A. Prapavorarat and A. Tassanakajon, unpublished data.
- WSSV
- white spot syndrome virus
- dsRNA
- double-stranded RNA
- GFP
- green fluorescence protein
- HHAP
- hemocyte homeostasis-associated protein
- LB
- Luria-Bertani
- PBS
- phosphate-buffered saline
- Pl
- Pacifastacus leniusculus
- Pm
- Penaeus monodon
- rHHAP
- recombinant HHAP
- RNAi
- RNA interference
- SPF
- specific pathogen-free;
- SSH
- suppression subtractive hybridization
- RNAi
- RNA interference
- RACE
- rapid amplification of cDNA ends
- RT
- reverse transcription.
REFERENCES
- 1.Flegel T. W. (2006) Aquaculture 258, 1–33 [Google Scholar]
- 2.Chou H., Huang C., Wang C., Chiang H., Lo C. (1995) Dis. Aquat. Org. 23, 165–173 [Google Scholar]
- 3.Lo C., Ho C., Peng S., Chen C., Hsu H., Chiu Y., Chang C., Liu K., Su M., Wang C., Kou G. (1996) Dis. Aquat. Org. 27, 215–225 [Google Scholar]
- 4.Wang C. S., Tang K. F., Kou G. H., Chen S. N. (1997) J. Fish Dis. 20, 323–331 [Google Scholar]
- 5.Chang P., Lo C., Wang Y., Kou G. (1996) Dis. Aquat. Org. 27, 131–139 [Google Scholar]
- 6.Vlak J. M., Bonami J. R., Flegel T. W., Kou G. H., Lightner D. V., Lo C. F., Loh P. C., Walker P. W. (2004) VIIIth Report of the International Committee on Taxonomy of Viruses, Elsevier, Amsterdam, The Netherlands [Google Scholar]
- 7.Yang F., He J., Lin X., Li Q., Pan D., Zhang X., Xu X. (2001) J. Virol. 75, 11811–11820 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Jiravanichpaisal P., Lee B. L., Söderhäll K. (2006) Immunobiology 211, 213–236 [DOI] [PubMed] [Google Scholar]
- 9.Hoffmann J. A., Kafatos F. C., Janeway C. A., Ezekowitz R. A. (1999) Science 284, 1313–1318 [DOI] [PubMed] [Google Scholar]
- 10.Iwanaga S., Lee B. L. (2005) Mol. Biol. 38, 128–150 [DOI] [PubMed] [Google Scholar]
- 11.Liu H., Söderhäll K., Jiravanichpaisal P. (2009) Fish Shellfish Immunol. 27, 79–88 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Tsing A., Arcier J. M., Brehelin M. (1989) J. Invertebr. Pathol. 53, 64–77 [Google Scholar]
- 13.Bauchau A. G. (1980) in Invertebrate Blood Cells, pp. 385–420, Academic Press, New York [Google Scholar]
- 14.Smith V. J., Söderhäll K. (1983) Cell Tissue Res. 233, 295–303 [DOI] [PubMed] [Google Scholar]
- 15.Smith V. J., Söderhäll K. (1983) Biol. Bull. 164, 299–314 [Google Scholar]
- 16.Sung H. H., Chang H. J., Her C. H., Chang J. C., Song Y. L. (1998) J. Invertebr. Pathol. 71, 26–33 [DOI] [PubMed] [Google Scholar]
- 17.Pech L. L., Strand M. R. (2000) J. Insect Physiol. 46, 1565–1573 [DOI] [PubMed] [Google Scholar]
- 18.Kobayashi M., Johansson M. W., Söderhäll K. (1990) Cell Tissue Res. 260, 13–18 [Google Scholar]
- 19.Persson M., Vey A., Söderhäll K. (1987) Cell Tissue Res. 247, 409–417 [Google Scholar]
- 20.van de Braak C. B., Botterblom M. H., Huisman E. A., Rombout J. H., van der Knaap W. P. (2002) Dis. Aquat. Org. 51, 149–155 [DOI] [PubMed] [Google Scholar]
- 21.Wongprasert K., Khanobdee K., Glunukarn S. S., Meeratana P., Withyachumnarnkul B. (2003) Dis. Aquat. Org. 55, 3–10 [DOI] [PubMed] [Google Scholar]
- 22.Wang L., Zhi B., Wu W., Zhang X. (2008) Dev. Comp. Immunol. 32, 706–715 [DOI] [PubMed] [Google Scholar]
- 23.Granja C. B., Aranguren L. F., Vidal O. M., Aragón L., Salazar M. (2003) Dis. Aquat. Org. 54, 73–78 [DOI] [PubMed] [Google Scholar]
- 24.Wang W., Zhang X. (2008) Fish Shellfish Immunol. 25, 522–527 [DOI] [PubMed] [Google Scholar]
- 25.Du H., Fu L., Xu Y., Kil Z., Xu Z. (2007) Aquaculture 262, 532–534 [Google Scholar]
- 26.Paterson W. D., Stewart J. E. (1974) J. Fish Res. Board Can. 31, 1051–1056 [Google Scholar]
- 27.Pfaffl M. W. (2001) Nucleic Acids Res. 29, e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Altschul S. F., Gish W., Miller W., Myers E. W., Lipman D. J. (1990) J. Mol. Biol. 215, 403–410 [DOI] [PubMed] [Google Scholar]
- 29.Ahmad S., Gromiha M. M., Sarai A. (2004) Bioinformatics. 20, 477–486 [DOI] [PubMed] [Google Scholar]
- 30.Ferrè F., Clote P. (2005) Nucleic Acids Res. 33, W230–W232 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Schultz J., Milpetz F., Bork P., Ponting C. P. (1998) Proc. Natl. Acad. Sci. U.S.A. 95, 5857–5864 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.van de Braak C. B., Botterblom M. H., Liu W., Taverne N., van der Knaap W. P., Rombout J. H. (2002) Fish Shellfish Immunol. 12, 253–272 [DOI] [PubMed] [Google Scholar]
- 33.Chaga O., Lignell M., Söderhäll K. (1995) Anim. Biol. 4, 59–70 [Google Scholar]
- 34.Söderhäll I., Bangyeekhun E., Mayo S., Söderhäll K. (2003) Dev. Comp. Immunol. 27, 661–672 [DOI] [PubMed] [Google Scholar]
- 35.Lin X., Söderhäll K., Söderhäll I. (2008) BMC Immunol. 9, 58. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Söderhäll I., Kim Y. A., Jiravanichpaisal P., Lee S. Y., Söderhäll K. (2005) J. Immunol. 174, 6153–6160 [DOI] [PubMed] [Google Scholar]
- 37.Hsiao C. Y., Song Y. L. (2010) Fish Shellfish Immunol. 28, 77–86 [DOI] [PubMed] [Google Scholar]
- 38.Lin X., Kim Y. A., Lee B. L., Söderhäll K., Söderhäll I. (2009) Exp. Cell Res. 315, 1171–1180 [DOI] [PubMed] [Google Scholar]
- 39.Lorenzon S., Guarrini S. D., Smith V. J., Ferrero E. A. (1999) Fish Shellfish Immunol. 9, 31–50 [Google Scholar]
- 40.Bangrak P., Graidist P., Chotigeat W., Phongdara A. (2004) J. Biotechnol. 108, 219–226 [DOI] [PubMed] [Google Scholar]









