Abstract
Background/Aims
Human trypsinogens are post-translationally sulfated on Tyr154 by the Golgi resident enzyme tyrosylprotein sulfotransferase-2 (TPST2). Tyrosine sulfation stimulates the autoactivation of human cationic trypsinogen. Because increased trypsinogen autoactivation has been implicated as a pathogenic mechanism in chronic pancreatitis, we hypothesized that genetic variants of TPST2 might alter the risk for the disease.
Methods
We sequenced the 4 protein-coding exons and the adjacent intronic sequences of TPST2 in 151 subjects with chronic pancreatitis and in 169 healthy controls. The functional effect of TPST2 variants on trypsinogen sulfation was analyzed in transfected HEK 293T cells.
Results
We detected 10 common polymorphic variants, including 6 synonymous variants and 4 intronic variants, with similar frequencies in patients and controls. None of the 8 common haplotypes reconstructed from the frequent variants showed an association with chronic pancreatitis. In addition, we identified 5 rare TPST2 variants, which included 3 synonymous alterations, the c.458G>A (p.R153H) nonsynonymous variant and the c.-9C>T variant in the 5′ untranslated region. The p.R153H variant was found in a family with hereditary pancreatitis; however, it did not segregate with the disease. In functional assays, both the p.R153H and c.-9C>T TPST2 variants catalyzed trypsinogen sulfation as well as wild-type TPST2.
Conclusion
Genetic variants of human TPST2 exert no influence on the risk of chronic pancreatitis.
Key Words: Chronic pancreatitis, Genetic association study, Tyrosine sulfation, tyrosylprotein sulfotransferase-2 variant, tyrosylprotein sulfotransferase-2 haplotype, PHASE
Introduction
The imbalance between trypsinogen activation and trypsin inactivation seems to be an important pathogenic factor in the development of chronic pancreatitis. Genetic variants that stimulate the autoactivation of cationic trypsinogen (PRSS1, OMIM 276000) have been found in families with hereditary chronic pancreatitis and in subjects with idiopathic chronic pancreatitis without a family history [1,2] and references therein]. Triplication and duplication of the trypsinogen locus was identified in a subset of patients with hereditary and idiopathic chronic pancreatitis. This type of genetic alteration is believed to lead to increased trypsinogen expression and activation through a gene dosage effect [3,4]. Loss of function variants of the pancreatic secretory trypsin inhibitor (SPINK1, OMIM 167790) and the trypsin degrading enzyme chymotrypsin C (CTRC, OMIM 601405) are associated with different forms of chronic pancreatitis [5,6,7,8,9]. Thus, not only enhanced trypsin activation, but also impairment of trypsin inhibition or trypsin degradation increases the risk of chronic pancreatitis. In contrast, a degradation-sensitive variant of anionic trypsinogen (PRSS2, OMIM 601564) was shown to afford protection against chronic pancreatitis [10,11,12].
Human trypsinogens are modified post-translationally by the sulfation of Tyr154 [13,14,15]. Tyrosine sulfation is catalyzed by the enzyme tyrosylprotein sulfotransferase (TPST) in the trans-Golgi network. In humans, 2 TPST isoenzymes TPST1 (OMIM 603125) and TPST2 (OMIM 603126) are expressed in all tissues [16,17,18,19]. In cell culture experiments, both TPST enzymes are capable of trypsinogen sulfation [20]. In the human pancreas, TPST2 is expressed at levels 50-fold higher than TPST1, indicating that physiological trypsinogen sulfation is mediated by TPST2 [18,21,22]. Notably, TPST2 expression is approximately 10-fold higher in the pancreas than in other human tissues. With respect to trypsinogen function, the only significant consequence of tyrosine sulfation is increased autoactivation of cationic trypsinogen [14,20]. In contrast, tyrosine sulfation does not affect the autoactivation of anionic trypsinogen. Furthermore, the common p.D153H African polymorphism in anionic trypsinogen abolishes trypsinogen sulfation, suggesting that the modification plays no important functional role in this isoform [20]. Because increased autoactivation of cationic trypsinogen has been linked to the pathogenesis of hereditary pancreatitis [[23] and references therein], we hypothesized that altered trypsinogen sulfation due to genetic variants of TPST2 might modify the risk for chronic pancreatitis. To test this notion, we screened the protein-coding exons of the human TPST2 gene by direct sequencing in subjects with chronic pancreatitis and healthy controls.
Materials and Methods
Patients
We investigated 151 unrelated patients with chronic pancreatitis (including 73 female and 78 male patients), of which 104 had idiopathic chronic pancreatitis, 40 hereditary chronic pancreatitis and 7 patients alcoholic chronic pancreatitis (median age 33 years, mean age 35.8, range 9–83). All patients were negative for PRSS1 mutations. The 104 patients with idiopathic chronic pancreatitis were all investigated for SPINK1 variants; 49 patients were heterozygous and 9 homozygous for p.N34S, and 1 patient carried a c.27delC variant. CFTR variants were tested in 66 of the 104 subjects with idiopathic chronic pancreatitis with the following results: 6 × p.F508del, 1 × p.S1235R, 1 × p.R117H, 5 × p.R75Q, 1 × p.R74Q, 5 × p.E528E, 2 × 5T, 1 × p.I507V and 1 × IVS16–2A>G. As healthy controls, 169 subjects were enrolled (131 females, 38 males; median age 47 years, mean age 46.5, range 20–81). This study was approved by the medical ethical review committee of the University of Leipzig. All individuals gave informed consent. The diagnosis of chronic pancreatitis was based on 2 or more of the following findings: presence of a typical history of recurrent pancreatitis, pancreatic calcifications and/or pancreatic ductal irregularities revealed by endoscopic retrograde pancreatography or by magnetic resonance imaging of the pancreas and/or pathological sonographic findings. Hereditary chronic pancreatitis was diagnosed when one 1st-degree relative or 2 or more 2nd-degree relatives suffered from recurrent acute or chronic pancreatitis without any apparent precipitating factors. Idiopathic chronic pancreatitis was diagnosed in the absence of a positive family history or possible precipitating factors, such as alcohol abuse, trauma, medication, infection and metabolic disorders. Alcohol-induced chronic pancreatitis was diagnosed in patients who consumed more than 60 g (females) or 80 g (males) of ethanol per day for more than 2 years.
Sequence Analysis of TPST2
DNA was extracted from peripheral blood leukocytes. We analyzed all 4 protein-coding exons and their flanking intronic sequences in TPST2 by unidirectional DNA sequencing of PCR amplicons (fig. 1). Sequence variants were confirmed by DNA sequencing of a 2nd independent PCR amplification. The sequences of primers used for PCR amplification and DNA sequencing are given in table 1.
Fig. 1.
Organization of the TPST2 gene and transcripts in humans. The numbers indicate the lengths of the exons in base pairs. NM_001008566.1 and NM_003595.3 are the GenBank accession numbers for the 2 transcript variants. gDNA = Genomic DNA; CDS = protein-coding sequence.
Table 1.
Oligonucleotide primers used for PCR amplification and sequencing of the 4 protein-coding exons and the exon/intron junctions in TPST2
| Exon | Primer name | Primer sequence (5′→3′) |
|---|---|---|
| Exon 3 (primer set 1) | 1F-T1-PCR | GAAAGGTGCCCTCTGCATTC |
| 1R-T1-PCR | CCGAGGAAGTCGAGGATGAG | |
| 1F-T1-SEQ | ACTATGCATGTCCCCCTCTCT | |
| Exon 3 (primer set 2) | 1F-T2-PCR | GGGACAGCAGGTGCTAGAGT |
| 1R-T2-PCR | GAAAGGAGAGGAGTAATTGTTGTCA | |
| 1R-T2-SEQ | ATGAAACGGAGGCTCAGAGA | |
| Exon 4 | F-PCR | CTGTGCCTGACCTAAACTGTTG |
| R-PCR | CTGGCCTGCTGTTAGATGTTAGAG | |
| F-SEQ | GTACCAATGGTGTATACTGCTAG | |
| Exon 5 | F-PCR | CTAATCCCACCTCTTTACTGTAC |
| R-PCR | GGAAAACCATCAACCAGAGTGG | |
| F-SEQ | GCTATGTCCTTGTTTATCTGTG | |
| Exon 6 | F-PCR | CTCATAGCAGCCTGTCATATTGC |
| R-PCR | CCATCATAGTGGTGCTTCCTGC | |
| F-SEQ | GCAGCCTGTCATATTGCCCAAG | |
The annealing temperature was 62°C for all primers listed. F = Forward; R = reverse; PCR = polymerase chain reaction; SEQ = sequencing.
PCR reactions were performed under the following conditions: 0.75 U AmpliTaq Gold polymerase (Applied Biosystems, Foster City, Calif., USA), 450 μmol/l deoxynucleoside triphosphates and 0.3 μmol/l of each primer were used in a total volume of 25 μl. Cycle conditions were as follows: initial denaturation for 6 min at 95°C; 48 cycles of 20-second denaturation at 95°C, 40-second annealing at 62°C and 90-second primer extension at 72°C; and a final extension step for 6 min at 72°C. PCR products were digested with shrimp alkaline phosphatase (USB Europe, Staufen, Germany) and exonuclease I (USB). Cycle sequencing was performed using BigDye terminator mix (Applied Biosystems). The reaction products were purified on a Sephadex G-50 column (GE Healthcare, Piscataway, N.J., USA) or by ethanol precipitation, and were loaded onto an ABI 3100-Avant fluorescence sequencer (Applied Biosystems). Sequencing data were analyzed using ABI DNA sequencing analysis software (Version 1.1.2).
Nucleotide numbering was based on the TPST2 cDNA sequence (GenBank NM_001008566.1 and NM_003595.3), with the 1st nucleotide of the ATG start codon designated as +1. The mutations are described according to the nomenclature recommended by the Human Genome Variation Society (http://www.hgvs.org/mutnomen). Haplotype reconstruction was performed using PHASE software v2.1 [24,25]. For the reconstruction of haplotypes, only single nucleotide polymorphisms with a minor allele frequency of ≥5% were considered.
The significance of the differences between variation frequencies in affected individuals and controls was tested by a 2-tailed Fisher's exact test and calculated using GraphPad Prism v4.03. p < 0.05 was considered to be of statistical significance.
Plasmid Construction and Mutagenesis
Construction of the pcDNA3.1(-)_PRSS1, pcDNA3.1(–)_PRSS2 and pcDNA3.1(–)_TPST2 plasmids were described previously [26,20]. Mutation p.R153H was introduced into pcDNA3.1 (–)_TPST2 by overlap extension PCR mutagenesis. In the pcDNA3.1(–)_TPST2 expression plasmid, the 5′ untranslated region was only 6 nucleotides long and was altered to generate an optimal Kozak sequence [20]. To analyze the effect of the c.-9C>T variant on the translation of TPST2, we constructed a new TPST2 expression plasmid which contained 29 nucleotides of unadulterated 5′ upstream sequence. This was achieved by amplifying the TPST2 sequence from IMAGE clone No. 4857366 (GenBank BC017509) using the TPST2 XhoI ver2 sense primer [5′-CGG GCC CTC GAG GCC AGG CCT ACC CTG CCT-3′ (where the XhoI site is underlined)] and the previously described TPST2 BamHI antisense primer [20]. The PCR product was digested with XhoI and BamHI, and cloned into the pcDNA3.1(–) plasmid. Variant c.-9C>T was then introduced into this plasmid by PCR mutagenesis using the following mutagenic primer: 5′-CGG GCC CTC GAG GCC AGG CCT ACC CTG CCT CTG GCC CAG-3′ (where the XhoI 5′ cloning site is underlined and the altered nucleotide in the c.-9C>T variant is set in bold and underlined).
Functional Analysis of TPST2 Variants
To analyze the activity of TPST2 variants, we used a previously developed method in which HEK 293T cells are cotransfected with a constant amount of pcDNA3.1(–)_PRSS2 or pcDNA3.1(–)_PRSS1 plasmid and increasing amounts of pcDNA3.1(–)_TPST2 plasmid. TPST2 activity is characterized by measuring the level of sulfated trypsinogen in the conditioned medium by Western blotting using an antisulfotyrosine IgG antibody [20,27,28]. Cell culture conditions, the transfection protocol and details of Western blotting were described previously [20].
Results
The human TPST2 gene is located on chromosome 22 and contains 8 exons, including 2 alternatively spliced exons 1 (fig. 1). Only exons 3, 4, 5 and 6 code for protein. Since the majority of known pancreatitis-associated mutations affect the coding region or the exon-intron junctions of the PRSS1, SPINK1 and CTRC genes, we focused our investigation on the protein-coding exons and their flanking intronic sequences in TPST2.
We sequenced these regions in 151 subjects with chronic pancreatitis and 169 healthy controls, detecting 15 nucleotide variants in the TPST2 gene including 10 commonly observed polymorphisms (tables 2, 3) and 5 rare mutations (table 4). None of the 10 frequent variants showed a statistically significant distribution difference between patients and controls when allele-frequencies or genotype-frequencies (dominant and recessive model) were compared (tables 2, 3). To determine whether a distinct haplotype might be associated with chronic pancreatitis, haplotypes were reconstructed considering variants with a minor allele frequency of ≥5% using PHASE v2.1. With this method, 22 haplotypes were defined, of which 8 had a frequency of ≥5%. However, the frequencies of the haplotypes were similar in patients and controls (table 5).
Table 2.
Allelic frequencies of common TPST2 variants in subjects with chronic pancreatitis and in healthy controls
| Variant | Allele | Patients | Controls |
|---|---|---|---|
| c.270C>G (p.=) | C | 268/302 (88.7) | 306/338 (90.5) |
| Ala90 rs4822735 | G | 34/302(11.3) | 32/338 (9.5) |
| c.276C>T (p.=) | C | 273/302 (90.4) | 317/338 (93.8) |
| Pro92 rs17851532 | T | 29/302 (9.6) | 21/338 (6.2) |
| c.399G>C (p.=) | G | 296/302(98) | 333/338 (98.5) |
| Leul33 | C | 6/302 (2) | 5/338 (1.5) |
| c.510G>T (p.=) | G | 277/302 (91.7) | 298/338 (88.2) |
| Ser170 rs5761587 | T | 25/302 (8.3) | 40/338(11.8) |
| c.700C>T (p.=) | C | 235/302 (77.8) | 268/338 (79.3) |
| Leu234 rs12169509 | T | 67/302 (22.2) | 70/338 (20.7) |
| c.831C>T (p.=) | C | 272/302 (90.1) | 315/338 (93.2) |
| Val277 rs58274935 | T | 30/302 (9.9) | 23/338 (6.8) |
| c.1041+104C>T | C | 155/302(51.3) | 151/338 (44.7) |
| rs3752523 | T | 147/302 (48.7) | 187/338 (55.3) |
| c.1093−108G>A | G | 212/302 (70.2) | 238/338 (70.4) |
| rs2283823 | A | 90/302 (29.8) | 100/338 (29.6) |
| c.1093−84G>A | G | 212/302 (70.2) | 238/338 (70.4) |
| rs2283822 | A | 90/302 (29.8) | 100/338 (29.6) |
| c.*31G>A | G | 212/302 (70.2) | 238/338 (70.4) |
| rs2283821 | A | 90/302 (29.8) | 100/338 (29.6) |
For the synonymous variants (p.=), the affected codons are indicated. The dbSNP identifiers are also listed. Figures in parentheses are percentages.
Table 3.
Genotype frequencies of common TPST2 variants in subjects with chronic pancreatitis and in healthy controls
| Variant | Genotype | Patients | Controls |
|---|---|---|---|
| c.270C>G | CC | 119/151 (78.8) | 140/169 (82.8) |
| CG | 30/151 (19.9) | 26/169 (15.4) | |
| GG | 2/151 (1.3) | 3/169(1.8) | |
| c.276C>T | CC | 123/151 (81.5) | 148/169 (87.6) |
| CT | 27/151 (17.9) | 21/169(12.4) | |
| TT | 1/151 (0.7) | 0/169 | |
| c.399G>C | GG | 145/151 (96) | 164/169 (97) |
| GC | 6/151 (4) | 5/169 (3) | |
| CC | 0/151 | 0/169 | |
| c.510G>T | GG | 127/151 (84.1) | 135/169 (79.9) |
| GT | 23/151 (15.2) | 28/169 (16.6) | |
| TT | 1/151 (0.7) | 6/169 (3.6) | |
| c.700C>T | CC | 93/151 (61.6) | 107/169 (63.3) |
| CT | 49/151 (32.5) | 54/169 (32) | |
| TT | 9/151 (6) | 8/169 (4.7) | |
| c.831C>T | CC | 121/151 (80.1) | 148/169 (87.6) |
| CT | 30/151 (19.9) | 19/169(11.2) | |
| TT | 0/151 | 2/169(1.2) | |
| c.1041+104C>T | CC | 39/151 (25.8) | 34/169 (20.1) |
| CT | 77/151 (51) | 83/169 (49.1) | |
| TT | 35/151 (23.2) | 52/169 (30.8) | |
| c.1093-108G>A | GG | 75/151 (49.7) | 87/169 (51.5) |
| GA | 62/151 (41.1) | 64/169 (37.9) | |
| AA | 14/151 (9.3) | 18/169(10.7) | |
| c.1093-84G>A | GG | 75/151 (49.7) | 87/169 (51.5) |
| GA | 62/151 (41.1) | 64/169 (37.9) | |
| AA | 14/151 (9.3) | 18/169(10.7) | |
| c.*31G>A | GG | 75/151 (49.7) | 87/169 (51.5) |
| GA | 62/151 (41.1) | 64/169 (37.9) | |
| AA | 14/151 (9.3) | 18/169(10.7) | |
Figures in parentheses are percentages.
Table 4.
Rare TPST2 variants in subjects with chronic pancreatitis and in healthy controls
| Variant | Patients | Controls |
|---|---|---|
| c.-9C>T | 1/151 (0.7) | 0/169 (0) |
| c.177C>T (p.=) His59 | 1/151 (0.7) | 1/169 (0.6) |
| c.458G>A (p.R153H) | 1/151 (0.7) | 1/169 (0.6) |
| c.822C>T (p.=) Pro274 | 0/151 (0) | 1/169 (0.6) |
| c.900G>A (p.=) Lys300 | 1/151 (0.7) | 0/169 (0) |
For the synonymous variants (p.=), the affected codons are indicated. Figures in parentheses are percentages.
Table 5.
Common TPST2 haplotypes in subjects with chronic pancreatitis and in healthy controls
| Haplotypes | Patients | Controls | |
|---|---|---|---|
| 1 | C-C-G-C-C-C-G-G-G | 60/302 (19.9) | 60/338 (17.8) |
| 2 | G-C-G-C-C-C-G-G-G | 28/302 (9.3) | 25/338 (7.4) |
| 3 | C-C-G-C-C-T-G-G-G | 52/302 (17.2) | 74/338 (21.9) |
| 4 | C-C-G-T-C-T-G-G-G | 35/302(11.6) | 46/338 (13.6) |
| 5 | C-T-G-T-C-T-G-G-G | 23/302 (7.6) | 18/338 (5.3) |
| 6 | C-C-G-C-C-C-A-A-A | 29/302 (9.6) | 34/338 (10.1) |
| 7 | C-C-G-C-T-C-A-A-A | 22/302 (7.3) | 18/338 (5.3) |
| 8 | C-C-T-C-C-T-A-A-A | 23/302 (7.6) | 34/338 (10.1) |
Haplotypes were reconstructed using PHASE v2.1 considering TPST2 variants with a minor allele frequency of ≥5%. The variable nucleotides defining the haplotypes are listed according to their order within the haplotypes: c.270C/G, c.276C/T, c.510G/T, c.700C/T, c.831C/T, c.1041+104C/T, c.1093-108G/A, c.1093-84G/A and c.*31G/A. In total 22 haplotypes were defined. The 8 haplotypes listed here occurred with a frequency of ≥5%. Figures in parentheses are percentages.
The only missense variant found in this study was c.458G>A (p.R153H), which was present in 1 of 151 (0.7%) patients and in 1 of 169 (0.6%) controls in a heterozygous form. The carrier patient was also heterozygous for the p.N34S SPINK1 variant and had a family history of chronic pancreatitis with an affected father and grandfather. The p.R153H TPST2 variant, however, did not segregate with the disease, as the patient inherited this variant maternally from her unaffected mother and grandmother (fig. 2). Functional assays using HEK 293T cells cotransfected with human anionic or cationic trypsinogen and TPST2 demonstrated that the p.R153H variant catalyzed trypsinogen sulfation as well as wild-type TPST2, indicating that neither TPST2 expression nor activity is affected by the mutation (fig. 3). We conclude that p.R153H is a functionally innocuous TPST2 variant not associated with chronic pancreatitis.
Fig. 2.
A hereditary pancreatitis family carrying the TPST2 p.R153H and the SPINK1 p.N34S variants. Individuals suffering from chronic pancreatitis are highlighted in gray. Family members tested negative for PRSS1 (exons 2 and 3) and CTRC (exons 2, 3 and 7) variants. The asterisk indicates the index patient. het. = Heterozygous carrier.
Fig. 3.
Sulfation of human anionic trypsinogen (PRSS2) and human cationic trypsinogen (PRSS1) by TPST2 variant p.R153H. HEK 293T cells were cotransfected with 2 μg pcDNA3.1(–)_PRSS2 (a) or 2 μg pcDNA3.1(–)_PRSS1 (b) plasmid and increasing amounts (0–25 ng) of wild-type pcDNA3.1(–)_TPST2 plasmid or variant p.R153H. Note that for these experiments, the p.K237D/p.N241D PRSS1 variant was used, which is expressed almost 3-fold better than the wild type [see 20]. Conditioned media were collected after 48 h and sulfated trypsinogen levels were determined by Western blotting. Briefly, 50 μl (PRSS2) or 150 μl (PRSS1) aliquots of media were precipitated with 10% trichloroacetic acid, resuspended in reducing Laemmli sample buffer, heat denatured and electrophoresed on 15% SDS-polyacrylamide gels. The proteins were transferred onto an Immobilon-P membrane and the membrane was incubated with antityrosine-sulfate IgG at a dilution of 1:2,000. Horseradish peroxidase conjugated rabbit polyclonal antibody against human IgG was used as secondary antibody at a dilution of 1:10,000. Horseradish peroxidase was detected using the SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific, Waltham, Mass., USA).
We also identified a c.-9C>T variant in the 5′ untranslated region of TPST2 in 1 of 151 patients (0.7%). Because of its proximity to the initiator ATG codon, this variant has the potential to alter the translation efficiency of TPST2. We found, however, no difference in the expression of the c.-9C>T variant and wild-type TPST2 in transfected HEK 293T, as judged by the TPST2-mediated sulfation of anionic trypsinogen (fig. 4). The results demonstrate that the c.-9C>T variant has no effect on the translation of the TPST2 protein and, therefore, should be classified as a functionally harmless variant.
Fig. 4.
Expression of TPST2 variant c.-9C>T as assessed by sulfation of human anionic trypsinogen. HEK 293T cells were cotransfected with 2 μg pcDNA3.1(–)_PRSS2 plasmid and increasing amounts (0–80 ng) of wild-type pcDNA3.1(–)_TPST2 plasmid or variant c.-9C>T. Conditioned media were collected after 48 h and sulfated trypsinogen levels were determined by Western blotting as described in figure 3.
Discussion
In this study, we tested the hypothesis that changes in tyrosine sulfation of human trypsinogens might alter the risk for chronic pancreatitis. This notion was based on the observation that human trypsinogens undergo post-translational sulfation and this modification leads to increased autoactivation of cationic trypsinogen [14,20]. Genetic variants of cationic trypsinogen cause hereditary pancreatitis by stimulating trypsinogen autoactivation; therefore, it seemed reasonable to assume that sulfation-stimulated autoactivation might represent a similar risk [[23] and references therein]. Conversely, decreased sulfation might be protective against chronic pancreatitis. To determine whether genetic variants of TPST2 alter the risk of chronic pancreatitis, we sequenced the protein-coding exons and their adjacent intronic sequences of TPST2 in subjects with chronic pancreatitis and healthy control subjects. We identified several variants, but no association with chronic pancreatitis was evident regardless of whether individual variants or haplotypes were considered. Previously, Iida et al. [29] sequenced the TPST2 gene in 48 healthy Japanese volunteers and described 22 intronic variants and a variant in the 3′ untranslated region. Allele or genotype frequencies were not reported, and there were only 2 variants (c.1041 + 104C>T and c.∗31G>A) described in this dataset which were also identified in Germans in our present study, suggesting ethnic differences in TPST2 variations.
We found a single nonsynonymous variant in the coding region of TPST2, indicating that missense variants in this gene are rare. The p.R153H variant was detected in a healthy control subject and in a family affected with hereditary pancreatitis. However, the variant did not segregate with the disease and functional assays indicated no changes in TPST2 activity. Taken together, the genetic and biochemical data indicate that the p.R153H variant is functionally neutral and does not alter the risk for chronic pancreatitis. The paucity of missense variants in the TPST2 gene is in line with the high degree of sequence conservation among mammalian TPST2 enzymes. For example, at the amino acid level, the human and mouse enzymes are 94% identical and the human and bovine enzymes are 93% identical. The evolutionary conservation suggests an indispensable physiological function for TPST2. Indeed, selective disruption of the TPST2 gene in mice resulted in infertility, hypothyroidism and delayed growth [30,31]. Hypothyroidism was also observed in a dwarf mouse strain which carried the natural p.H266Q mutation in the TPST2 gene [32].
In a subject with chronic pancreatitis, we identified a c.-9C>T variant that seemed to have the potential to alter the translation efficiency of TPST2 due to its proximity to the initiator ATG codon. Functional analysis, however, demonstrated that expression of wild-type TPST2 and the c.-9C>T variant were comparable, indicating that translation of the TPST2 protein was not affected. Therefore, the c.-9C>T variant is functionally harmless.
In conclusion, the present study found no association between genetic variants of TPST2 and chronic pancreatitis. The genetic and biochemical data presented here can facilitate further analysis of the TPST2 gene in a variety of human diseases.
Acknowledgements
This work was supported by the Deutsche Forschungsgemeinschaft Ro 3929/1-1 (to J.R.) and NIH grants AA014544 and DK058088 to M.S.-T. We thank the individuals who have participated in this study. We also thank Claudia Ruffert (Leipzig) and Knut Krohn, Birgit Oelzner and Kathleen Stein (Interdisciplinary Center for Clinical Research Leipzig, Core Unit for DNA-Technologies) for their excellent technical assistance.
Footnotes
J.R. and Z.R. contributed equally to this work.
References
- 1.Whitcomb DC, Gorry MC, Preston RA, Furey W, Sossenheimer MJ, Ulrich CD, Martin SP, Gates LK, Jr, Amann ST, Toskes PP, Liddle R, McGrath K, Uomo G, Post JC, Ehrlich GD. Hereditary pancreatitis is caused by a mutation in the cationic trypsinogen gene. Nat Genet. 1996;14:141–145. doi: 10.1038/ng1096-141. [DOI] [PubMed] [Google Scholar]
- 2.Teich N, Rosendahl J, Tóth M, Mössner J, Sahin-Tóth M. Mutations of human cationic trypsinogen (PRSS1) and chronic pancreatitis. Hum Mutat. 2006;27:721–730. doi: 10.1002/humu.20343. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Le Maréchal C, Masson E, Chen JM, Morel F, Ruszniewski P, Levy P, Férec C. Hereditary pancreatitis caused by triplication of the trypsinogen locus. Nat Genet. 2006;38:1372–1374. doi: 10.1038/ng1904. [DOI] [PubMed] [Google Scholar]
- 4.Masson E, Le Maréchal C, Chandak GR, Lamoril J, Bezieau S, Mahurkar S, Bhaskar S, Reddy DN, Chen JM, Férec C. Trypsinogen copy number mutations in patients with idiopathic chronic pancreatitis. Clin Gastroenterol Hepatol. 2008;6:82–88. doi: 10.1016/j.cgh.2007.10.004. [DOI] [PubMed] [Google Scholar]
- 5.Witt H, Luck W, Hennies HC, Classen M, Kage A, Lass U, Landt O, Becker M. Mutations in the gene encoding the serine protease inhibitor, Kazal type 1 are associated with chronic pancreatitis. Nat Genet. 2000;25:213–216. doi: 10.1038/76088. [DOI] [PubMed] [Google Scholar]
- 6.Witt H, Luck W, Becker M, Böhmig M, Kage A, Truninger K, Ammann RW, O'Reilly D, Kingsnorth A, Schulz HU, Halangk W, Kielstein V, Knoefel WT, Teich N, Keim V. Mutation in the SPINK1 trypsin inhibitor gene, alcohol use, and chronic pancreatitis. JAMA. 2001;285:2716–2717. doi: 10.1001/jama.285.21.2716-a. [DOI] [PubMed] [Google Scholar]
- 7.Chandak GR, Idris MM, Reddy DN, Bhaskar S, Sriram PV, Singh L. Mutations in the pancreatic secretory trypsin inhibitor gene (PSTI/SPINK1) rather than the cationic trypsinogen gene (PRSS1) are significantly associated with tropical calcific pancreatitis. J Med Genet. 2002;39:347–351. doi: 10.1136/jmg.39.5.347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Rosendahl J, Witt H, Szmola R, Bhatia E, Ózsvári B, Landt O, Schulz HU, Gress TM, Pfützer R, Löhr M, Kovacs P, Blüher M, Stumvoll M, Choudhuri G, Hegyi P, te Morsche RH, Drenth JP, Truninger K, Macek M, Jr, Puhl G, Witt U, Schmidt H, Büning C, Ockenga J, Kage A, Groneberg DA, Nickel R, Berg T, Wiedenmann B, Bödeker H, Keim V, Mössner J, Teich N, Sahin-Tóth M. Chymotrypsin C (CTRC) variants that diminish activity or secretion are associated with chronic pancreatitis. Nat Genet. 2008;40:78–82. doi: 10.1038/ng.2007.44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Masson E, Chen JM, Scotet V, Le Maréchal C, Férec C. Association of rare chymotrypsinogen C (CTRC) gene variations in patients with idiopathic chronic pancreatitis. Hum Genet. 2008;123:83–91. doi: 10.1007/s00439-007-0459-3. [DOI] [PubMed] [Google Scholar]
- 10.Witt H, Sahin-Tóth M, Landt O, Chen JM, Kähne T, Drenth JP, Kukor Z, Szepessy E, Halangk W, Dahm S, Rohde K, Schulz HU, Le Maréchal C, Akar N, Ammann RW, Truninger K, Bargetzi M, Bhatia E, Castellani C, Cavestro GM, Cerny M, Destro-Bisol G, Spedini G, Eiberg H, Jansen JB, Koudova M, Rausova E, Macek M, Jr, Malats N, Real FX, Menzel HJ, Moral P, Galavotti R, Pignatti PF, Rickards O, Spicak J, Zarnescu NO, Böck W, Gress TM, Friess H, Ockenga J, Schmidt H, Pfützer R, Löhr M, Simon P, Weiss FU, Lerch MM, Teich N, Keim V, Berg T, Wiedenmann B, Luck W, Groneberg DA, Becker M, Keil T, Kage A, Bernardova J, Braun M, Güldner C, Halangk J, Rosendahl J, Witt U, Treiber M, Nickel R, Férec C. A degradation-sensitive anionic trypsinogen (PRSS2) variant protects against chronic pancreatitis. Nat Genet. 2006;38:668–673. doi: 10.1038/ng1797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Santhosh S, Witt H, te Morsche RH, Nemoda Z, Molnár T, Pap A, Jansen JB, Drenth JP. A loss of function polymorphism (G191R) of anionic trypsinogen (PRSS2) confers protection against chronic pancreatitis. Pancreas. 2008;36:317–320. doi: 10.1097/MPA.0b013e31815db4b3. [DOI] [PubMed] [Google Scholar]
- 12.Kume K, Masamune A, Takagi Y, Kikuta K, Watanabe T, Satoh K, Satoh A, Hirota M, Hamada S, Shimosegawa T. A loss-of-function p.G191R variant in the anionic trypsinogen (PRSS2) gene in Japanese patients with pancreatic disorders. Gut. 2009;58:820–824. doi: 10.1136/gut.2008.151688. [DOI] [PubMed] [Google Scholar]
- 13.Scheele G, Bartelt D, Bieger W. Characterization of human exocrine pancreatic proteins by two-dimensional isoelectric focusing/sodium dodecyl sulfate gel electrophoresis. Gastroenterology. 1981;80:461–473. [PubMed] [Google Scholar]
- 14.Sahin-Tóth M, Kukor Z, Nemoda Z. Human cationic trypsinogen is sulfated on Tyr154. FEBS J. 2006;273:5044–5050. doi: 10.1111/j.1742-4658.2006.05501.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Itkonen O, Helin J, Saarinen J, Kalkkinen N, Ivanov KI, Stenman UH, Valmu L. Mass spectrometric detection of tyrosine sulfation in human pancreatic trypsinogens, but not in tumor-associated trypsinogen. FEBS J. 2008;275:289–301. doi: 10.1111/j.1742-4658.2007.06200.x. [DOI] [PubMed] [Google Scholar]
- 16.Ouyang Y, Lane WS, Moore KL. Tyrosylprotein sulfotransferase: purification and molecular cloning of an enzyme that catalyzes tyrosine O-sulfation, a common posttranslational modification of eukaryotic proteins. Proc Natl Acad Sci USA. 1998;95:2896–2901. doi: 10.1073/pnas.95.6.2896. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Beisswanger R, Corbeil D, Vannier C, Thiele C, Dohrmann U, Kellner R, Ashman K, Niehrs C, Huttner WB. Existence of distinct tyrosylprotein sulfotransferase genes: molecular characterization of tyrosylprotein sulfotransferase-2. Proc Natl Acad Sci USA. 1998;95:11134–11139. doi: 10.1073/pnas.95.19.11134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ouyang YB, Moore KL. Molecular cloning and expression of human and mouse tyrosylprotein sulfotransferase-2 and a tyrosylprotein sulfotransferase homologue in Caenorhabditis elegans. J Biol Chem. 1998;273:24770–24774. doi: 10.1074/jbc.273.38.24770. [DOI] [PubMed] [Google Scholar]
- 19.Moore KL. The biology and enzymology of protein tyrosine O-sulfation. J Biol Chem. 2003;278:24243–24246. doi: 10.1074/jbc.R300008200. [DOI] [PubMed] [Google Scholar]
- 20.Rónai Z, Witt H, Rickards O, Destro-Bisol G, Bradbury A, Sahin-Tóth M. A common African polymorphism abolishes tyrosine sulfation of human anionic trypsiongen (PRSS2) Biochem J. 2009;418:155–161. doi: 10.1042/BJ20081848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Mishiro E, Sakakibara Y, Liu MC, Suiko M. Differential enzymatic characteristics and tissue-specific expression of human TPST-1 and TPST-2. J Biochem. 2006;140:731–737. doi: 10.1093/jb/mvj206. [DOI] [PubMed] [Google Scholar]
- 22.Nishimura M, Naito S. Tissue-specific mRNA expression profiles of human carbohydrate sulfotransferase and tyrosylprotein sulfotransferase. Biol Pharm Bull. 2007;30:821–825. doi: 10.1248/bpb.30.821. [DOI] [PubMed] [Google Scholar]
- 23.Sahin-Tóth M. Biochemical models of hereditary pancreatitis. Endocrinol Metab Clin North Am. 2006;35:303–312. doi: 10.1016/j.ecl.2006.02.002. ix. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Stephens M, Smith N, Donnelly P. A new statistical method for haplotype reconstruction from population data. Am J Hum Genet. 2001;68:978–989. doi: 10.1086/319501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Stephens M, Donnelly P. A comparison of Bayesian methods for haplotype reconstruction from population genotype data. Am J Hum Genet. 2003;73:1162–1169. doi: 10.1086/379378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Nemoda Z, Sahin-Tóth M. Chymotrypsin C (caldecrin) stimulates autoactivation of human cationic trypsinogen. J Biol Chem. 2006;281:11879–11886. doi: 10.1074/jbc.M600124200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kehoe JW, Velappan N, Walbolt M, Rasmussen J, King D, Lou J, Knopp K, Pavlik P, Marks JD, Bertozzi CR, Bradbury AR. Using phage display to select antibodies recognizing posttranslational modifications independently of sequence context. Mol Cell Proteomics. 2006;5:2350–2363. doi: 10.1074/mcp.M600314-MCP200. [DOI] [PubMed] [Google Scholar]
- 28.Lassen KS, Bradbury AR, Rehfeld JF, Heegaard NH. Microscale characterization of the binding specificity and affinity of a monoclonal antisulfotyrosyl IgG antibody. Electrophoresis. 2008;29:2557–2564. doi: 10.1002/elps.200700908. [DOI] [PubMed] [Google Scholar]
- 29.Iida A, Sekine A, Saito S, Kitamura Y, Kitamoto T, Osawa S, Mishima C, Nakamura Y. Catalog of 320 single nucleotide polymorphisms (SNPs) in 20 quinone oxidoreductase and sulfotransferase genes. J Hum Genet. 2001;46:225–240. doi: 10.1007/s100380170093. [DOI] [PubMed] [Google Scholar]
- 30.Borghei A, Ouyang YB, Westmuckett AD, Marcello MR, Landel CP, Evans JP, Moore KL. Targeted disruption of tyrosylprotein sulfotransferase-2, an enzyme that catalyzes posttranslational protein tyrosine O-sulfation, causes male infertility. J Biol Chem. 2006;281:9423–9431. doi: 10.1074/jbc.M513768200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Westmuckett AD, Hoffhines AJ, Borghei A, Moore KL. Early postnatal pulmonary failure and primary hypothyroidism in mice with combined TPST-1 and TPST-2 deficiency. Gen Comp Endocrinol. 2008;156:145–153. doi: 10.1016/j.ygcen.2007.12.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Sasaki N, Hosoda Y, Nagata A, Ding M, Cheng JM, Miyamoto T, Okano S, Asano A, Miyoshi I, Agui T. A mutation in Tpst2 encoding tyrosylprotein sulfotransferase causes dwarfism associated with hypothyroidism. Mol Endocrinol. 2007;21:1713–1721. doi: 10.1210/me.2007-0040. [DOI] [PubMed] [Google Scholar]