Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2010 Jun 21;107(27):12357–12362. doi: 10.1073/pnas.1005633107

Control of transient, resurgent, and persistent current by open-channel block by Na channel β4 in cultured cerebellar granule neurons

Jason S Bant a, Indira M Raman b,1
PMCID: PMC2901465  PMID: 20566860

Abstract

Voltage-gated Na channels in several classes of neurons, including cells of the cerebellum, are subject to an open-channel block and unblock by an endogenous protein. The NaVβ4 (Scn4b) subunit is a candidate blocking protein because a free peptide from its cytoplasmic tail, the β4 peptide, can block open Na channels and induce resurgent current as channels unblock upon repolarization. In heterologous expression systems, however, NaVβ4 fails to produce resurgent current. We therefore tested the necessity of this subunit in generating resurgent current, as well as its influence on Na channel gating and action potential firing, by studying cultured cerebellar granule neurons treated with siRNA targeted against Scn4b. Knockdown of Scn4b, confirmed with quantitative RT-PCR, led to five electrophysiological phenotypes: a loss of resurgent current, a reduction of persistent current, a hyperpolarized half-inactivation voltage of transient current, a higher rheobase, and a decrease in repetitive firing. All disruptions of Na currents and firing were rescued by the β4 peptide. The simplest interpretation is that NaVβ4 itself blocks Na channels of granule cells, making this subunit the first blocking protein that is responsible for resurgent current. The results also demonstrate that a known open-channel blocking peptide not only permits a rapid recovery from nonconducting states upon repolarization from positive voltages but also increases Na channel availability at negative potentials by antagonizing fast inactivation. Thus, NaVβ4 expression determines multiple aspects of Na channel gating, thereby regulating excitability in cultured cerebellar granule cells.

Keywords: Scn4b, siRNA, inactivation, Purkinje, voltage-gated


NaVβ4 (Scn4b), one of four β subunits of voltage-gated Na channels (1), is implicated in several pathologies: NaVβ4 is down-regulated in Huntington's disease (2), cleaved by enzymes activated in Alzheimer's Disease (3), and mutated in some long-QT syndromes (4), raising the question of how it modulates Na currents in neurons and other cells. Among the proposed roles for NaVβ4, based on studies of a peptide fragment of its cytoplasmic tail, is that it may act as an open-channel blocker of Na channels in neurons that produce resurgent current, i.e., reopening of Na channels upon repolarization from positive voltages (5).

Resurgent current is present in several neuronal classes, including cell types in the cerebellum, brainstem, subthalamic nuclei, and dorsal root ganglia (6–11). As in other cells, voltage-gated Na channels in these neurons are closed at negative voltages and open upon depolarization. After opening, however, channels are blocked rapidly by an endogenous protein that prevents the fast inactivation gate from binding. Upon repolarization, this blocker is expelled, and resurgent current flows as channels reopen before either inactivating or deactivating, depending on the voltage (12). In Purkinje cells, modeling studies (13, 14) and experiments on NaV1.6 mutant mice, in which resurgent currents are reduced (14–16), have led to the proposal that Na channels that carry resurgent current facilitate repetitive firing.

Given the dependence of Purkinje firing rates on resurgent current, and the widespread incidence of the current in the nervous system, it is likely that open-channel block and unblock of Na channels regulates the intrinsic excitability of many neurons. If so, the blocking protein may serve as a molecular switch that enables neurons to produce specific patterns of activity, e.g., repetitive firing or bursting. Indeed Na channel mutations associated with pain syndromes and movement disorders can increase resurgent current amplitudes in affected cells, implicating the blocking protein in exacerbating certain channelopathies (17). An understanding of the molecular mechanism of resurgent current, as well as the ability to manipulate it under pathological conditions, however, relies on identification of the blocking protein(s).

Previous experiments have demonstrated that the blocking protein is distinct from the α subunit (15, 18), and that its action resembles open-channel block by compounds that produce hooked tail currents in Na channels (19). NaVβ4 emerged as a candidate blocking protein because part of its cytoplasmic tail, KKLITFILKKTREK, contains functional groups that resemble exogenous blocking compounds. Moreover, a free peptide comprising these amino acids (the β4 peptide) restores resurgent currents after enzymatic degradation of the endogenous blocker (20). Thus, the endogenous blocking protein must contain a domain whose interaction with the pore resembles that of the β4 peptide, raising the possibility that NaVβ4 is itself an open-channel blocker.

Coexpressing NaVβ4 with Na channel α subunits in expression systems, however, modulates Na channels without reconstituting resurgent current (21, 22). Thus, either the NaVβ4 subunit does not behave as a blocker, or it requires neuron-specific modulation to enable open-channel block. To investigate the functional role of NaVβ4, we recorded from cultured cerebellar granule neurons, which normally express an endogenous blocker, and tested how silencing Scn4b transcripts with small interfering RNA (siRNA) affects Na current kinetics and action potential firing. Knockdown of NaVβ4 correlated with reduced resurgent but not transient current, demonstrating that NaVβ4 is indeed necessary for normal resurgent current. Loss of the subunit had the additional effects of reducing persistent current, stabilizing fast inactivation, and decreasing repetitive firing. With NaVβ4 knocked down, the β4 peptide restored not only resurgent current but also all other aspects of Na current kinetics and spiking to control values. These data suggest that NaVβ4 is an endogenous blocking protein, and that it normally promotes excitability in cerebellar granule cells by regulating multiple components of Na channel gating.

Results

To explore the functional role of NaVβ4 in neurons, we studied cerebellar granule cells, which express resurgent current (7) and survive well in culture, making them amenable to molecular manipulation. Voltage-clamped, TTX-sensitive Na currents were evoked in neurons 7–14 d in vitro (DIV) by a 15-ms depolarization from –90 mV to +30 mV, followed by a 200-ms repolarization to –30 mV. In untransfected cells, resurgent current evoked by repolarization was 11.7 ± 1.1% of the peak transient current evoked at +30 mV (n = 9). This fraction is near published values (7), confirming that the channel blocking machinery is retained in cultured neurons.

Next, we used siRNA to test whether expression of the NaVβ4 subunit influences the amplitude of any component of Na current. Control cells were transfected with a pool of four “non-target” siRNAs that target no mouse transcripts, as well as GFP as a marker of transfection. Recordings were repeated in neurons transfected with a pool of four Scn4b-targeted siRNAs and GFP. Relative to untreated cells, the peak transient Na current was reduced equivalently in both “non-target cells” and “on-target cells” (by 52% and 49%, P > 0.7; Fig. 1F). This observation suggests either that smaller cells are more readily transfected or that Lipofectamine incorporation leads to a reduction in current density independently of the siRNAs applied. We therefore considered non-target cells as the control group, with which all on-target effects were compared. Non-target cells expressed both transient and resurgent current proportionate to that that in untreated cells (9.0 ± 1.0% resurgent-to-transient ratio, n = 9, P = 0.1 vs. untreated cells). In contrast, resurgent current was undetectable in 9 of 18 cells, and the mean resurgent-to-transient ratio across all 18 cells fell to 3.7 ± 0.5% (P < 0.0001; Fig. 1 A and B). Thus, resurgent current is indeed sensitive to knockdown of NaVβ4.

Fig. 1.

Fig. 1.

Knockdown of NaVβ4 reduces resurgent current and shifts inactivation. (A) Transient and resurgent TTX-sensitive Na currents in a non-target cell, an on-target cell, and an on-target cell with the β4 peptide. (B) Relative resurgent current for all cells. (C) Transient currents evoked at 0 mV after 200-ms conditioning pulses at different voltages. (D) Availability curves from representative cells for data obtained as in C. (E) Mean V1/2 and k availability parameters. (F) Transient current amplitudes in each condition. (G) V1/2 vs. percent resurgent current for all on-target cells.

The decrease, however, may result either directly, from a loss of the endogenous blocking protein, or indirectly, from modulation of α subunits, other proteins, and/or their interactions, such that channels are no longer subject to block. We therefore repeated recordings in on-target cells with the β4 peptide (200 μM), which blocks open channels much like the endogenous blocking protein (20), in the pipette. The peptide rescued the amplitude and kinetics of resurgent current to close to non-target levels (mean current rise time and τdecay: control, 6.4, 48 ms; rescue, 6.9 ms, 41 ms; Fig. 1 A and B). Thus, α subunits remain susceptible to open-channel block in on-target cells, supporting the idea that decreased NaVβ4 expression disrupts the endogenous blocker itself.

Nevertheless, the reduction of resurgent current varied across cells, suggesting either that knockdown itself was variable or that open-channel block in some neurons might be independent of NaVβ4. We reasoned that if multiple blocking proteins existed, they might have distinct affinities for the channel, such that the kinetics of resurgent current might differ in the apparently knockdown-resistant cells. The rise time and τdecay of the average residual resurgent current across all on-target cells, however, were 6.9 and 46 ms, much like control. Thus, the blocker that was lost, the blocker that remained, and the β4 peptide all interact similarly with the channel.

The effects of NaVβ4 knockdown were not limited to reducing resurgent current, however, as steady-state inactivation curves also depended on NaVβ4 expression. Cells in which we recorded resurgent current were held at negative potentials for 200 ms and availability was assessed with a step to 0 mV. Relative to non-target cells, the mean half-maximal inactivation voltage (V1/2) in on-target cells was hyperpolarized by 7.7 mV (n = 16 on-target, n = 9 non-target, P < 0.05; Fig. 1 C–E), indicating that NaVβ4 normally increases the availability of Na channels at moderately negative voltages.

Like the change in resurgent current, the magnitude of the shift in the inactivation curve varied in on-target cells. Across cells, however, the V1/2 correlated strongly with the percent resurgent current, with the most negative values in cells with the least resurgent current (Fig. 1G). In these cells, resurgent current was undetectable, and the V1/2 was ~20 mV hyperpolarized to control values. In addition, the persistent current at the end of the repolarization to −30 mV dropped from 2.3 ± 0.6% in control to 1.0 ± 0.2% in on-target cells (P < 0.05), and the amplitude of persistent and resurgent currents in on-target cells were likewise correlated (P < 0.05). These data suggest that the efficacy of siRNA differed across cells, with successful knockdown modulating availability, persistent current, and resurgent current. Consequently, the effect of complete NaVβ4 loss is likely underestimated by the mean data.

To test which aspects of NaVβ4 modulation could be replicated by the β4 peptide, we repeated the experiments with the β4 peptide in the pipette. Strikingly, the peptide restored normal inactivation parameters (n = 7, P = 0.74 vs. control; Fig. 1 D and E), as well as the persistent current amplitude (2.8 ± 1.0%; P = 0.65 vs. control), demonstrating that the free peptide itself can not only block open channels but also oppose fast inactivation and increase Na current at negative voltages. Notably, heterologous expression of NaVβ4 with Na channels neither depolarizes the V1/2 of inactivation nor generates resurgent current, although it can increase persistent current in the absence of NaVβ1 (1, 20, 21), supporting the idea that the effects of NaVβ4 on gating are modulated in neurons that normally express resurgent current. Together, the simplest interpretation is that the NaVβ4 subunit is itself a blocking protein in cultured granule cells, and serves to generate resurgent current, facilitate persistent current, and reduce steady-state inactivation of transient current at negative potentials.

Although in situ hybridizations yield low labeling of Scn4b transcripts in granule cells (1), immunohistochemistry suggests that these neurons indeed express NaVβ4 (23). Therefore, to verify that transcripts were present in cultured granule cells and reduced by on-target siRNA, we sought a direct measure of Scn4b mRNA. Because single-cell quantification of granule cell transcripts reveals a low number and high variance of transcripts (24), single-cell studies were not suited for detecting knockdown of a rare transcript such as Scn4b. We therefore performed quantitative RT-PCR on samples from whole-culture RNA extracts. Scn4b transcripts were indeed present in neuron-glia cultures (identical to those from which recordings were made), whereas 8-fold fewer transcripts were detected in glia-only cultures, in which neurons had been killed by excitotoxicity (P < 0.05; Fig. 2A). Transcripts of Scn2a and Scn8a, which encode the primary Na channel α subunits of granule neurons (NaV1.2 and NaV1.6) (25), were reduced by 68% and 80% in glia-only cultures, confirming that the decrease in Scn4b resulted from the loss of neurons. These results not only verify that granule cells express NaVβ4 but also validate measuring neuronal transcripts from whole culture extracts.

Fig. 2.

Fig. 2.

On-target siRNA reduces neuronal Scn4b transcripts. (A) Number of Scn4b transcripts per sample estimated from the CQ for mixed neuron–glia cultures and glia-only cultures. (B) Ratio of Scn4b transcripts in on-target to non-target cultures, normalized to Scn2a or Scn8a. Dotted line indicates no knockdown.

Next, we estimated the degree of siRNA transfection directly, by omitting GFP and applying fluorescently tagged siRNA. Inspection of cultures indicated that, 1 d after transfection, fluorescence was detectable in about half of the neurons and many glia in each plate, suggesting that siRNA transfection was more efficient than indicated by GFP fluorescence. Although incorporation of tagged siRNA does not provide a guarantee of knockdown (26), these observations suggested that transfection might be efficient enough for knockdown of Scn4b in a subset of cells to be measurable, although underestimated, by whole-culture analysis.

Finally, we quantified Scn4b relative to the neuronal transcripts Scn2a and Scn8a in on-target and non-target cultures without GFP cotransfection. On-target and non-target cells had the same ratio of Scn8a to Scn2a transcripts (40% at 6 and 9 DIV and 60% at 12 DIV; P > 0.5, on-target vs. non-target), consistent with measurements of transient currents. These data support the conclusion from electrophysiological studies that transfection with either pool of siRNA had indistinguishable effects on α subunit transcripts, and verify that these transcripts were appropriate for relative quantification. At 6 DIV, however, the estimate of Scn8a transcripts was variable, so we used only Scn2a as the reference for this age group. Scn4b transcripts were decreased by 43 ± 10% at 6 DIV (P < 0.005) and by 66 ± 10% or 66 ± 15% at 9 DIV (relative to Scn2a or Scn8a, P < 0.005 for both; Fig. 2B). The reduction fell to 28 ± 15% or 21 ± 14% at 12 DIV (P = 0.09 for Scn2a, P = 0.17 Scn8a vs. control), falling just short of statistical significance. Nevertheless, as only ~50% of neurons per dish incorporate siRNA, knockdown in transfected cells is likely to be underestimated at all ages. The time course of the drop in siRNA efficacy is similar to that predicted by kinetic studies of gene-silencing by siRNA (26, 27). Thus, Scn4b is indeed measurably reduced in on-target cultures. The changes in Na currents recorded in voltage-clamp can therefore reasonably be attributed to changes in expression of NaVβ4.

Changes in Na channels that reduce resurgent current disrupt repetitive firing by Purkinje neurons (14, 15), and resurgent current is likewise proposed to facilitate spiking by granule cells (28). We therefore tested whether knockdown of NaVβ4 altered the excitability of cultured granule cells. Because protein expression is expected to lag the decay of siRNA efficacy, we restricted recordings to cells 8–12 DIV, in which loss of NaVβ4 protein should be substantial and in which Na current density should be relatively constant. To further minimize variance, we analyzed data only from cells with input resistances between 0.7 and 2.1 GΩ (>90% of cells, Fig. 3A). Action potentials were evoked from −70 mV with 300-ms current injections in 5-pA increments. Under these conditions, rheobase was 13 ± 1 pA (n = 13). In non-target cells, the maximal spikes/step ranged from 7 to 28 (mean, 17 ± 2). This diversity is consistent with the dependence of granule cell firing rates on K current properties, which can vary widely in these cells. Nevertheless, nearly all control cells fired throughout the 300-ms step for several amplitudes of current injection (Fig. 3 B and C Left). To define the duration of repetitive firing across cells, we aligned spike rasters to rheobase and plotted the median time of the last spike for each current injection, which describes the envelope of the rasters for the population (Fig. 3D Left). This analysis illustrates that non-target cells fired throughout the step for approximately six steps (30 pA).

Fig. 3.

Fig. 3.

NaVβ4 is required for normal excitability in granule cells. (A) Mean ± SD of input resistances and ages of cells recorded in current clamp. (B) Responses to 45-pA current injections in each condition. (C) Spike rasters evoked by range of currents for cells in B. (D) Median time of last spike (symbols) with upper and lower quartiles (thin solid and dashed lines) for each population of cells. Middle quartiles for non-target controls (gray) are superimposed on the on-target ± β4 peptide conditions for comparison.

Maximal firing rates in on-target cells also ranged widely (2–31 spikes/step, mean 15 ± 2, n = 19), but rheobase was raised to 25 ± 4 pA (P < 0.05 vs. control). Moreover, firing persisted through a narrower range of current injections. Most cells failed to fire steadily with depolarizations >20 pA above rheobase, such that the median firing duration across cells fell near the lower 25th percentile for control cells (P < 0.0005; Fig. 3 B, C, and D Middle). This decreased repetitive firing during depolarizations is predicted from a loss of resurgent current, because it is the dissociation of the blocker that restores Na channel availability at moderate interspike potentials, at which fast-inactivated channels remain unavailable. Moreover, the disruption of firing will be exacerbated by the hyperpolarized availability curve and is likely to be further affected by the smaller persistent current. Nevertheless, reduced excitability might also result from changes in other channels, secondary to the loss of NaVβ4. We therefore tested whether the β4 peptide could increase the dynamic range of repetitive firing in on-target cells. Indeed, the peptide restored the duration of repetitive firing (P > 0.05; Fig. 3 B, C, and D Right), as well as rheobase (16 ± 2 pA, P = 0.37 vs. control), to control values. Maximal firing rates ranged from 8 to 33 spikes per step (mean, 16 ± 2, n = 17). These results suggest that the disruption of repetitive firing does not depend on changes downstream of the loss of NaVβ4. Instead, the simplest interpretation is that it can be attributed largely to the loss of the portion of the NaVβ4 cytoplasmic domain that generates an open-channel block and unblock and that maintains Na channel availability throughout action potential trains.

Discussion

By directly manipulating the NaVβ4 protein and examining the effect on Na channel gating in cultured cerebellar granule neurons, we found evidence that NaVβ4 is necessary for normal resurgent Na current: Although knockdown of Scn4b by siRNA was incomplete across neurons, resurgent current was absent only from cells treated with on-target siRNA. Moreover, the loss of resurgent current correlated with a hyperpolarized availability curve and drop in persistent current, suggesting that when knockdown did occur, all three parameters were affected. Finally, because the voltage-dependence and kinetics of all components of Na current in on-target cells were restored by a peptide from the NaVβ4 tail that behaves as an open Na-channel blocker, it is likely that NaVβ4 is itself an endogenous blocking protein in granule neurons.

These data also reveal a competition between NaVβ4 and the fast inactivation gate at negative voltages. Previous work has shown that resurgent and persistent Na current amplitudes are both reduced in neurons from mice lacking NaV1.6, an α subunit that is a particularly good target for the endogenous blocker in some but not all cell types (9, 15, 29, 30). More precisely, α subunits with rapid inactivation kinetics (non-NaV1.6 channels in Purkinje cells) fail to produce large resurgent currents because the endogenous blocker cannot compete successfully with fast inactivation (18). To the extent that rapid inactivation correlates with stable inactivation, such channels are likely to produce little persistent current as well. The present results, however, offer an additional explanation for why resurgent and persistent current amplitudes covary: The depolarization of the availability curve by NaVβ4, as well as by the β4 peptide, raises the interesting possibility that channels equilibrating among open and closed states are delayed from entering fast-inactivated states by a rapid but unstable binding and unbinding of the blocker at negative voltages (31). Alternatively, the β4 peptide may exert an additional, separate effect on the channel, independent of open-channel block, which reduces fast inactivation and increases persistent current.

Nevertheless, in cells in which NaVβ4 acts as an endogenous blocker, resurgent current, persistent current, and steady-state availability cannot be separated: The subunit antagonizes inactivation at negative voltages, promoting subthreshold persistent current flow, and occludes channels at positive voltages, setting the stage for resurgent current upon repolarization. Therefore, except near the peak of the action potential, NaVβ4 actually increases availability and activation, promoting depolarization and spike initiation, and, if K currents permit, rapid and repetitive spiking.

Indeed, NaVβ4 also measurably influences excitability. Consistent with the decreased subthreshold availability, rheobase is increased in on-target cells. The most salient change, however, is that the duration of repetitive firing during depolarizations is reduced. In granule cells, loss of NaVβ4 subunits may well lead to changes in the expression or properties of multiple ion channels and/or neuron morphology (2), but the observation that the β4 peptide rescues repetitive spiking rules out such changes as the primary basis for reduced firing. Instead, the data support the idea that excitability of cultured granule neurons is regulated by NaVβ4 acting at least in part as an open-channel blocker of Na channels. Thus, with all other aspects of intrinsic excitability held constant, the expression of NaVβ4 may act as a switch that permits sustained firing, particularly in the face of depolarizing inputs.

NaVβ4 may not be unique as an endogenous blocking protein across neurons, however. The distribution of resurgent current indeed correlates well with that of NaVβ4, which is expressed strongly in the cerebellum, brainstem, subthalamic nuclei, and dorsal root ganglia (1), but some brain regions that express NaVβ4 only weakly also contain cells with resurgent Na current (30, 32). Despite weak labeling, some of these cells may nevertheless express NaVβ4, as is the case for cerebellar granule neurons. Alternatively, because most ion channel proteins exist in multiple isoforms, many of which are tissue or cell specific, other proteins with structural and functional similarity to NaVβ4 may well be identified in the future.

Conversely, it is likely that not all cells that express NaVβ4 produce resurgent current. Indeed, over-expressing NaVβ4 in CA3 neurons does not yield resurgent current (22), suggesting that cell-type-specific modulation of α or β subunits is required to enable open-channel block. Such modulation seems plausible, as resurgent current can be disrupted by broad-spectrum phosphatases (33); NaVβ4 is the target of enzymatic cleavage (3); and disease mutations change the susceptibility of α subunits to open-channel block (17). Even under conditions that “enable” block, however, NaVβ4 may have diverse effects on current, depending on its affinity for different α subunits. A high-affinity might require strong repolarization for expulsion, with little enhancement of subthreshold Na current, whereas a low affinity may effectively antagonize inactivation and permit persistent current without yielding an obvious resurgent component. In fact, resurgent current kinetics vary across cell types, consistent with diversity of blocker–channel interactions (29). Regardless of whether NaVβ4 turns out to be unique, it emerges as the first endogenous, open-channel blocking protein that generates resurgent current. That this subunit is highly expressed in several neurons with resurgent current makes it seem likely that this function is not restricted to one cell type.

Materials and Methods

Culture Preparation.

In accordance with Institutional Animal Care and Use Committee guidelines, cerebella were dissected from P0-P1 C57BL6 mice in cold D1 saline (mM: 140 NaCl, 5 KCl, 0.1 Na2HPO4, 2.2 KH2PO4, 5 Hepes, 4 sucrose, 30 glucose, 10 μL/mL penicillin/streptomycin stock, and 0.001% phenol red). After 30 min in D1 with 20 U/mL papain (Worthington Biochemicals), 1.7 mM cysteine, 100 μM CaCl2, and 50 μM EDTA (pH 7.3, NaOH) at 37 °C, tissue was washed in minimal essential medium (MEM) (Invitrogen) with 5% heat-inactivated FCS (HyClone), 20 mM glucose, 0.5 mM Glutamax (Invitrogen) and 2.5 mg/mL each of BSA and trypsin inhibitor. After trituration, cells were plated onto coverslips coated with poly-L-lysine and collagen (Invitrogen) and grown to confluence. One week later, neurons were killed by excitotoxicity by (mM) 0.1 glutamate, 165 NaCl, 5 KCl, 2 CaCl2, and 5 Hepes (30 min). Fresh neurons and glia were plated onto glial beds, and after 24–48 h, glial proliferation was prevented with 5 μM cytosine arabinofuranoside.

Transfections.

A premixed pool of four on-target siRNA duplexes targeted to four sites in the Scn4b gene, and a premixed pool of four non-target negative-control siRNA duplexes were obtained from Dharmacon. On-target antisense siRNA sequences were CAAACAAGAAGUCCAAUGAUU, AAUUUAUCAACCACUUGGAUU, CAAGAGGAUGGAGAUGUUAUU, and UUAUUGUAGGACCACUUGAUU, designed by Dharmacon as described elsewere (34). Non-targeting sequences (“on-target plus siControl non-targeting pool”), which are proprietary to Dharmacon, do not target transcripts from the mouse genome, as previously confirmed (35). Simultaneous use of multiple on-target siRNAs maximizes the probability that at least one siRNA sequence will knock down the desired mRNA; the non-target pool serves as a control. Indeed, when siRNA pools were applied to HEK cells transfected with rat Scn4b (22), Scn4b expression by quantitative RT-PCR was reduced by 90% in on-target relative to non-target cells (P < 0.005; β-actin as reference gene). Each coverslip of granule cells (1–2 DIV) was transfected with 0.13 μg (10 pmol) of the four siRNAs, 0.15 μg GFP plasmid, and Lipofectamine 2000 (Invitrogen) at 1 μL (recording) or 4 μL (quantitative RT-PCR). Cells were incubated with reagent in serum-free OPTI-MEM (Gibco) for 2 h and then washed with serum-containing medium before feeding. To combat the tendency of siRNA efficacy to decrease over a period of a few days (26), we used siRNA concentrations that were ~100-fold in excess of those predicted to yield maximal knockdown (36). Experimental observations were consistent with knockdown of protein on the time scale reported elsewhere (27).

Electrophysiology.

Recordings were made with an Axopatch 200B amplifier and pCLAMP software (Molecular Devices; 5 kHz filtering, 50 kHz sampling) from 6 to 15 μm diameter phase-bright cells with one or more neurites. Transfection was verified under fluorescence. Cells were bathed in Tyrode's solution containing (mM) 150 NaCl, 4 KCl, 2 CaCl2, 2 MgCl2, 10 Hepes, and 10 glucose (pH 7.36, NaOH). For voltage-clamp studies, patch electrodes (3.5–6.5 MΩ) were filled with the following (mM): 108 CsCH3SO3, 9 NaCl, 1.8 MgCl2, 9 Hepes, 0.9 EGTA, 43 sucrose, 14 Tris-creatinePO4, 4 MgATP, and 0.3 TrisGTP (pH 7.4, CsOH). Whole-cell series resistance was compensated to ~70%. With 100 nM tetrodotoxin (TTX, Alomone) in the bath to improve space clamp, somata were perfused through flow pipes containing the following (mM): 154 NaCl, 10 TEACl, 10 Hepes, 10 glucose, 0.3 CdCl2, and 0.4 BaCl2 ± 900 nM TTX. TTX-sensitive Na current was isolated by subtraction. Cells with escaping spikes or leak changes were rejected. For current-clamp studies, 5–10 MΩ electrodes contained the following (mM): 120 K-gluconate, 2 Na-gluconate, 2 MgCl2, 0.9 Hepes, 1 EGTA, 20 sucrose, 14 Tris-creatinePO4, 4 MgATP, and 0.3 TrisGTP (pH 7.4 with CsOH). Cells were bathed in Tyrode's solution.

Quantitative RT-PCR.

The methods and standards proposed by Bustin et al. (37) were used as a guide. Primers, kits, and enzymes were from Invitrogen. Primers (5′ to 3′, forward then reverse) were as follows: Scn4b, GGGCTTTTGGGTCTCTTC, GAGGTTCTCAAAGCCATAACA; Scn2a, AAGTGGATTGTTCCATCAGG, AAAGAGCAGGGATTTCTTCC; Scn8a, GTCTTCACCTACATCTTCATCCTG, CCTAAGGGACTTTATGGCACC; Scn8a neonatal, GTCTTCACCTACATCTTCATCCTG, ACCCCCTCGCCCTTTAC; Scn8a Δ18, TGGAGATGTTGCTCAAATGG, ATGAGACACACCAGCAGCAC. Amplified products were run on gels to verify size and melt curves confirmed a lack of primer-dimers. Neonatal and Δ18 Scn8a (38) did not differ in on-target and non-target cells.

Cultured neurons (1 DIV) or glia after excitotoxicity were transfected with on-target or non-target siRNA. At 6, 9, and 12 DIV, RNA was extracted with TRIZOL. RNA samples with 260/280 absorbance ratio <1.8 (Nanodrop ND-1000) were rejected. RNA was digested with DNase, reverse transcribed (Superscript III kit), digested with RNase H, mixed with SYBR green SupermixUDG for quantitative PCR, and loaded onto 384-well plates in quadruplicate. Quantification cycle (CQ) values (PCR cycles to reach fluorescence threshold) were obtained with the standard cycling program on a 7900HT-Fast Real-Time PCR System and SDS software (Applied Biosystems). Calibration curves for primers were obtained (38) by plotting CQ for serially diluted cDNA samples vs. log[relative cDNA]. Efficiency, E, was calculated as 10-1/m where m is the calibration curve slope. The change in cDNA was calculated (39) as (EtargetΔCQ(ctrl-sample))/(Ereference ΔCQ(ctrl-sample)). Efficiencies were 2.00 (Scn4b), 1.98 (Scn2a), and 2.00 (Scn8a). Copy number was estimated from qPCR of known quantities of rat Scn4b (22).

Data Analysis.

Data were analyzed with IGOR-Pro (Wavemetrics) with NeuroMatic functions and are reported as mean ± SEM except as noted. Resurgent current was measured as the mean current for 1 ms about the peak, less the mean persistent current in the last 10 ms of the 200-ms step. Inactivation curves were normalized to peak current and fit as I = Fss+(1−Fss)/(1+exp(V−V1/2)/k), where I is current, V1/2 is the half-maximal inactivation voltage, k is the slope factor, and Fss is the noninactivating fraction. Spike rasters were obtained with a 15 V/s threshold. Median rather than mean time of last spike was measured to account for the ceiling value of 300 ms. Statistical significance (P < 0.05) was assessed with Student's two-tailed t tests, confirmed with one-way ANOVAs for Na currents, or with univariate ANOVAs and two-sample Kolmogorov–Smirnov tests for spikes. Capacitative artifacts are reduced.

Acknowledgments

We thank the Turek Laboratory for advice and use of the 7900HT-Fast Real-Time PCR System, T. Aman for discussion throughout the project, and the other members of the Raman laboratory for helpful comments. This work was supported by National Institutes of Health Grants F31-NS65587 (to J.S.B.) and R01-NS39395 (to I.M.R.).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

References

  • 1.Yu FH, et al. Sodium channel β4, a new disulfide-linked auxiliary subunit with similarity to β2. J Neurosci. 2003;23:7577–7585. doi: 10.1523/JNEUROSCI.23-20-07577.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Oyama F, et al. Sodium channel β4 subunit: Down-regulation and possible involvement in neuritic degeneration in Huntington's disease transgenic mice. J Neurochem. 2006;98:518–529. doi: 10.1111/j.1471-4159.2006.03893.x. [DOI] [PubMed] [Google Scholar]
  • 3.Miyazaki H, et al. BACE1 modulates filopodia-like protrusions induced by sodium channel β4 subunit. Biochem Biophys Res Commun. 2007;361:43–48. doi: 10.1016/j.bbrc.2007.06.170. [DOI] [PubMed] [Google Scholar]
  • 4.Medeiros-Domingo A, et al. SCN4B-encoded sodium channel beta4 subunit in congenital long-QT syndrome. Circulation. 2007;116:134–142. doi: 10.1161/CIRCULATIONAHA.106.659086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Grieco TM, Malhotra JD, Chen C, Isom LL, Raman IM. Open-channel block by the cytoplasmic tail of Na channel β4 as a mechanism for resurgent Na current. Neuron. 2005;45:233–244. doi: 10.1016/j.neuron.2004.12.035. [DOI] [PubMed] [Google Scholar]
  • 6.Do MT, Bean BP. Subthreshold sodium currents and pacemaking of subthalamic neurons: Modulation by slow inactivation. Neuron. 2003;39:109–120. doi: 10.1016/s0896-6273(03)00360-x. [DOI] [PubMed] [Google Scholar]
  • 7.Afshari FS, et al. Resurgent Na currents in four classes of neurons of the cerebellum. J Neurophysiol. 2004;92:2831–2843. doi: 10.1152/jn.00261.2004. [DOI] [PubMed] [Google Scholar]
  • 8.Cummins TR, Dib-Hajj SD, Herzog RI, Waxman SG. Nav1.6 channels generate resurgent sodium currents in spinal sensory neurons. FEBS Lett. 2005;579:2166–2170. doi: 10.1016/j.febslet.2005.03.009. [DOI] [PubMed] [Google Scholar]
  • 9.Enomoto A, Han JM, Hsiao CF, Chandler SH. Sodium currents in mesencephalic trigeminal neurons from Nav1.6 null mice. J Neurophysiol. 2007;98:710–719. doi: 10.1152/jn.00292.2007. [DOI] [PubMed] [Google Scholar]
  • 10.Leão RN, Naves MM, Leão KE, Walmsley B. Altered sodium currents in auditory neurons of congenitally deaf mice. Eur J Neurosci. 2006;24:1137–1146. doi: 10.1111/j.1460-9568.2006.04982.x. [DOI] [PubMed] [Google Scholar]
  • 11.Gittis AH, du Lac S. Similar properties of transient, persistent, and resurgent Na currents in GABAergic and non-GABAergic vestibular nucleus neurons. J Neurophysiol. 2008;99:2060–2065. doi: 10.1152/jn.01389.2007. [DOI] [PubMed] [Google Scholar]
  • 12.Raman IM, Bean BP. Resurgent sodium current and action potential formation in dissociated cerebellar Purkinje neurons. J Neurosci. 1997;17:4517–4526. doi: 10.1523/JNEUROSCI.17-12-04517.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Raman IM, Bean BP. Inactivation and recovery of sodium currents in cerebellar Purkinje neurons: Evidence for two mechanisms. Biophys J. 2001;80:729–737. doi: 10.1016/S0006-3495(01)76052-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Khaliq ZM, Gouwens NW, Raman IM. The contribution of resurgent sodium current to high-frequency firing in Purkinje neurons: An experimental and modeling study. J Neurosci. 2003;23:4899–4912. doi: 10.1523/JNEUROSCI.23-12-04899.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Raman IM, Sprunger LK, Meisler MH, Bean BP. Altered subthreshold sodium currents and disrupted firing patterns in Purkinje neurons of Scn8a mutant mice. Neuron. 1997;19:881–891. doi: 10.1016/s0896-6273(00)80969-1. [DOI] [PubMed] [Google Scholar]
  • 16.Levin SI, et al. Impaired motor function in mice with cell-specific knockout of sodium channel Scn8a (NaV1.6) in cerebellar purkinje neurons and granule cells. J Neurophysiol. 2006;96:785–793. doi: 10.1152/jn.01193.2005. [DOI] [PubMed] [Google Scholar]
  • 17.Jarecki BW, Piekarz AD, Jackson JO, 2nd, Cummins TR. Human voltage-gated sodium channel mutations that cause inherited neuronal and muscle channelopathies increase resurgent sodium currents. J Clin Invest. 2010;120:369–378. doi: 10.1172/JCI40801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Grieco TM, Raman IM. Production of resurgent current in NaV1.6-null Purkinje neurons by slowing sodium channel inactivation with β-pompilidotoxin. J Neurosci. 2004;24:35–42. doi: 10.1523/JNEUROSCI.3807-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yeh JZ, Narahashi T. Kinetic analysis of pancuronium interaction with sodium channels in squid axon membranes. J Gen Physiol. 1977;69:293–323. doi: 10.1085/jgp.69.3.293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Grieco TM, Malhotra JD, Chen C, Isom LL, Raman IM. Open-channel block by the cytoplasmic tail of sodium channel β4 as a mechanism for resurgent sodium current. Neuron. 2005;45:233–244. doi: 10.1016/j.neuron.2004.12.035. [DOI] [PubMed] [Google Scholar]
  • 21.Chen Y, et al. Functional properties and differential neuromodulation of Na(v)1.6 channels. Mol Cell Neurosci. 2008;38:607–615. doi: 10.1016/j.mcn.2008.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Aman TK, et al. Regulation of persistent Na current by interactions between β subunits of voltage-gated Na channels. J Neurosci. 2009;29:2027–2042. doi: 10.1523/JNEUROSCI.4531-08.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Davis TH, Chen C, Isom LL. Sodium channel β1 subunits promote neurite outgrowth in cerebellar granule neurons. J Biol Chem. 2004;279:51424–51432. doi: 10.1074/jbc.M410830200. [DOI] [PubMed] [Google Scholar]
  • 24.Durand GM, Marandi N, Herberger SD, Blum R, Konnerth A. Quantitative single-cell RT-PCR and Ca2+ imaging in brain slices. Pflugers Arch. 2006;451:716–726. doi: 10.1007/s00424-005-1514-3. [DOI] [PubMed] [Google Scholar]
  • 25.Osorio N, et al. Differential targeting and functional specialization of sodium channels in cultured cerebellar granule cells. J Physiol. 2005;569:801–816. doi: 10.1113/jphysiol.2005.097022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Holen T, Amarzguioui M, Wiiger MT, Babaie E, Prydz H. Positional effects of short interfering RNAs targeting the human coagulation trigger Tissue Factor. Nucleic Acids Res. 2002;30:1757–1766. doi: 10.1093/nar/30.8.1757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bartlett DW, Davis ME. Insights into the kinetics of siRNA-mediated gene silencing from live-cell and live-animal bioluminescent imaging. Nucleic Acids Res. 2006;34:322–333. doi: 10.1093/nar/gkj439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Magistretti J, Castelli L, Forti L, D'Angelo E. Kinetic and functional analysis of transient, persistent and resurgent sodium currents in rat cerebellar granule cells in situ: An electrophysiological and modelling study. J Physiol. 2006;573:83–106. doi: 10.1113/jphysiol.2006.106682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Aman TK, Raman IM. Subunit dependence of Na channel slow inactivation and open channel block in cerebellar neurons. Biophys J. 2007;92:1938–1951. doi: 10.1529/biophysj.106.093500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Royeck M, et al. Role of axonal NaV1.6 sodium channels in action potential initiation of CA1 pyramidal neurons. J Neurophysiol. 2008;100:2361–2380. doi: 10.1152/jn.90332.2008. [DOI] [PubMed] [Google Scholar]
  • 31.Aman TK, Raman IM. Inwardly permeating Na ions generate the voltage dependence of resurgent Na current in cerebellar Purkinje neurons. J Neurosci. 2010;30:5629–5634. doi: 10.1523/JNEUROSCI.0376-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Mercer JN, Chan CS, Tkatch T, Held J, Surmeier DJ. Nav1.6 sodium channels are critical to pacemaking and fast spiking in globus pallidus neurons. J Neurosci. 2007;27:13552–13566. doi: 10.1523/JNEUROSCI.3430-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Grieco TM, Afshari FS, Raman IM. A role for phosphorylation in the maintenance of resurgent sodium current in cerebellar purkinje neurons. J Neurosci. 2002;22:3100–3107. doi: 10.1523/JNEUROSCI.22-08-03100.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Pei Y, Tuschl T. On the art of identifying effective and specific siRNAs. Nat Methods. 2006;3:670–676. doi: 10.1038/nmeth911. [DOI] [PubMed] [Google Scholar]
  • 35.Baum P, et al. Off-target analysis of control siRNA molecules reveals important differences in the cytokine profile and inflammation response of human fibroblasts. Oligonucleotides. 2010;20:17–26. doi: 10.1089/oli.2009.0213. [DOI] [PubMed] [Google Scholar]
  • 36.Elbashir SM, Harborth J, Weber K, Tuschl T. Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods. 2002;26:199–213. doi: 10.1016/S1046-2023(02)00023-3. [DOI] [PubMed] [Google Scholar]
  • 37.Bustin SA, et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55:611–622. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed] [Google Scholar]
  • 38.Plummer NW, McBurney MW, Meisler MH. Alternative splicing of the sodium channel SCN8A predicts a truncated two-domain protein in fetal brain and non-neuronal cells. J Biol Chem. 1997;272:24008–24015. doi: 10.1074/jbc.272.38.24008. [DOI] [PubMed] [Google Scholar]
  • 39.Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES