Searching for Mesophilic Thermotogales Bacteria: “Mesotogas” in the Wild

Abstract

All cultivated Thermotogales are thermophiles or hyperthermophiles. However, optimized 16S rRNA primers successfully amplified Thermotogales sequences from temperate hydrocarbon-impacted sites, mesothermic oil reservoirs, and enrichment cultures incubated at <46°C. We conclude that distinct Thermotogales lineages commonly inhabit low-temperature environments but may be underreported, likely due to “universal” 16S rRNA gene primer bias.

Thermotogales, a bacterial group in which all cultivated members are anaerobic thermophiles or hyperthermophiles (5), are rarely detected in anoxic mesothermic environments, yet their presence in corresponding enrichment cultures, bioreactors, and fermentors has been observed using metagenomic methods and 16S rRNA gene amplification (6) (see Table S1 in the supplemental material). The most commonly detected lineage is informally designated here “mesotoga M1” (see Table S1 in the supplemental material). PCR experiments indicated that mesotoga M1 sequences amplified inconsistently using “universal” 16S rRNA gene primers, perhaps explaining their poor detection in DNA isolated from environmental samples (see text and Table S2 in the supplemental material). We therefore designed three 16S rRNA PCR primer sets (Table 1) targeting mesotoga M1 bacteria and their closest cultivated relative, Kosmotoga olearia. Primer set A was the most successful set, detecting a wider diversity of Thermotogales sequences than set B and being more Thermotogales-specific than primer set C (Table 2).

TABLE 1.

Primers targeting mesotoga M1 bacteria constructed and used in this study

Primer	Sequence (5′ to 3′)	Position in mesotoga 16S rRNA gene	No. of heterogeneity hot spotsa	Potential primer match in other Thermotogales lineages
Primer set A			1 (helix 17)
NMes16S.286F	CGGCCACAAGGAYACTGAGA	286		Perfect match in Kosmotoga olearia. The last 7 or 8 nucleotides at the 3′ end are conserved in other Thermotogales lineages.
NMes16S.786R	TGAACATCGTTTAGGGCCAG	786		One 5′ mismatch in Kosmotoga olearia and Petrotoga mobilis; 2-4 internal and 5′ mismatches in other lineages
Primer set B			None
BaltD.42F	ATCACTGGGCGTAAAGGGAG	540		Perfect match in Kosmotoga olearia; one or two 3′ mismatches in most other Thermotogales lineages
BaltD.494R	GTGGTCGTTCCTCTTTCAAT	992		No match in other Thermotogaleslineages. The primer is located in heterogeneity hot spot helices 33 and 34. This primer also fails to amplify some mesotoga M1 sequences.
Primer set C			9 (all 9 regions)
TSSU-3F	TATGGAGGGTTTGATCCTGG	3		Perfect match in Thermotoga spp., Kosmotoga olearia, and Petrotoga mobilis; two or three 5′ mismatches in other Thermotogales lineages; one 5′ mismatch to mesotoga M1 16S rRNA genes
Mes16S.R	ACCAACTCGGGTGGCTTGAC	1390		One 5′ mismatch in Kosmotoga olearia; 1-3 internal or 5′ mismatches in other Thermotogales lineages

^aHeterogeneity hot spots identified in reference 1.

TABLE 2.

Mesotoga clade sequences detected in environmental samples and enrichment cultures screened in this study^a

Site (abbreviation)	Temp in situ(°C)	Waterflooded	Environmental samplesb						Enrichment cultures
			Primer set A		Primer set B		Primer set C		Thermotogalesdetected by primer setc:			Lineage(s) detected
			No. of OTUs (no. of clones)	Lineage	No. of OTUs (no. of clones)	Lineage	No. of OTUs (no. of clones)	Lineage	A	B	C
Sidney Tar Ponds sediment (TAR)	Temperate	NA	1 (5)	M1	1	M1	—	—	+	+	+	M1, M2, M5
Oil sands settling basin tailings (05mlsb)	∼12d	NA	—	—	1 (6)	M1	—	—	−	+	−	M1
Grosmont A produced water (GrosA)	20	No	1 (15)	M1	1 (22)	M1	2 (14)	M1	+	+	+	M1
Foster Creek produced water (FC)	14	No	1 (21)	M1	1 (23)	M1	1 (1)	M1	+	ND	−	M1
Oil field D wellhead water (DWH)e,f	52-53g	Yes	1 (14)	Kosmotogai	1 (6)	M1i	1 (1)	Kosmotogai	NA	NA	NA	NA
Oil field D FWKO water (DF)f,h	20-30	Yes	1 (45)	Kosmotogai	1 (17)	M1i	—	—	+	+	−	M1, Kosmotoga, Petrotoga
Oil field H FWKO water (HF)j	30-32	Yes	7 (59)	M1, M2, M3, M4, Kosmotoga	1 (29)	M1	—	—	+	+	−	M1, Petrotoga
Oil field H satellite water (HSAT)e,j	41 and 50g	Yes	1 (8)	M1	—	—	2 (16)	Kosmotoga, Thermotoga	NA	NA	NA	NA
Oil field H wellhead water (HWH)e,j	41 and 50g	Yes	NA	—	—	NA	NA	NA	+	+	+	M1, Petrotoga

^aSee the supplemental material for site and methodological details. NA, not applicable; ND, not determined.

^bThe number of OTUs observed at a 0.01 distance cutoff is given for each primer set. The numbers of clones with Thermotogales sequences are in parentheses. —, PCR was attempted but no Thermotogales sequences were obtained or the PCR consistently failed.

^c+, sequence(s) detected; −, not detected. For more information on the enrichments, see the text and Table S3 in the supplemental material.

^dFrom April to May 2004, the temperature at the depth where the sample was taken was 12°C (7).

^eThere were no water samples from DWH and HSAT available for enrichment cultures, and no DNA was available from HWH.

^fThis reservoir has been treated with biocides; moreover, at this site, the water is filtered before being reinjected into the reservoir.

^gTemperatures of the oil pool where the water sample was obtained. The HSAT facility receives water from two oil pools, one at 41°C and one at 50°C.

^hWe screened DNA from samples taken in 2006 and 2008 but detected the same sequences in both, so sequences from the two samples were pooled.

ⁱThe mesotoga M1 and Kosmotoga sequences from DWH and DF were >99% similar and were assembled into one sequence in Fig. 1.

^jThis reservoir has been injected with water from a neighboring oil reservoir.

Since the putative mesophilic Thermotogales have been overwhelmingly associated with polluted and hydrocarbon-impacted environments and mesothermic oil reservoirs are the only natural environments where mesotoga M1 sequences previously were detected (see Table S1 in the supplemental material), we selected four oil reservoirs with in situ temperatures of 14°C to 53°C and two temperate, chronically hydrocarbon-impacted sites for analysis (Table 2). Total community DNA was extracted, the 16S rRNA genes were amplified, cloned, and sequenced as described in the supplemental material.

Environmental samples.

We detected Thermotogales sequences in all the environmental samples surveyed (Table 2), and specifically, mesotoga M1 16S rRNA gene sequences were detected in all mesothermic samples. In the temperate Sydney Tar Ponds samples, the oil sands tailings, and the wellhead production water samples from the mesothermic Grosmont A (14°C) and Foster Creek (20°C) oil reservoirs, all the Thermotogales sequences detected were highly similar and fell into the M1 clade (Table 2 and Fig. 1). The detection of mesotoga M1 in these two oil reservoirs, which have not undergone waterflooding, suggests that these sequences may represent indigenous petroleum reservoir bacteria, evidence for which has been long sought (reviewed in reference 3). Clade M1 sequences were also detected in oil fields H and D (Table 2), but their origin cannot be discerned because these reservoirs have been waterflooded.

FIG. 1.

Maximum-likelihood tree estimated from partial and full-length 16S rRNA gene sequences using PhyML (4) and RAxML (9, 10) (see the supplemental material). Representatives of characterized and cultivated Thermotogales lineages were included, as well as out-group sequences to root the tree. Sequences amplified from environmental DNA or enrichment cultures in this study are shown in bold font; site abbreviations are given in Table 2, and site descriptions are given in the supplemental material. For the sequences from the environmental DNA, the number of clones (>99% identity) included in each OTU is indicated (N=n). For sequences amplified from enrichment cultures, the temperatures of the cultures (described in the text and Table S3 in the supplemental material) in which they were detected are given (e.g., TAR2.A RT.46 indicates that the sequence was detected in cultures at room temperature and 46°C). Sequences from characterized thermophilic isolates or sequences retrieved from environments at >45° (indicated by GenBank accession numbers only) are indicated by a star. Sequence names in lightface font were retrieved from GenBank and are from environmental samples or cultures, bioreactors, or digesters at mesothermic temperatures ≤42°C (see Table S1 in the supplemental material). Only a subset of the uncultivated sequences published in GenBank and affiliated with the M1 clade are included here; for a more detailed tree containing all M1 clade sequences, see Fig. S1 in the supplemental material, and for sequence information, see Table S1. Among the environmental Thermotogales sequences in GenBank recovered from sites with temperatures >46°C, we included only sequences with high similarity to sequences identified from mesothermic environments to identify clades composed of sequences from both hot and cold environments. Where multiple highly similar sequences (∼99% identity) were deposited from the same study, the sequences were pooled and a consensus sequence was constructed, indicated as, for instance, “AB195914 - 23” in the tree. One study (8) includes sequences from several different wastewater treatment plants; here, we pooled sequences according to the site of origin and included the site in the name of the consensus sequence, e.g., “CU921025 +11, Cholet.” Numbers on branches indicate the percentage of occurrence in 100 bootstrap replicates using PhyML (lightface font) and RAxML (bold font). Support ≥90% in both analyses is indicated by a black dot on the branch, and support ≥70% but ≤90% is indicated by a gray dot.

The highest diversity of Thermotogales sequences was detected in the free-water knockout facility (FWKO) sample from oil field H (HF) (Table 2). Phylogenetic analysis showed that the sample from HF harbored mesotoga M1 as well as sequences closely related to K. olearia and three additional, putative mesophilic lineages (clades M2, M3, and M4) (Fig. 1); in total, we observed seven operational taxonomic units (OTUs) with an 85% average similarity. The diversity detected in the sample from HF is striking considering that all other environmental samples, including one from the same oil field (satellite facility [HSAT]), yielded only clade M1 or Kosmotoga-like sequences (Table 2). The lower temperature in the FWKO unit (30 to 32°C) than in the reservoir (41 and 50°C) may afford better growth conditions for the putative mesophilic clades M2, M3, and M4.

Enrichment cultures.

To substantiate the observations from environmental samples and determine whether enrichment in medium designed for growth of Thermotogales would facilitate detection of mesotoga sequences with our primer sets, we established anoxic enrichment cultures by inoculating K. olearia medium (2) with produced water or sediment slurries and incubating them at temperatures ranging from ∼14 to 65°C (details are in the supplemental material).

The diversity of Thermotogales sequences detected in the mesothermic enrichment cultures was similar to or less than that observed in the corresponding environmental samples (Table 2). The exception was the Sydney Tar Ponds enrichments, where sequences undetected in the environmental DNA appeared (belonging to the M2 and M5 clades) (Fig. 1). Notably, the Sydney Tar Ponds cultures had been incubated for several years, suggesting that bacteria in the M2 and M5 clades might need extended incubation to achieve detectable numbers.

Mesotoga M1 sequences were detected in all enrichments and, except in the Sydney Tar Ponds cultures, were also the dominant Thermotogales sequences in cultures incubated at <46°C. Despite the relatively high number of Thermotogales OTUs seen in the HF environmental DNA, we did not detect sequences of the M2, M3, M4, or Kosmotoga lineages in enrichments of this sample (Table 2; see also Table S3 in the supplemental material), suggesting that M1 mesotogas are more readily enriched at lower temperatures. Thermophilic Thermotogales sequences (i.e., Petrotoga and Kosmotoga) detected in enrichments from oil fields H and D incubated at temperatures ≥30°C were not observed in the Grosmont A or Foster Creek enrichments (see Table S3), suggesting that thermophilic Thermotogales are not present at the latter sites.

These cultures show that the mesotoga M1 clade includes the Thermotogales most readily enriched at temperatures <46°C, whereas thermophilic Thermotogales appear at temperatures >35°C. The M1 clade can also be enriched and detected separately from Kosmotoga, which tolerates a broad temperature range (2). Considered together with the low in situ temperatures of the Grosmont A and Foster Creek reservoirs, where mesotoga M1 sequences were the only Thermotogales sequences detected (Table 2), this observation substantiates our proposition that mesotogas from clade M1 thrive at temperatures much lower than has been observed for other Thermotogales.

Significance of results.

This study has shown that certain Thermotogales lineages have a wide distribution in mesothermic, anoxic, hydrocarbon-rich environments. The observation that oil reservoirs and polluted sites rich in hydrocarbons are the only environments where mesotoga M1 sequences have been detected to date supports the hypothesis that these bacteria originated as indigenous inhabitants of thermophilic oil reservoirs and adapted to lower temperatures as the reservoirs cooled (6). Mesotoga M1 isolate MesG1.Ag4.2, recently purified by C. Nesbø, M. Dlutek, W. F. Doolittle, J. Foght, and K. Noll (unpublished), has at least two 16S rRNA genes that differ by about 1% (GenBank accession numbers HM003108 and HM003109). In the phylogenetic tree (Fig. 1, sequences MesG1.Ag4.2 A and B), this comprises a substantial portion of the microvariation in one of the subclades within M1; thus, some of the variation within clade M1 might be due to within-genome heterogeneity. The global distribution of these highly similar sequences (Asia, Europe, and North and South America) (see Table S1 in the supplemental material) suggests that mesotogas may have spread relatively recently.

Nucleotide sequence accession numbers.

Sequences were deposited in GenBank under accession numbers HM003067 to HM003109.