Skip to main content
Molecular Plant logoLink to Molecular Plant
. 2008 Nov 14;1(6):1007–1020. doi: 10.1093/mp/ssn074

An Rh1–GFP Fusion Protein Is in the Cytoplasmic Membrane of a White Mutant Strain of Chlamydomonas reinhardtii

Corinne Yoshihara a, Kentaro Inoue b, Denise Schichnes c, Steven Ruzin c, William Inwood a, Sydney Kustu a,1
PMCID: PMC2902906  PMID: 19825599

Abstract

The major Rhesus (Rh) protein of the green alga Chlamydomonas reinhardtii, Rh1, is homologous to Rh proteins of humans. It is an integral membrane protein involved in transport of carbon dioxide. To localize a fusion of intact Rh1 to the green fluorescent protein (GFP), we used as host a white (lts1) mutant strain of C. reinhardtii, which is blocked at the first step of carotenoid biosynthesis. The lts1 mutant strain accumulated normal amounts of Rh1 heterotrophically in the dark and Rh1–GFP was at the periphery of the cell co-localized with the cytoplasmic membrane dye FM4-64. Although Rh1 carries a potential chloroplast targeting sequence at its N-terminus, Rh1–GFP was clearly not associated with the chloroplast envelope membrane. Moreover, the N-terminal half of the protein was not imported into chloroplasts in vitro and N-terminal regions of Rh1 did not direct import of the small subunit of ribulose bisphosphate carboxylase (SSU). Despite caveats to this interpretation, which we discuss, current evidence indicates that Rh1 is a cytoplasmic membrane protein and that Rh1–GFP is among the first cytoplasmic membrane protein fusions to be obtained in C. reinhardtii. Although lts1 (white) mutant strains cannot be used to localize proteins within sub-compartments of the chloroplast because they lack thylakoid membranes, they should nonetheless be valuable for localizing many GFP fusions in Chlamydomonas.

Keywords: CO2 acquisition, fluorescence imaging, membrane biology, protein targeting

INTRODUCTION

The best known Rh (Rhesus) proteins are those that compose the Rh blood group substance of humans. Despite their importance in human medicine and their abundance in the erythrocyte membrane, the primary function of Rh proteins remained unknown for 65 years (Agre and Cartron, 1991). This was, in part, because Rh proteins are large, extremely hydrophobic membrane proteins that are difficult to handle. Though Chlamydomonas is usually considered a relative of vascular plants, it also has features of metazoan animals (e.g. flagella = cilia), which were lost in vascular plants (Merchant et al., 2007). Rh proteins are one of these features. They are found in Chlamydomonas and many other microbial eukaryotes, are present in all metazoan animals for which there are complete genome sequences, and were apparently lost in the moss Physcomitrella and vascular plants (JGI Eukaryotic Genomes, http://genome.jgi-psf.org/euk_home.html; Seack et al., 1997; Eichinger et al., 2005; Huang and Peng, 2005; Eisen et al., 2006). Chlamydomonas is one of the simplest organisms to have an Rh protein and we showed that its major Rh protein, Rh1, is involved in transport of carbon dioxide (Soupene et al., 2002, 2004; Fong et al., 2007). Recent evidence indicates that the human Rh blood group substance is also involved in CO2 transport (Endeward et al., 2006, 2008), and this is probably a function of its RhAG (Rh50) component (Huang and Peng, 2005). RhAG remains closest to ancestral Rh proteins like C. reinhardtii Rh1 and does not carry the immunologically problematic epitopes.

Knowing the sub-cellular localization of Rh1 is essential to interpreting future studies of its function. With one exception, all Rh proteins that have been localized are found in the cytoplasmic membrane (Huang, 1997; Liu et al., 2000; Weiner et al., 2003; Ji et al., 2006). The exception is the Rh50-like protein of the slime mold, Dictyostelium discoideum. This protein, which is highly expressed during vegetative growth, is found in the membrane of the contractile vacuole (Benghezal et al., 2001). Targeting requires clusters of acidic residues in its cytoplasmic C-terminal region (Mercanti et al., 2006) that are not present in Chlamydomonas Rh1. Initial in-silico analysis predicted that Chlamydomonas Rh1 had a cleavable chloroplast transit peptide at its N-terminus (Soupene et al., 2002). However, it is difficult to predict localization of membrane proteins in Chlamydomonas, particularly localization of a protein more typical of animals than of plants (Franzén et al., 1990), and hence we wanted to localize Rh1 experimentally. We here present evidence that it is in the cytoplasmic membrane, like most other Rh proteins, and discuss possible alternative roles for its N-terminal sequence.

RESULTS

Predictions for the Localization of Rh1 Did Not Agree

We used 20 programs to predict the sub-cellular localization of the Chlamydomonas Rh1 protein. They split evenly between predicting a plasma membrane or non-organellar localization (10 programs) and an organellar localization, usually chloroplast (eight programs) (Table 1). To assess the efficacy of the programs for Chlamydomonas proteins, we used them to predict the localization of 16 known proteins (Supplemental Table 1). The 10 programs that did this best (10 or more correct predictions) were also split between predicting a plasma membrane localization (six programs) or chloroplast localization (four programs) for Rh1. Seven of the 10 programs that worked best for Chlamydomonas proteins analyzed the N-terminal sequence rather than the whole protein. The four of these that predicted a chloroplast localization for Rh1 focused on the 39 N-terminal amino acids, in particular the positive charge and the ‘SFFHS’ motif at amino acids 19–23 (Cline and Henry, 1996). However, two of them, which assigned likelihood values to their predictions, gave Rh1 scores of only 0.513 and 0.463 compared to threshold values of 0.500 and 0.420, respectively. One of the programs that predicted a plasma membrane localization for Rh1, PSORT, also predicted a thylakoid membrane localization as a close second. However, PSORT is a notoriously poor predictor of thylakoid membrane proteins (Gómez et al., 2003). Given that none of the programs predicted the localization of the Rh1 protein with high confidence, we explored its localization experimentally, focusing on the two compartments most commonly predicted—the plasma membrane and the chloroplast.

Table 1.

Predicted Localization of Rh1 Protein.

Program Reference Program descriptiona Possible compartmentsb Species Prediction
PSORT Nakai and Kanehisa, 1991 Hierarchical evaluation of signal; membrane protein topology 1–10 signal type Plant Plasma membrane moderate reliability
SignalP Bendtsen et al., 2004 Signal sequence only Signal type Eukaryote Signal anchor not cleaved
ChloroP Emanuelsson et al., 1999 Signal sequence only Signal type Plant Chloroplast low reliability
TargetP Emanuelsson et al., 2000 SignalP; additional signal predictors 1, 6, 11, 12 signal type Plant Chloroplast high reliability
PCLR Schein et al., 2001 Signal sequence only Signal type Eukaryote Chloroplast
SubLoc Hua and Sun, 2001 AA Comp SVM 2, 6, 7, 12 Animal Other
iPSORT Bannai et al., 2002 Signal sequence only Signal type, first 30 AAa Eukaryote Chloroplast
ESL Pred Bhasin and Raghava, 2004 AA Comp SVM 2, 4, 6, 7 Animal Extracellular
Predotar Small et al., 2004 Signal sequence only Signal type Eukaryote Not organelle
HSL Pred Garg et al., 2005 AA Comp SVM 2, 6, 7, 9 Human Plasma membrane
LOCtree Nair and Rost, 2005 AA Comp SVM 1, 2, 4, 6, 7 Plant (non-membrane) Chloroplast low reliability
SLP-Local Matsuda et al., 2005 AA comp SVM 1, 6, 11, 12 Plant Chloroplast
Plant-PLoc Chou and Shen, 2006 GO classification; sequence similarity 1–4, 6–10, 12, 14 Plant Plasma membrane
BaCelLo Pierleoni et al., 2006 AA comp SVM 1, 2, 6, 7, 11 Plant Chloroplast
CELLO v2 Yu et al., 2006 2-level SVM 1–10, 12–14 Eukaryote Plasma membrane
Protein Prowler Hawkins and Bodén, 2006 TargetP followed by decision network 1, 6, 11, 12 signal type Eukaryote Secretory pathway
pTarget Guda, 2006 Protein functional domains 2–9, 13 Animal Plasma membrane
AAIndexLoc Tantoso and Li, 2007 Local/Global AA comp, 5-level 1–10 Plant Peroxisome
SCLFA Tamura and Akutsu, 2007 AA feature vectors; sequence alignments 1, 6, 11, 12 Eukaryote Mitochondria
SherLoc Shatkay et al., 2007 AA comp SVM 1–10 Plant Chloroplast
SLPS Jia et al., 2007 Protein functional domains and homology; nearest neighbor 1–14 Eukaryote Plasma membrane
a

Abbreviations: AA, amino acid(s); AA comp, amino acid comparison; GO, gene ontology; SVM, support vector machine; 5-level, five-level prediction program.

b

Compartments: 1. chloroplast; 2. cytoplasm; 3. endoplasmic reticulum; 4. extracellular space; 5. Golgi apparatus; 6. mitochondria; 7. nucleus; 8. peroxisome; 9. plasma membrane; 10. vacuolar; 11. secretory pathway; 12. other (unspecified); 13. lysosome; 14. cell wall; 15. cytoskeleton.

Attempts to Localize Rh1–GFP Fusions in a Wild-Type Background Were Not Successful

As described in Methods, we fused three portions of Rh1 (predicted transmembrane-spanning segments 1–4, 1–6, and 1–12) to a GFP protein adapted to C. reinhardtii nuclear codon usage (Fuhrmann et al., 1999) and later we also fused full-length Rh1 to this GFP (Figure 1). Fusions of TM1-6 and TM1-12 had been used previously to localize Rh proteins in other organisms (Liu et al., 2000; Ji et al., 2006). When we put the first three constructs into strain 4A+ and selected zeocin resistance, we saw little evidence of expression of fusion proteins in the transformants. Initially, we examined 25 transformants from each construct by microscopy (100–200 cells per transformant). Cultures were grown on TAP medium in the light, which yields low but detectable Rh1 expression (Soupene et al., 2002, 2004). We failed to detect GFP fluorescence above the background of chlorophyll fluorescence. We next used appropriate primers to amplify each RH1–GFP fusion from the 25 transformants to be sure it was present. We obtained PCR products from a subset of transformants in each case (Table 2) and, in all cases, their correctness was confirmed by DNA sequencing. However, only a further subset of the transformants that carried the fusions transcribed them. Though there may have been other problems in the 4A+ background, we subsequently found that the fusions of portions of Rh1 to GFP yielded very few fluorescent transformants in the lts1-204 (white) background, whereas we were able to obtain fluorescent transformants from a fusion of intact Rh1 to GFP (see below).

Figure 1.

Figure 1.

RH1 Genomic Constructs.

(A) Diagram of the RH1 gene indicating the positions of the 12 exons (numbered boxes) and six primers. Untranslated regions are indicated by intervening lines.

(B) Schematic diagram depicting the Rh1–GFP fusion proteins. The white boxes represent Rh1 protein and the green boxes represent GFP protein. TM1–4, 1–6, 1–12, and full-length represent the four fusion constructs that cover four, six, and 12 putative transmembrane-spanning regions and the full-length Rh1 protein, respectively. The number of residues is indicated. See also Figure 8.

Table 2.

Analysis of Zeocin-Resistant Transformants of 4A+.

Transformant Total transformants analyzed Transformants with RH1 fusion genea Transformants expressing RH1–GFP RNAb
TM1–4 25 5 1
TM1–6 25 12 8
TM1–12 25 8 5
a

PCR.

b

RT–PCR.

Rh1 Was Present in Normal Amounts in lts1 Mutant Strains

At a suggestion of K.K. Niyogi, we next explored the use of white mutant strains, lts1 (light sensitive 1) (McCarthy et al., 2004) as hosts for Rh1–GFP constructs. Strains with lesions in lts1 lack phytoene synthase, the first enzyme of carotenoid biosynthesis, and their lack of carotenoids results in degradation of chlorophyll (Herrin et al., 1992; McCarthy et al., 2004). This facilitates direct detection of GFP fluorescence microscopically and hence allows easy screening of many transformants. Because lts1 strains are restricted to growth on acetate in the dark, we first checked to see whether parental strain 4A+ expressed Rh1 in detectable amounts under these conditions and whether the lts1 strains expressed it in similar amounts. As shown in Figure 2, Western analysis indicated that strain 4A+ expressed Rh1 at low but detectable levels on acetate in the dark with respect to the high levels seen in cultures grown on TP and bubbled with air supplemented with 3% CO2 in the light (Soupene et al., 2002). (The Rh1 band in Figure 2 was identified by bubbling a TP-grown culture of 4A+ with CO2 for 4–5 h (Lane 5 vs Lane 2).) The lts1-203 and lts1-204 strains appeared to have approximately as much Rh1 as 4A+ on acetate in the dark (Figure 2, Lane 3 vs Lane 1 and not shown). Unfortunately, bubbling dark-grown cultures of 4A+ and the two lts1 strains with CO2 in the dark did not increase the amount of Rh1 (Figure 2, Lanes 4 and 6 vs Lanes 1 and 3).

Figure 2.

Figure 2.

Rh1 Is Present in Normal Amounts in lts1-204.

Western analysis of whole cells of strains 4A+ (Lanes 1, 2, 4, and 5) and lts1-204 (Lanes 3 and 6). Strains were grown in the dark on TAP medium (Lanes 1, 3, 4, and 6) or in the light (∼100 μmol photons m−2 s−1) on TP medium (Lanes 2 and 5). In both cases, the nitrogen source was NH4Cl. Lanes 1–3, cells bubbled with air (0.035% (vol./vol.) CO2); Lanes 4–6, cells shifted from air to high CO2 (3% CO2) for 4–5 h. The Rh1 band is indicated with an arrow. As expected (Soupene et al., 2002), induction of Rh1 in strain 4A+ at high CO2 was only partial in this experiment (approximately five-fold) and, likewise, repression of the periplasmic carbonic anhydrase Cah1 was only partial (data not shown).

Rh1–GFP Localized to the Cytoplasmic Membrane of lts1-204

When we put constructs carrying portions of RH1 fused to GFP (see above) into strain lts1-204 (Inwood et al., 2008) and selected zeocin resistance, we again saw little evidence of expression of fusion proteins in the transformants (data not shown). As discussed above, we examined at least 25 transformants from each construct microscopically but did not perform other tests. Instead, we fused intact RH1 (∼5 kbp with the promoter region) to GFP. C. reinhardtii has a very high GC content of 67%, which makes it difficult to amplify large regions by PCR. Although we have been able to accomplish this (Kim et al., 2006), we were unable to obtain intact RH1 sequence without alterations (0/17). Hence, we selected three versions of the RH1–GFP construct with slight alterations (see Methods). When we put the intact RH1–GFP fusions into lts1-204, we found that 15 (∼20%) of the 73 zeocin-resistant transformants we examined were fluorescent: six of these were from version 1 of the construct, eight from version 2, and one from version 3.

Only three transformants, all derived from version 2 of the intact RH1–GFP fusion, fluoresced strongly enough to be analyzed further by confocal fluorescence microscopy. We will refer to these as transformants 2a (CR505), 2b (CR507), and 2c (CR508). Version 2 was the cleanest of those we used because it contained no nucleotide changes in coding sequence for Rh1 (there were three changes in the 5’ untranslated region and three in introns). That there were no further changes when version 2 of the construct was integrated into the genome was confirmed by sequencing transformants 2a and 2b. Cells of transformant 2a were strongly fluorescent over 6 months of examination, whereas cells of transformant 2c fluoresced strongly but intermittently. Cells of transformant 2b, although fluorescent initially, were only very weakly fluorescent for most of the study. Fluorescent cells of both transformants 2a and 2c were a small proportion of the total population (10–20%; Table 3). Occasionally, as many as 30–40% of the cells examined were fluorescent.

Table 3.

Expression of Intact Rh1–GFP in Zeocin-Resistant Transformants of lts1-204.

Transformant Cells analyzed Fluorescent cells (%)
2a 196 416 11
2b 63 360 3
2c 130 944 17

We used confocal microscopy to localize GFP fluorescence in ∼200 transformant cells carrying intact Rh1–GFP (Table 4 and Figure 3). In almost all of the fluorescent cells, GFP appeared to localize peripherally. Peripheral GFP fluorescence was often more concentrated along the sides of the cell than at the posterior end and was always absent at the anterior end of the cell near the flagella. Peripheral GFP fluorescence was external to weak chlorophyll autofluorescence (red) (Figure 3A–3E) and, in cells of transformant 2a, was shown to co-localize with the red dye FM4-64, which stains the cytoplasmic membrane (Figure 3F). That green fluorescence was clearly exterior to the chloroplast membrane was shown in two-dimensional (Figure 4) and three-dimensional (Figure 5) reconstructions of the data. In addition to its peripheral location, about half the time, Rh1–GFP fluorescence was also found at internal cellular positions that were asymmetrically distributed (Figure 3D, 3E, and 3G–3K). Only rarely was internal GFP fluorescence seen in the absence of peripheral fluorescence (Table 4).

Table 4.

Localization of intact Rh1–GFP Fluorescence.

Transformant Total cells examined Cytoplasmic membrane onlya Cytoplasmic membrane and internal Total cytoplasmic membrane Internal only
2a 151 68 73 141 (93%) 10
2b 9 7 2 9 (100%) 0
2c 44 21 22 43 (98%) 1
a

Refers to peripheral localization and co-localization with FM4-64 (Figure 3).

Figure 3.

Figure 3.

Localization of Rh1–GFP Fluorescence in lts1-204 Cells by Confocal Microscopy.

For all panels, Column 1 shows the Rh1–GFP fluorescent image, Column 2 the DIC image, Column 3 chlorophyll autofluorescence or fluorescent staining of other cell structures, and Column 4 the merged image. Cells in Rows A–E were examined for chlorophyll autofluorescence, the cell in Row F was stained with the cytoplasmic membrane dye FM4-64, and cells in Rows G–L were stained with MitoTracker Orange. GFP is localized peripherally in all cells and both peripherally and internally in many cells (particularly Rows D, E, and G–K). Note the large starch granule in Row L. Scale bars are 5 μm.

Figure 4.

Figure 4.

Single Median Optical Slice from RH1–GFP Transformant.

The image stack (44 optical slices, 380-nm step size) was deconvolved using Huygens Professional 3.1 software (Scientific Volume Imaging, Amsterdam, NL) using a theoretical Point Spread Function (PSF) calculated from optical scanning parameters. The resultant image stack was reconstructed using Imaris 6.01 (Bitplane AG).

Figure 5.

Figure 5.

3D Image of the Dataset Described in Figure 4.

GFP fluorescence (green) was rendered as volumetric data. Chlorophyll fluorescence (red) was reconstructed as an isosurface linking intensity values 25% above background.

Internal Fluorescence from Rh1–GFP Did Not Localize to Chloroplasts or Mitochondria

By contrast to the case for peripheral (cytoplasmic membrane) GFP fluorescence, there was no easily discernible pattern to internal GFP fluorescence, which was most intense in cells of transformant 2c (Figure 3D, 3E, and 3G–3K). Internal fluorescence appeared as round patches whose number varied and whose appearance was sharp or diffuse. These patches were sometimes in the cell interior and sometimes at more peripheral locations.

The patches of internal fluorescence did not co-localize with weak chlorophyll autofluorescence and hence were not in chloroplasts (Figure 3D and 3E). Chlorophyll autofluorescence had the same irregular pattern as in host strain lts1-204 (Inwood et al., 2008). Chlorophyll autofluorescence was usually seen around the perimeter of the cells and around starch granules, which could be very abundant and large, and was displaced to the anterior of the cell when starch granules were particularly large. Internal GFP fluorescence also did not co-localize with mitochondria (identified by staining with the dye MitoTracker orange; Figure 3G–3L).

N-terminal Regions of Rh1 Did Not Act as a Cleavable Targeting Sequence In Vitro

To further test the predicted chloroplast localization of Rh1, we performed in-vitro chloroplast import assays. For this purpose, we used chloroplasts isolated from pea seedlings because they have been used generically for import of proteins from various organisms including Chlamydomonas (Mishkind et al., 1985). Our initial attempts to produce intact Rh1 (61.1 kD) in a wheat germ extract were unsuccessful (data not shown). Hence, we tested whether the N-terminal portion of Rh1, which was predicted to carry a cleavable chloroplast targeting sequence, could target proteins to chloroplasts. The first tests were done with N-terminal fragments of Rh1 that carried the predicted transit peptide, namely the N-terminal 200 amino acids ending in loop 5 or the N-terminal 235 amino acids ending in loop 6 (Figure 6). There was no detectable import of [35S]-labeled truncations of Rh1 into chloroplasts (data not shown). The second tests were done with N-terminal fragments of Rh1 fused to the mature portion of the Rubisco small subunit (mSSU), specifically with Rh1(1–44)–mSSU and Rh1(1–105)–mSSU (Figure 6). A very small amount of Rh1(1–44)–mSSU was recovered in chloroplasts, although it showed no change in mobility on SDS–PAGE (Figure 7, compare Lanes 8 and 11, 12). No detectable Rh1(1–105)–mSSU was recovered in chloroplasts (Lanes 15–19).

Figure 6.

Figure 6.

RH1 cDNA Constructs Used in the Chloroplast Import Assay.

(A) Diagram of RH1 cDNA indicating primer positions.

(B) Rh1 protein and the small subunit of pea Rubisco (SSU). A putative Rh1 transit peptide (tp) is indicated in yellow and the remainder of the protein in orange. The SSU transit peptide (tpSSU) is shown in green and mature Rubisco small subunit (mSSU) is blue. Rh1 truncations are represented as Rh1–loop5 and Rh1–loop6. The residue positions are indicated. Rh1–mSSU fusion constructs containing the first 44 and 105 N-terminal residues of Rh1 are indicated as Rh1(1–44)mSSU and Rh1(1–105)mSSU, respectively.

Figure 7.

Figure 7.

Effect of Putative Rh1 Targeting Sequences on Protein Import into Pea Chloroplasts.

Radiolabeled translation products (tl = 10% of the translation products used for import) are described in the text. They were incubated with intact chloroplasts under conditions suitable for protein import and then chloroplasts containing radiolabeled proteins were independently subjected to two different treatments. In the first, chloroplasts were lysed hypotonically (HM) and fractionated by centrifugation into a supernatant that contains soluble proteins (S1), and an initial pellet. The initial pellet was suspended in 0.1 M Na2CO3 and further fractionated by centrifugation into a second supernatant that contains peripheral membrane proteins (S2) and a pellet fraction (P). The fractions were subjected to SDS–PAGE followed by fluorography. In the second treatment, the chloroplasts were incubated on ice for 30 min without (–) or with (+) thermolysin (t-lysin), or with t-lysin and 1% Triton X-100 (+*) before they were subjected to analysis. Vertical black lines indicate groups of lanes that were subjected to fluorography together.

Although Rh1(1–44)–mSSU was recovered in the pellet fraction after alkaline wash (Lane 11), which is normally indicative of an ‘integral association’ with chloroplast membranes, it was digested by thermolysin (compare Lanes 12 and 13), a protease that has access to proteins in the outer but not the inner membrane of the chloroplast envelope. Thus, the association of Rh1(1–44)–mSSU with membranes was apparently adventitious. By contrast to the fusions, the precursor of SSU (prSSU; Lane 1) was imported into the soluble fraction of chloroplasts as a smaller processed form (Lane 2). It was resistant to thermolysin digestion (compare Lanes 5 and 6) unless chloroplasts were disrupted with detergent (Lane 7). Import depended on the transit peptide because targeting of the mature form of SSU (mSSU, Lane 22) to chloroplasts was not detectable (Lanes 23–26). In fact, the behavior of mSSU was very similar to that of the Rh1–mSSU fusions (Figure 7 and data not shown). Collectively, these data indicate that the N-terminal region of Rh1 does not contain information for chloroplast targeting in vitro and does not function as a cleavable stromal targeting sequence. Although our failure to detect import of truncated or chimeric versions of Chlamydomonas Rh1 into pea chloroplasts in vitro might be attributed to the heterologous assay system, this is unlikely because the general chloroplast import system of Chlamydomonas appears to be much like that of vascular plants (Kalanon and McFadden, 2008).

DISCUSSION

To facilitate localization of fusions of Rh1 to GFP, we used as host an lts1 mutant strain of C. reinhardtii, which lacks carotenoids and is white (McCarthy et al., 2004). (See Results for difficulties in using a wild-type host.) A fusion of intact Rh1 to GFP localizes to the cytoplasmic membrane (Figures 3–5) and is depleted in the specialized region of membrane around the flagella (Bloodgood et al., 1986). Two- and three-dimensional reconstructions (Figures 4 and 5) show clearly that the fusion is external to the chloroplast. We have recently postulated that Rh proteins transport the hydrated form of CO2 (H2CO3 = HCO3– + H+) (Fong et al., 2007) under conditions of high CO2 availability. That Chlamydomonas Rh1 would carry out this function across the cytoplasmic membrane seems a reasonable possibility. The lts1 strains have an intact chloroplast envelope membrane but lack stacked thylakoids (Inwood et al., 2008). Although we consider it unlikely, we cannot rule out the possibility that Rh1 is normally targeted to thylakoid membranes and defaults to the cytoplasmic membrane in their absence.

In agreement with the cytoplasmic membrane localization of the Rh1–GFP fusion in a C. reinhardtii lts1 strain, neither large N-terminal fragments of Rh1 nor fusions of short putative targeting sequences to SSU from pea were imported into chloroplasts in vitro. Although small amounts of one fusion appeared to be adventitiously associated with pea chloroplast membranes, the N-terminal sequence of this protein was not cleaved. Rather than targeting Rh1 to the chloroplast, its long N-terminal sequence may be a signal peptide or a signal anchor sequence (Shaw et al., 1988). The first transmembrane spanning segment of ammonium transport (Amt) proteins, which are the only known homologs of Rh proteins (Marini et al., 1997; Huang and Peng, 2005), is removed in proteobacteria and in archaea (Thomas et al., 2000; Khademi et al., 2004; Zheng et al., 2004; Andrade et al., 2005; Thornton et al., 2006). The first transmembrane spanning segment of the Rh protein from the bacterium Nitrosomonas europaea is also removed, at least in E. coli (Li et al., 2007; Lupo et al., 2007). Cleavage of the N-terminus, which leaves 11 transmembrane spanning segments, is apparently very unusual for bacterial membrane transport proteins and its mechanism remains to be defined (Pao et al., 1998; Saier, 2003; Thornton et al., 2006). In contrast to the case for the Nitrosomonas europaea Rh protein, all three components of the Rh blood group substance, RhAG, RhD, and RhCcEe, retain the N-terminal transmembrane spanning segment, which is followed by a large loop that may separate it from the remainder of the protein (Avent et al., 1992; Eyers et al., 1994) (Figure 8). It is not known whether the N-terminal segment is removed from C. reinhardtii Rh1.

Figure 8.

Figure 8.

Alignment of Rh Proteins.

The Chlamydomonas reinhardtii Rh1 protein, the human RhAG protein, and the Nitrosomonas europaea Rh50 protein were first aligned to maximize sequence similarity and then, to the extent possible, to align transmembrane segments. Chlamydomonas Rh1 and Nitrosomonas Rh50 are each more closely related to Human RhAG than to each other. Chlamydomonas Rh1 transmembrane segments, highlighted in green, were predicted using several programs: MEMSAT3 (Jones, 2007), HMMtop (Tusnády and Simon, 1998), TMpred (Hofmann and Stoffel, 1993), DAS (Cserzö et al., 1997), and PONGO (Amico et al., 2006). All programs are in general agreement as to the location of the TM segments, although some could not ‘find’ TM5 and TM9, apparently due to their close proximity to TM4 and TM8, respectively. Human RhAG transmembrane segments, shown in red, were predicted by Huang and Liu (2001). Transmembrane segments of Nitrosomonas Rh50, highlighted in purple, are based on the crystal structure of the protein (Li et al., 2007; Lupo et al., 2007). Segments are numbered M1 to M12 using the RhAG protein model (see text). The Chlamydomonas Rh1 sequences included in various fusions and truncations are indicated. Arrows show the downstream boundaries of segments fused to GFP: ‘4’ for TM1–4; ‘6’ for TM1–6; ‘12’ for TM1–12. Arrowheads indicate downstream boundaries of segments fused to SSU or of truncations used for chloroplast import studies: ‘a’ for 44 amino acids (fusion); ‘b’ for 105 amino acids (fusion); ‘L5’ for 200 amino acids (truncation); ‘L6’ for 235 amino acids (truncation). Highly conserved residues F107, H168, F215, and H318 are underlined.

In about half of the fluorescent cells we examined, Rh1–GFP fluorescence was localized internally as well as to the cytoplasmic membrane. Internal localization was to a variable number of patches in the cytoplasm that were readily distinguished from mitochondria (Figure 3G–3L). Whether this internal fluorescence is associated with the delivery machinery for cytoplasmic membrane proteins, the autophagous vacuoles abundant in lts1 strains (Inwood et al., 2008), the contractile vacuole, as is the case for a Dictyostelium discoideum Rh protein (Benghezal et al., 2001; Mercanti et al., 2006), or another organelle(s) remains to be determined. It likewise remains to be determined whether Rh1 is normally dually targeted. Dual localization has been well documented for other membrane transport proteins; for example, the general amino acid permease of the yeast Saccharomyces cerevisiae is found in both the cytoplasmic and vacuolar membranes (Risinger et al., 2006; Risinger and Kaiser, 2008).

Although lts1 strains lack thylakoid membranes (Inwood et al., 2008) and hence will not be useful for localization of proteins within sub-compartments of the chloroplast, their low levels of chlorophyll should make them valuable for localizing a variety of GFP fusions in Chlamydomonas. Rh1–GFP is one of the first cytoplasmic membrane protein fusions available in Chlamydomonas and, as such, may be useful for studying exclusion of cytoplasmic membrane proteins from specialized membrane regions around Chlamydomonas flagella (Bloodgood et al., 1986).

METHODS

Prediction Programs for Sub-Cellular Localization

References, algorithms, and some basic parameters for the 20 programs we used to determine the localization of the Chlamydomonas Rh1 protein are listed in Table 1. Where possible, Chlamydomonas was treated as a plant. The 16 Chlamydomonas proteins of known localization used to assess the efficacy of the programs were: CSOA and CSOB, the opsin proteins localized in the plasma membrane associated with the eyespot; a PDR-like transport protein that was identified as a plasma membrane protein in Arabidopsis; PMA2, a plasma membrane ATPase; CAH1, a periplasmic carbonic anhydrase; CAH3, a thylakoid lumen carbonic anhydrase; CAH6, a chloroplast stromal carbonic anhydrase; mtCA, a mitochondrial carbonic anhydrase; SSU, the small subunit of ribulose bisphosphate carboxylase (Rubisco), which is in the chloroplast stroma; Lhcbm6, a light harvesting protein of photosystem II, which is in the thylakoid membrane of the chloroplast; ATPvA2 and ATPvA1, subunits of the vacuolar membrane ATPase; ATPC, ATPD, and ATPG, nuclear-encoded subunits of the chloroplast ATPase, which is in the thylakoid membrane; and ATP1A, a subunit of the mitochondrial ATPase, which is in the mitochondrial inner membrane.

Strains and Growth Conditions

Wild-type strain 4A+ and the lts1-203 and lts1-204 mutants were obtained from K.K. Niyogi (University of California, Berkeley). Wild-type strain CC-125, which was used to amplify RH1, was obtained from the Chlamydomonas Culture Collection (Duke University, Durham, North Carolina). Control strain Ble–GFP (Fuhrmann et al., 1999), which expresses a fusion between Ble and GFP in the nucleus, was obtained from S.P. Mayfield (The Scripps Research Institute, La Jolla, CA). Strains were maintained at 25°C on Tris Acetate Phosphate (TAP) agar medium (Harris, 1989, p. 26) containing NH4Cl (10 mM) as nitrogen source, as were transformants carrying RH1 or portions of RH1 fused to GFP (see below). Liquid cultures were grown in the same medium unless otherwise specified. Strain 4A+ was also grown in medium without acetate (TP medium), as noted. Medium for Ble–GFP was supplemented with 250 μM arginine. The lts1 strains, which have lesions in the gene for phytoene synthase, the first enzyme of carotenoid synthesis (McCarthy et al., 2004), were maintained in complete darkness, as were transformants carrying RH1–GFP fusions. Other strains were maintained under continuous illumination (125 μmol photons m−2 s−1). For microscopic examination, cells were grown in liquid culture with constant orbital shaking (∼110 rpm) at 25°C and harvested during the exponential phase.

Western Analysis for Rh1 in lts1 Mutant Strains

Strains were grown in flat 1-l bottles containing 700 ml of TAP–NH4Cl medium under constant illumination (∼100 μmol photons m−2 s−1) or in darkness and bubbled with air (0.035% vol./vol. CO2). After growth to mid-exponential phase, some cultures were then subjected to an upshift by bubbling with air enriched with 3% vol./vol. CO2 for 4–5 h. Cell densities were measured with a hemocytometer and were matched for different samples. A 10-ml portion of cells was harvested by centrifugation at 8000 g for 5 min at 4°C. Cells were suspended in NuPAGE LDS sample buffer (Invitrogen), and lysates were incubated at 37°C for 30 min. Cell extracts (∼4 μg protein; measured before samples were put in lysis buffer) were subjected to SDS–PAGE (NuPAGE 4–12% Bis–Tris gel; Invitrogen) and proteins were transferred to a nitrocellulose membrane. Affinity-purified rabbit antibodies raised against a C-terminal peptide of Rh1 (Zymed) were used to detect Rh1, and affinity-purified rabbit antibodies (kindly provided by Martin H. Spalding, Iowa State University, Ames) were used to detect the periplasmic carbonic anhydrase Cah1. Membranes were incubated with an alkaline phosphatase-conjugated secondary antibody (Zymed).

RH1–GFP Fusion Constructs

The sequence of the RH1 gene was determined from the RH1/RH2 region of the Chlamydomonas genome (Joint Genome Institute v2.0) and was the same as that in strain CC-125. Chlamydomonas genomic DNA was prepared from strain CC-125 as described (Kim et al., 2005) and the 5′-UT region for RH1 (∼1.4 kb), portions of RH1 (through predicted transmembrane segments 4, 6, and 12; Figure 8), and intact RH1 were amplified by PCR using primers listed in Table 5. Amplified regions were cloned into the HindIII/XbaI sites of pCrGFP (Entelechon, Regensburg, Germany), in which the GFP gene is adapted for Chlamydomonas nuclear codon usage (Fuhrmann et al., 1999). Fragments carrying fusions were then excised from pCrGFP using HindIII/EcoRI and cloned into the EcoRV site of the pSP124s vector (gift of Heriberto Cerutti, University of Nebraska, Lincoln; described in Soupene et al., 2004).

Table 5.

PCR and Sequencing Primers for RH1, Rh1 cDNA, and Pea SSU cDNA.

Primer Direction Region Sequence (5’ to 3’) Position in genomic DNAa Position in cDNA
RH1–HIII/5’ F 5′-UT ATAAGCTTAGCCGGCGGTGAGG –1443 to –1428
RH–XbaI/3’ R TM4 AATCTAGAGTGGCCTTGCCGATGAT 1406 to 1389
RH–XbaI/3′Ex7 R TM6 ACTGTCTAGATTGCGGCTGATCATGAG 1757 to 1741
RH–XbaI/3′Ex10 R TM12 ACTGTCTAGAGGGTTGAACCACGACAC 2803 to 2787
RH1–HIII/5′c b F 5′-UT ACTGAAGCTTTAGCCGGCGGTGAGGGAAGGCCG –1443 to –1420
RH1–XbaI/3′Ex12 R C-terminus ACTGTCTAGAACGTTGCCGGCGCCGGCCACCAT 3523 to 3501
RH1–ATG F N-terminus ATGCAGGCACTTCCTCCCAAGATTCC 1 to 26
Loop5 R Loop5 CTACATGTCCAGCGCCTTGAATGTG 600 to 579
Loop6 R Loop6 CTAGTTCTTGGGGTTGTCCAGGCCG 705 to 684
Primer A F N-terminus GCCATGGAGGCACTTCCTCCCAA 1 to 20
Primer B R TM1 CGCATGCAGGGCACAAAGCCAGC 132 to 118
Primer C R TM2 CGCATGCCGTAGCCGTAGCGGC 315 to 299
RH1–TAG R C-terminus CTACACGTTGCCGGCGCCGGCCACCAT 1725 to 1702
mSSU–ATG F N-terminus ATGCAGGTGTGGCCTCCAATTGGAA 1 to 25
mSSU–TGA1 R C-terminus TCAGTGGTGGTGGTGGTGGTGCTCG —c
a

+1 is A of starting ATG.

b

Used to amplify full-length RH1.

c

Outside coding regions; in pET23d.

Transmembrane segments of Rh1 were predicted by alignment with the human RhAG protein (Soupene et al., 2002) (Figure 8). Forward primer RH1–HIII/5’ was paired with each of the reverse primers RH–XbaI/3′, RH–XbaI/3′Ex7, and RH–XbaI/3′Ex10 for the various segments of RH1. Forward primer RH1–HIII/5′c was paired with reverse primer RH1–XbaI/3′Ex12 for intact RH1 (Figure 1). PCR of RH1 segments was performed using the Expand Long Template PCR System (Roche) in a 100-μl reaction mixture containing: genomic DNA from wild-type strain CC-125 (90 ng); primers (300 nM of each); dNTPs (500 μM of each); DMSO (5%); MgCl2 (2.75 mM); and proof-reading Expand Taq polymerase (3.75 units). Amplification conditions were: 2 min at 95°C; 30 cycles of amplification (denaturation for 30 s at 94°C/annealing for 1 min at 55°C/elongation for 7 min at 68°C; and 10 min at 68°C). The only changes for PCR amplification of intact RH1 were: 150 ng genomic DNA; 3.5 mM MgCl2; 4.75 units polymerase; and annealing at 65°C. Constructs in pSP124s were then transformed into strain 4A+ or strain lts1-204 that had been treated with autolysin as described previously (Soupene et al., 2004). They were transformed by a modified version of the glass bead method (Kindle, 1990). Polyethylene glycol was added during the transformation and was vortexed together with the plasmid and cells for 20 s. The cells were then grown out in TAP/NH4Cl and subsequently concentrated and plated with selection for zeocin-resistance as described (Soupene et al., 2004). Plates were incubated in the light for 4A+ or the dark for lts1-204 for 4 weeks before transformants were picked. Although we observed some green colonies for lts1-204 on transformation plates, these were obtained even when pSP124s, which did not carry GFP fusion inserts, was used. Green transformant colonies did not fluoresce and hence appeared to be accumulating more chlorophyll than lts1-204.

Although we obtained the correct sequences when portions of RH1 were fused to GFP, we were unable to do so when intact RH1 was fused to GFP. (We checked 17 sequences.) In the latter case, we chose three variants that had the fewest changes and those likely to be least damaging. Variant 1 carried one change in the 5′-UT, one change in an intron, and two silent changes in exons 2 and 12 (four changes total); variant 2 carried four changes in the 5′-UT and three changes in introns (seven changes total); variant 3 carried two changes in the 5′-UT, three changes in introns, and one change in exon 5, changing an isoleucine to a threonine (six changes total; Table 6).

Table 6.

Variants of Intact RH1–GFP Fusion.

Varianta Plasmid Position and nucleotide changeb
5′-UT Exon Intron
1 pJES –140 A→G 323 G→A 297 A→G
1563 3398 A→G
2 pJES –1421 C→G
1566 –1399 G→A 257 T→C
–1260 T→C 2036 T→C
–553 A→G 3134 T→C
3 pJES –1179 A→G 1108 T→Cc 112 T→C
1567 –398 G→A 136 T→C
267 T→G
a

The E. coli strains carrying pSP–RH1–GFP for the three variants are NCM4221, NCM4213, and NCM4224, respectively, and the three transformants of lts1-204 carrying variant 2 are CR505 (2a), CR507 (2b), and CR508 (2c).

b

+1 is A of the starting ATG.

c

Ile→Thr.

Constructs for Testing Rh1-Directed Import into Pea Chloroplasts

A clone carrying the cDNA for Rh1 (Genbank accession number AY013257) in pBluescript KS (Cr.Rhp) was obtained from Cheng-Han Huang (Lindsley F. Kimball Research Institute, New York Blood Center, New York City) and was used for PCR amplification of cDNA. The cDNA coding for Rh1 was amplified with forward primer RH1–ATG and reverse primer RH1–TAG. The coding region plus a 1.4-kb region of the 3′-UT was excised from the original pBluescript plasmid and both were cloned into the EcoRV site of pGEM-T Easy (Promega). The cDNA coding for fragments of Rh1 ending after predicted transmembrane spanning segments 5 or 6 was amplified with forward primer RH1–ATG and reverse primers ‘LOOP 5’ or ‘LOOP 6’, respectively (Tables 5 and 7; Figure 8, L5 and L6). PCR products were cloned into pGEM-T Easy and constructs in which Rh1 cDNA was transcribed from the SP6 promoter were chosen. For fusions of putative chloroplast targeting sequences from Rh1 to mature SSU (mSSU) from pea, two segments of cDNA encoding N-terminal regions of Rh1 were amplified using primer A and primers B (fragment of 132 nucleotides) and C (fragment of 315 nucleotides) (Table 7 and Figure 8, a and b). PCR products were cloned into pGEM-T Easy and then excised with NcoI and SphI. They were cloned into the corresponding sites of pET–prSSU (Inoue et al., 2001) to fuse N-terminal codons of Rh1 to coding sequence for mature pea SSU from which N-terminal chloroplast targeting sequences had been deleted. cDNA for mSSU was amplified from pET–prSSU using primers mSSU–ATG and mSSU–TGA1 and cloned into pGEM-T Easy. The resultant protein was used as a negative control for chloroplast import. All constructs were transformed into DH5α (Invitrogen) and maintained on Luria broth supplemented with ampicillin and 0.2% glucose. When expressed from high copy number vectors such as pBluescript and pGEM-T Easy, Rh1 appears to be toxic to host cells, which grow worse without supplemental glucose. The correctness of all constructs was confirmed by sequencing.

Table 7.

Constructs for Chloroplast Import.

Rh1 cDNA Vectora Promoter Plasmid Strain
Intact pGEM-T Easy + RH1 coding T7 pJES 1526 NCM4136
pGEM-T Easy + RH1 coding + 3′-UT
pBluescript + RH1 coding + 3′-UTb T3 pKSAV 395002 NCM3847
1→Loop5 pGEM-T Easy + RH(1-Loop5) SP6 pJES 1536 NCM4331
1→Loop6 pGEM-T Easy + RH(1-Loop6) SP6 pJES 1537 NCM4332
1→44–SSU pETmSSU + RH(1–44) T7 pJES 1533 NCM4330
1→105–SSU pETmSSU + RH(1–105) T7 pJES 1535 NCM4342
mSSU pGEM-T Easy + mSSU SP6 pJES 1540 NCM4491
a

For in-vitro transcription/translation.

b

From C.-H. Huang (Lindsley F. Kimball Research Institute, New York Blood Center, New York City).

Fluorescence Microscopy

Zeocin-resistant transformants potentially carrying GFP fusion constructs were first screened for detectable GFP fluorescence with a Zeiss Axiophot epifluorescence microscope with a Zeiss Fluar 40X objective. Transformants that showed Rh1–GFP fluorescence in preliminary tests were then examined further by confocal microscopy on a Zeiss 510 Meta confocal laser scanning microscope (Carl Zeiss, Oberkochen, Germany; CNR Biological Imaging Facility, UC Berkeley). To assure that we were studying live cells, we photographed only flagellated cells that had been observed to move as they were immobilized in warm agar (20 μl cells + 20 μl low-melting-point agar at 40°C). They were observed through a Zeiss Plan-Geofluar 40X/1.35 oil immersion or a Zeiss Plan-APO chromat 100X/1.40 Oil DIC objective and were photographed through the latter. GFP fluorescence was excited using a 488-nm Argon laser with a 505–550-nm barrier filter before the photomultiplier tube (PMT) detector. Chlorophyll fluorescence was excited using a 543-nm Helium Neon laser with a 560-nm Long pass filter before the PMT. To resolve the closely related spectra of GFP fluorescence in transformants from chlorophyll autofluorescence, we first obtained reference spectra by taking lambda scans of strains 4A+, lts1-204, and Ble–GFP. These were used in linear unmixing of lambda scans from transformants. Differential interference (DIC) images were obtained using a 488-nm source and the transmitted light detector. Images were analyzed using Zeiss 510 meta software.

For cytoplasmic membrane staining, FM4-64 (Molecular Probes, Inc.) was diluted to 17 μM final concentration from a stock solution of 82 μM in Hanks balanced salt solution (Molecular Probes) and the cells were viewed immediately. For mitochondrial staining, MitoTracker Orange CMTMRos (Molecular Probes, Inc.) was diluted to 300 nM and cells were incubated at room temperature for 15–40 min. They were then pelleted by centrifugation and re-suspended in fresh medium. Stained cells were mixed with low-melting-point agar and viewed. Excitation was as for chlorophyll.

Chloroplast Import

Precursor proteins were synthesized from the cDNA constructs described above using either T7 or SP6 RNA polymerase in a coupled transcription–translation system from wheat germ or rabbit reticulocytes (Promega, Madison, WI). They were labeled with [35S]methionine. Chloroplasts were isolated from 9–12-day-old pea seedlings as described (Bruce et al., 1994), and the import assay and subsequent fractionation and protease treatments were done as described by Inoue et al. (2006).

SUPPLEMENTARY DATA

Supplementary Data are available at Molecular Plant Online.

FUNDING

This work was funded by a National Institutes of Health grant (GM38361 to S.K.) and a grant from the Torrey Mesa Research Institute, Syngenta Research and Technology, La Jolla, California (S.K.). No conflict of interest declared.

Supplementary Material

[Supplementary Data]
ssn074_index.html (780B, html)

References

  1. Agre P, Cartron JP. Molecular biology of the Rh antigens. Blood. 1991;78:551–563. [PubMed] [Google Scholar]
  2. Amico M, et al. PONGO: a web server for multiple predictions of all-alpha transmembrane proteins. Nucleic Acids Res. 2006;34:W169–W172. doi: 10.1093/nar/gkl208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Andrade SL, Dickmanns A, Ficner R, Einsle O. Crystal structure of the archaeal ammonium transporter Amt-1 from Archaeoglobus fulgidus. Proc. Natl Acad. Sci. U S A. 2005;102:14994–14999. doi: 10.1073/pnas.0506254102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Avent ND, Butcher SK, Liu W, Mawby WJ, Mallinson G, Parsons SF, Anstee DJ, Tanner MJ. Localization of the C termini of the Rh (rhesus) polypeptides to the cytoplasmic face of the human erythrocyte membrane. J. Biol. Chem. 1992;267:15134–15139. [PubMed] [Google Scholar]
  5. Bannai H, Tamada Y, Maruyama O, Nakai K, Miyano S. Extensive feature detection of N-terminal protein sorting signals. Bioinformatics. 2002;18:298–305. doi: 10.1093/bioinformatics/18.2.298. [DOI] [PubMed] [Google Scholar]
  6. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 2004;340:783–795. doi: 10.1016/j.jmb.2004.05.028. [DOI] [PubMed] [Google Scholar]
  7. Benghezal M, Gotthardt D, Cornillon S, Cosson P. Localization of the Rh50-like protein to the contractile vacuole in Dictyostelium. Immunogenetics. 2001;52:284–288. doi: 10.1007/s002510000279. [DOI] [PubMed] [Google Scholar]
  8. Bhasin M, Raghava GPS. ESLpred: SVM-based method for subcellular localization of eukaryotic proteins using dipeptide composition and PSI_BLAST. Nucleic Acids Res. 2004;32:W414–W419. doi: 10.1093/nar/gkh350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bloodgood RA, Woodward MP, Salomonsky NL. Redistribution and shedding of flagellar membrane glycoproteins visualized using an anti-carbohydrate monoclonal antibody and concanavalin A. J. Cell Biol. 1986;102:1797–1812. doi: 10.1083/jcb.102.5.1797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bruce BD, Perry S, Froehlich J, Keegstra K. In vitro import of proteins into chloroplasts. Plant Mol. Biol. Manual. 1994;J1:1–15. [Google Scholar]
  11. Chou K-C, Shen H-B. Large-scale plant protein subcellular location prediction. J. Cell. Biochem. 2006;100:665–678. doi: 10.1002/jcb.21096. [DOI] [PubMed] [Google Scholar]
  12. Cline K, Henry R. Import and routing of nucleus-encoded chloroplast proteins. Annu. Rev. Cell Dev. Biol. 1996;12:1–26. doi: 10.1146/annurev.cellbio.12.1.1. [DOI] [PubMed] [Google Scholar]
  13. Cserzö M, Wallin E, Simon I, von Heijne G, Elofsson A. Prediction of transmembrane alpha-helices in prokaryotic membrane proteins: the dense alignment surface method. Protein Eng. 1997;10:673–676. doi: 10.1093/protein/10.6.673. [DOI] [PubMed] [Google Scholar]
  14. Eichinger L, et al. The genome of the social amoeba Dictyostelium discoideum. Nature. 2005;435:43–57. doi: 10.1038/nature03481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Eisen JA, et al. Macronuclear genome sequence of the ciliate Tetrahymena thermophila, a model eukaryote. PLoS Biol. 2006;4:e286. doi: 10.1371/journal.pbio.0040286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Emanuelsson O, Nielsen H, von Heijne G. ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites. Protein Sci. 1999;8:978–984. doi: 10.1110/ps.8.5.978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Emanuelsson O, Nielsen H, Brunak S, von Heijne G. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 2000;300:1005–1016. doi: 10.1006/jmbi.2000.3903. [DOI] [PubMed] [Google Scholar]
  18. Endeward V, Cartron JP, Ripoche P, Gros G. Red cell membrane CO2 permeability in normal human blood and in blood deficient in various blood groups, and effect of DIDS. Transfus. Clin. Biol. 2006;13:123–127. doi: 10.1016/j.tracli.2006.02.007. [DOI] [PubMed] [Google Scholar]
  19. Endeward V, Cartron JP, Ripoche P, Gros G. RhAG protein of the Rhesus complex is a CO2 channel in the human red cell membrane. FASEB J. 2008;22:1–11. doi: 10.1096/fj.07-9097com. [DOI] [PubMed] [Google Scholar]
  20. Eyers SA, Ridgwell K, Mawby WJ, Tanner MJ. Topology and organization of human Rh (rhesus) blood group-related polypeptides. J. Biol. Chem. 1994;269:6417–6423. [PubMed] [Google Scholar]
  21. Fong RN, Kim K-S, Yoshihara C, Inwood W, Kustu S. The W148L substitution in the Escherichia coli ammonium channel AmtB increases flux and indicates that the substrate is an ion. Proc. Natl Acad. Sci. U S A. 2007;104:18706–18711. doi: 10.1073/pnas.0709267104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Franzén LG, Rochaix JD, von Heijne G. Chloroplast transit peptides from the green alga Chlamydomonas reinhardtii share features with both mitochondrial and higher plant chloroplast presequences. FEBS Lett. 1990;260:165–168. doi: 10.1016/0014-5793(90)80094-y. [DOI] [PubMed] [Google Scholar]
  23. Fuhrmann M, Oertel W, Hegemann P. A synthetic gene coding for the green fluorescent protein (GFP) is a versatile reporter in Chlamydomonas reinhardtii. Plant J. 1999;19:353–361. doi: 10.1046/j.1365-313x.1999.00526.x. [DOI] [PubMed] [Google Scholar]
  24. Garg A, Bhasin M, Raghava GPS. Support vector machine-based method for subcellular localization of human proteins using amino acid compositions, their order, and similarity search. J. Biol. Chem. 2005;280:14427–14432. doi: 10.1074/jbc.M411789200. [DOI] [PubMed] [Google Scholar]
  25. Gómez SM, Bil’ KY, Aguilera R, Nishio JN, Faull KF, Whitelegge JP. Transit peptide cleavage sites of integral thylakoid membrane proteins. Mol. Cell. Proteomics. 2003;2:1068–1085. doi: 10.1074/mcp.M300062-MCP200. [DOI] [PubMed] [Google Scholar]
  26. Guda C. pTARGET: a web server for predicting protein subcellular localization. Nucleic Acids Res. 2006;34:W210–W213. doi: 10.1093/nar/gkl093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Harris E. The Chlamydomonas Sourcebook (New York: Academic Press) 1989 [Google Scholar]
  28. Hawkins J, Bodén M. Detecting and sorting targeting peptides with neutral networks and support vector machines. J. Bioinform. Comput. Biol. 2006;4:1–18. doi: 10.1142/s0219720006001771. [DOI] [PubMed] [Google Scholar]
  29. Herrin DL, Battey JF, Greer K, Schmidt GW. Regulation of chlorophyll apoprotein expression and accumulation: requirements for carotenoids and chlorophyll. J. Biol. Chem. 1992;267:8260–8269. [PubMed] [Google Scholar]
  30. Hofmann K, Stoffel W. TMbase: a database of membrane spanning protein segments. Biol. Chem. Hoppe-Seyler. 1993;374 [Google Scholar]
  31. Hua S, Sun Z. Support vector machine approach for protein subcellular localization prediction. Bioinformatics. 2001;17:721–728. doi: 10.1093/bioinformatics/17.8.721. [DOI] [PubMed] [Google Scholar]
  32. Huang C-H. Molecular insights into the Rh protein family and associated antigens. Curr. Opin. Hematol. 1997;4:94–103. doi: 10.1097/00062752-199704020-00004. [DOI] [PubMed] [Google Scholar]
  33. Huang C-H, Liu PZ. New Insights into the Rh superfamily of genes and proteins in erythroid cells and nonerythroid tissues. Blood Cells Mol. Dis. 2001;27:90–101. doi: 10.1006/bcmd.2000.0355. [DOI] [PubMed] [Google Scholar]
  34. Huang C-H, Peng J. Evolutionary conservation and diversification of Rh family genes and proteins. Proc. Natl Acad. Sci. U S A. 2005;102:15512–15517. doi: 10.1073/pnas.0507886102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Inoue K, Demel R, de Kruijff B, Keegstra K. The N-terminal portion of the preToc75 transit peptide interacts with membrane lipids and inhibits binding and import of precursor proteins into isolated chloroplasts. Eur. J. Biochem. 2001;268:4036–4043. doi: 10.1046/j.1432-1327.2001.02316.x. [DOI] [PubMed] [Google Scholar]
  36. Inoue K, Furbee KJ, Uratsu S, Kato M, Dandekar AM, Ikoma Y. Catalytic activities and chloroplast import of cartenogenic enzymes from citrus. Physiol. Plant. 2006;127:561–570. [Google Scholar]
  37. Inwood W, Yoshihara C, Zalpuri R, Kim K-S, Kustu S. The ultrastructure of a Chlamydomonas reinhardtii mutant strain lacking phytoene synthase resembles that of a colorless alga. Mol. Plant. 2008 doi: 10.1093/mp/ssn046. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Ji Q, Hashmi S, Liu Z, Zhang J, Chen Y, Huang C-H. CeRh1 (rhr-1) is a dominant Rhesus gene essential for embryonic development and hypodermal function in Caenorhabditis elegans. Proc. Natl Acad. Sci. U S A. 2006;103:5881–5886. doi: 10.1073/pnas.0600901103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Jia P, Qian Z, Zeng Z, Cai Y, Li Y. Prediction of subcellular protein localization based on functional domain composition. Biochem. Biophys. Res. Commun. 2007;357:366–370. doi: 10.1016/j.bbrc.2007.03.139. [DOI] [PubMed] [Google Scholar]
  40. Jones DT. Improving the accuracy of transmembrane protein topology prediction using evolutionary information. Bioinformatics. 2007;23:538–544. doi: 10.1093/bioinformatics/btl677. [DOI] [PubMed] [Google Scholar]
  41. Kalanon M, McFadden GI. The chloroplast protein translocation complexes of Chlamydomonas reinhardtii: a bioinformatic comparison of Toc and Tic components in plants, green algae and red algae. Genetics. 2008;179:95–112. doi: 10.1534/genetics.107.085704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Khademi S, O'Connell J, III, Remis J, Robles-Colmenares Y, Miercke LJ, Stroud RM. Mechanism of ammonia transport by Amt/MEP/Rh: structure of AmtB at 1.35Å. Science. 2004;305:1587–1594. doi: 10.1126/science.1101952. [DOI] [PubMed] [Google Scholar]
  43. Kim K-S, Feild E, King N, Yaoi T, Kustu S, Inwood W. Spontaneous mutations in the ammonium transport gene AMT4 of Chlamydomonas reinhardtii. Genetics. 2005;170:631–644. doi: 10.1534/genetics.105.041574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Kim K-S, Kustu S, Inwood W. Natural history of transposition in the green alga Chlamydomonas reinhardtii: use of the AMT4 locus as an experimental system. Genetics. 2006;173:2005–2019. doi: 10.1534/genetics.106.058263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Kindle KL. High-frequency nuclear transformation of Chlamydomonas reinhardtii. Proc. Natl Acad. Sci. U S A. 1990;87:1228–1232. doi: 10.1073/pnas.87.3.1228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Li X, Jayachandran S, Nguyen H-H, Chan MK. Structure of the Nitrosomonas europaea Rh protein. Proc. Natl Acad. Sci. U S A. 2007;104:19279–19284. doi: 10.1073/pnas.0709710104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Liu Z, Chen Y, Mo R, Hui C-C, Cheng J-F, Mohandas N, Huang C-H. Characterization of human RhCG and mouse Rhcg as novel nonerythroid Rh glycoprotein homologues predominantly expressed in kidney and testis. J. Biol. Chem. 2000;275:25641–25651. doi: 10.1074/jbc.M003353200. [DOI] [PubMed] [Google Scholar]
  48. Lupo D, Li X-D, Durand A, Tomizaki T, Cherif-Zahar B, Matassi G, Merrick M. The 1.3-Å resolution structure of Nitrosomonas europaea Rh50 and mechanistic implications for NH3 transport by Rhesus family proteins. Proc. Natl Acad. Sci. U S A. 2007;104:19303–19308. doi: 10.1073/pnas.0706563104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Marini AM, Urrestarazu A, Beauwens R, André B. The Rh (Rhesus) blood group polypeptides are related to NH4+ transporters. Trends Biochem. Sci. 1997;22:460–461. doi: 10.1016/s0968-0004(97)01132-8. [DOI] [PubMed] [Google Scholar]
  50. Matsuda S, Vert J-P, Saigo H, Ueda N, Toh H, Akutsu T. A novel representation of protein sequences for prediction of subcellular location using support vector machines. Protein Sci. 2005;14:2804–2813. doi: 10.1110/ps.051597405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. McCarthy SS, Kobayashi MC, Niyogi KK. White mutants of Chlamydomonas reinhardtii are defective in phytoenesynthase. Genetics. 2004;168:1249–1257. doi: 10.1534/genetics.104.030635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Mercanti V, Blanc C, Lefkir Y, Cosson P, Letourneur F. Acidic clusters target transmembrane proteins to the contractile vacuole in Dictyostellium cells. J. Cell Biol. 2006;119:837–845. doi: 10.1242/jcs.02808. [DOI] [PubMed] [Google Scholar]
  53. Merchant SS, et al. The Chlamydomonas genome reveals the evolution of key animal and plant functions. Science. 2007;318:245–250. doi: 10.1126/science.1143609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Mishkind ML, Wessler SR, Schmidt GW. Functional determinants in transit sequences: import and partial maturation by vascular plany chloroplasts of the ribulose-1,5-bisphosphate carboxylase small subunit of Chlamydomonas. J. Cell Biol. 1985;100:226–234. doi: 10.1083/jcb.100.1.226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Nair R, Rost B. Mimicking cellular sorting improves prediction of subcellular localization. J. Mol. Biol. 2005;348:85–100. doi: 10.1016/j.jmb.2005.02.025. [DOI] [PubMed] [Google Scholar]
  56. Nakai K, Kanehisa M. Expert system for predicting protein localization sites in gram-negative bacteria. Proteins. 1991;11:95–110. doi: 10.1002/prot.340110203. [DOI] [PubMed] [Google Scholar]
  57. Pao SS, Paulsen IT, Saier MH., Jr Major facilitator superfamily. Microbiol. Mol. Biol. Rev. 1998;62:1–34. doi: 10.1128/mmbr.62.1.1-34.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Pierleoni A, Martelli PL, Fariselli P, Casadio R. BaCelLo: a balanced subcellular localization predictor. Bioinformatics. 2006;22:e408–e416. doi: 10.1093/bioinformatics/btl222. [DOI] [PubMed] [Google Scholar]
  59. Risinger AL, Cain NE, Chen EJ, Kaiser CA. Activity-dependent reversible inactivation of the general amino acid permease. Mol. Biol. Cell. 2006;17:4411–4419. doi: 10.1091/mbc.E06-06-0506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Risinger AL, Kaiser CA. Different ubiquitin signals act at the Golgi and plasma membrance to direct GAP1 trafficking. Mol. Biol. Cell. 2008 doi: 10.1091/mbc.E07-06-0627. Published online ahead of print. PMID: 18434603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Saier MH., Jr Tracing pathways of transport protein evolution. Mol. Microbiol. 2003;48:1145–1156. doi: 10.1046/j.1365-2958.2003.03499.x. [DOI] [PubMed] [Google Scholar]
  62. Schein AI, Kissinger JC, Ungar LH. Chloroplast transit peptide prediction: a peek inside the black box. Nucleic Acids Res. 2001;29:e82. doi: 10.1093/nar/29.16.e82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Seack J, Pancer Z, Müller IM, Müller WE. Molecular cloning and primary structure of a Rhesus (Rh)-like protein from the marine sponge Geodia cydonium. Immunogenetics. 1997;46:493–498. doi: 10.1007/s002510050310. [DOI] [PubMed] [Google Scholar]
  64. Shatkay H, Höglund A, Brady S, Blum T, Dönnes P, Kohlbacher O. SherLoc: high-accuracy prediction of protein subcellular localization by integrating text and protein sequence data. Bioinformatics. 2007;23:1410–1417. doi: 10.1093/bioinformatics/btm115. [DOI] [PubMed] [Google Scholar]
  65. Shaw AS, Rottier PJ, Rose JK. Evidence for the loop model of signal-sequence insertion into the endoplasmic reticulum. Proc. Natl Acad. Sci. U S A. 1988;85:7592–7596. doi: 10.1073/pnas.85.20.7592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Small I, Peeters N, Legeai F, Lurin C. Predotar: a tool for rapidly screening proteomes for N-terminal targeting sequences. Proteomics. 2004;4:1581–1590. doi: 10.1002/pmic.200300776. [DOI] [PubMed] [Google Scholar]
  67. Soupene E, Inwood W, Kustu S. Lack of the Rhesus protein Rh1 impairs growth of the green alga Chlamydomonas reinhardtii at high CO2. Proc. Natl Acad. Sci. U S A. 2004;101:7787–7792. doi: 10.1073/pnas.0401809101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Soupene E, King N, Feild E, Liu P, Niyogi KK, Huang C-H, Kustu S. Rhesus expression in a green alga is regulated by CO2. Proc. Natl Acad. Sci. U S A. 2002;99:7769–7773. doi: 10.1073/pnas.112225599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Tamura T, Akutsu T. Subcellular location prediction of proteins using support vector machines with alignment of block sequences utilizing amino acid composition. BMC Bioinformatics. 2007;8:466. doi: 10.1186/1471-2105-8-466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Tantoso E, Li K-B. AAIndexLoc: predicting subcellular localization of proteins based on a new representation of sequences using amino acid indices. Amino Acids. 2007 doi: 10.1007/s00726-007-0616-y. Published online before print, Friday, 28 December 2007. [DOI] [PubMed] [Google Scholar]
  71. Thomas GH, Mullins JG, Merrick M. Membrane topology of the Mep/Amt family of ammonium transporters. Mol. Microbiol. 2000;37:331–344. doi: 10.1046/j.1365-2958.2000.01994.x. [DOI] [PubMed] [Google Scholar]
  72. Thornton J, Blakey D, Scanlon E, Merrick M. The ammonia channel protein AmtB from Escherichia coli is a polytopic membrane with a cleavable signal peptide. FEMS Microbiol. Lett. 2006;258:114–120. doi: 10.1111/j.1574-6968.2006.00202.x. [DOI] [PubMed] [Google Scholar]
  73. Tusnády GE, Simon I. Principles governing amino acid composition of integral membrane proteins: application to topology prediction. J. Mol. Biol. 1998;283:489–506. doi: 10.1006/jmbi.1998.2107. [DOI] [PubMed] [Google Scholar]
  74. Weiner ID, Miller RT, Verlander JW. Localization of the ammonium transporters, Rh B glycoprotein and Rh C glycoprotein in the mouse liver. Gastroenterol. 2003;124:1432–1440. doi: 10.1016/s0016-5085(03)00277-4. [DOI] [PubMed] [Google Scholar]
  75. Yu C-S, Chen Y-C, Lu C-H, Hwang J-K. Prediction of protein subcellular localization. Proteins. 2006;64:643–651. doi: 10.1002/prot.21018. [DOI] [PubMed] [Google Scholar]
  76. Zheng L, Kostrewa D, Bernèche S, Winkler FK, Li XD. The mechanism of ammonia transport based on the crystal structure of AmtB of Escherichia coli. Proc. Natl Acad. Sci. U S A. 2004;101:17090–17095. doi: 10.1073/pnas.0406475101. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplementary Data]
ssn074_index.html (780B, html)

Articles from Molecular Plant are provided here courtesy of Oxford University Press

RESOURCES