Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2010 Apr 21;84(13):6308–6317. doi: 10.1128/JVI.00321-10

Productive Infection and bICP0 Early Promoter Activity of Bovine Herpesvirus 1 Are Stimulated by E2F1▿

Aspen Workman 2,3, Clinton Jones 1,2,3,*
PMCID: PMC2903271  PMID: 20410283

Abstract

Bovine herpesvirus 1 (BoHV-1) is an important viral pathogen of cattle. Like other members of the subfamily Alphaherpesvirinae, BoHV-1 establishes latency in sensory neurons and has the potential to reactivate from latency. Dexamethasone (DEX) treatment of latently infected calves or rabbits consistently leads to reactivation from latency. The BoHV-1 transcript encoding the infected cell protein 0 (bICP0) is consistently detected during reactivation from latency, in part because the bICP0 early promoter is activated by DEX. During DEX-induced reactivation from latency, cyclin expression is stimulated in infected sensory neurons. Cyclin-dependent kinase activity phosphorylates Rb (retinoblastoma tumor suppressor gene product) family proteins and consequently releases the E2F family of transcription factors, suggesting that E2F family members stimulate productive infection and/or reactivation from latency. In this study, we provide evidence that repression of E2F1 by a specific small interfering RNA (siRNA) reduced productive infection approximately 5-fold. E2F1 or E2F2 stimulated bICP0 early promoter activity at least 100-fold in transient transfection assays. Two E2F-responsive regions (ERR) were identified within the early promoter, with one adjacent to the TATA box (ERR1) and one approximately 600 bp upstream from the TATA box (ERR2). Mobility shift assays suggested that E2F interacts with ERR1 and ERR2. E2F1 protein levels were increased at late times after infection, which correlated with enhanced binding to a consensus E2F binding site, ERR1, or ERR2. Collectively, these studies suggest that E2F1 stimulates productive infection and bICP0 early promoter activity, in part because E2F family members interact with ERR1 and ERR2.


Bovine herpesvirus 1 (BoHV-1) is a significant viral pathogen of cattle that can cause conjunctivitis, rhinotracheitis, pneumonia, genital disorders, or abortions. BoHV-1 also initiates shipping fever, a potentially fatal polymicrobial disease (37). Like other members of the Alphaherpesvirinae subfamily, BoHV-1 establishes lifelong latency in trigeminal ganglionic neurons following acute replication in mucosal epithelium. Reactivation from latency occurs periodically, resulting in virus shedding and spread to susceptible cattle. Reactivation from latency can occur after stress or corticosteroid treatment, which mimics stress (30, 34). Dexamethasone (DEX), a synthetic corticosteroid, reproducibly induces expression of BoHV-1 lytic cycle genes and reactivation from latency in calves or rabbits (15, 17-20, 30).

During productive infection of cultured cells, viral gene expression is temporally regulated in three distinct phases: the immediate-early (IE), early (E), and late (L) phases (reviewed in references 17 and 18). IE gene expression is stimulated by a virion component, bTIF, which interacts with a cellular transcription factor (Oct-1) to transactivate IE gene expression (22, 23). Two IE transcription units exist, namely, IE transcription unit 1 (IEtu1) and IEtu2 (44-46). IEtu1 encodes functional homologues of two herpes simplex virus type 1 (HSV-1) proteins, ICP0 and ICP4. IEtu2 encodes a protein that is similar to the HSV-1 IE gene product ICP22 (33). BoHV-1-encoded ICP0 (bICP0) is translated from an IE (IE2.9) or E (E2.6) mRNA, since an IE promoter (IEtu1 promoter) and an E promoter regulate bICP0 RNA expression (7, 44-46). The IE promoter regulates IE expression of bICP4 and bICP0. Expression of the bICP4 protein represses IEtu1 promoter activity, whereas bICP0 activates its own E promoter and all other viral promoters. A recent study demonstrated that during DEX-induced reactivation from latency, bICP0 mRNA, but not bICP4 mRNA, was consistently detected (47). In part, this was due to the fact that the bICP0 early promoter is activated by DEX induction of the cellular transcription factor CAAT-enhancer binding protein alpha (C/EBP-alpha) (47). bICP0 transcription appears to be stimulated during reactivation from latency by cellular transcription factors that transactivate the bICP0 E promoter. Since bICP0 is the major regulatory protein that stimulates productive BoHV-1 infection (7, 44-46), the identification of cellular factors that stimulate the bICP0 E promoter may help us to understand the early stages of reactivation from latency.

Members of the E2F family of transcription factors contain a conserved DNA-binding domain, an acidic transcriptional activation domain, and an Rb binding site (13). Functional E2F binding sites are present in the promoters of nearly all genes that control cell cycle progression (3, 24, 27, 32, 41). Several lines of evidence suggest that the E2F family of transcription factors may stimulate productive BoHV-1 infection and reactivation from latency. First, during DEX-induced reactivation from latency, sensory neurons that express abundant levels of lytic cycle genes also express certain cyclins (for example, cyclin E and cyclin A) (43). Phosphorylation of Rb family members by cyclin-dependent kinase-cyclin complexes leads to E2F release, and consequently, certain E2F family members are then able to activate transcription (2, 13, 24, 40). Furthermore, overexpression of E2F4 stimulates productive BoHV-1 infection and E2F1 or E2F2 transactivates IEtu1 promoter activity (9). Finally, the HSV-1 thymidine kinase (TK) promoter is activated by E2F1 by virtue of a GC-rich motif, not a consensus E2F binding site (35).

In this study, we demonstrated that small interfering RNAs (siRNAs) directed against E2F1 reduced productive infection. In transient transfection assays, E2F1 or E2F2 activated bICP0 E promoter activity >100-fold. Two E2F-responsive regions (ERRs) were identified within the bICP0 E promoter. These studies suggest that E2F1 and E2F2 stimulate productive infection, in part by activating bICP0 E promoter activity.

MATERIALS AND METHODS

Cells and viruses.

Murine neuroblastoma 2A (neuro-2A) and rabbit skin (RS) cells were grown in Earle's modified Eagle's medium (EMEM) supplemented with 5% fetal calf serum (FCS). Bovine kidney cells (CRIB cells) were grown in EMEM supplemented with 10% FCS. All media contained penicillin (10 U/ml) and streptomycin (100 μg/ml).

The Cooper strain of BoHV-1 (wild-type [wt] virus) was obtained from the National Veterinary Services Laboratory, Animal and Plant Health Inspection Services, Ames, IA. Stock cultures of BoHV-1 were prepared in CRIB cells.

A BoHV-1 mutant containing the LacZ gene in place of the viral gC gene was obtained from S. Chowdury (Baton Rouge, LA) (gCblue virus). The virus grows to titers similar to those of the wild-type parent virus and expresses the LacZ gene as a true late gene.

Plasmids.

Plasmids expressing E2F1 and E2F2 (pCMV-E2F1 and pCMV-E2F2, respectively) were obtained from J. R. Nevins (Duke University, Durham, NC). The empty vector pcDNA3.1 was purchased from Invitrogen.

Six bICP0 E promoter constructs were prepared by PCR amplification as previously described (47). The promoter fragments were cloned into the promoterless vector pCAT-Basic (E1871; Promega) at the unique XhoI and KpnI sites to generate plasmids EP-943, EP-638, EP-172, EP-143, EP-133, and EP-71 (see Fig. 2C). EP-50 and EP-42 were synthesized (IDT, IA) to contain XhoI and KpnI restriction sites. Duplex oligonucleotides were digested with XhoI and KpnI and cloned into the promoterless vector pCAT-Basic. The numbers in the plasmid names refer to the length of the bICP0 E promoter fragment inserted into the chloramphenicol acetyltransferase (CAT) vector. The deletions were made from the 5′ terminus of the bICP0 promoter.

FIG. 2.

FIG. 2.

Schematics of IEtu1 and bICP0 E promoter constructs used in this study. (A) Locations of unique long (L) and unique short (S) regions of the BoHV-1 genome. The repeats are denoted by open rectangles. Genes encoding bICP0 and bICP4 are present within the repeats. (B) Positions of bICP4 and bICP0 transcripts are shown. The immediate-early transcription unit 1 (IEtu1) encodes bICP4 (IE/4.2) and bICP0 (IE/2.9) (45, 46). The IEtu1 promoter activates IE expression of IE/4.2 and IE/2.9 (denoted by a black rectangle). E/2.6 is the early transcript that encodes bICP0, and an early promoter activates expression of this transcript (44). Exon 2 (e2) of bICP0 contains all of the protein coding sequences of bICP0. The dashed lines are intron sequences. (C) bICP0 E promoter constructs were prepared as described in Materials and Methods. Positions of putative SP1 binding sites, E2F-like sites, and TATA boxes are shown. Neuro2-A cells were cotransfected with 1 μg of the designated bICP0 E promoter/CAT construct and 0.1 μg of E2F1 or E2F2 expression plasmid. DNA amounts were equalized for all transfections by using pcDNA3.1, a blank expression vector. At 48 h posttransfection, cells were collected and processed for CAT activity as described in Materials and Methods. The CAT activity of cells transfected with the control CAT vector was set to 1 for each experiment. All other values are expressed as fold activation with respect to the control. The results are the averages for three independent experiments. (D) Neuro-2A cells were transfected with 0.1 μg E2F1 (lane 2), 1 μg E2F1 (lane 3), 5 μg E2F1 (lane 4), or 10 μg E2F1 (lane 5). Lane 1 was not transfected with the E2F1 expression vector. Forty-eight hours after transfection, whole-cell lysate was prepared and 200 μg protein/lane was used for Western blot assays. Antisera directed against E2F1, cleaved caspase 3 (Cell Signaling), and β-actin were used for these studies.

Two additional bICP0 E promoter constructs were generated, using the wt BoHV-1 genome as a template and a common 3′ primer (5′-ctcgagCCTGCTGGGCGACACAAACAACAGA-3′) with the following 5′ primers: for EP-398, 5′-ggggtaccAAGACGCAGAACCCCG-3′ ; and for EP-328, 5′-ACCCAGGGGCGGAGC-3′ (lowercase letters indicate restriction sites). The promoter fragments were cloned into the promoterless vector pCAT-Basic as described above. The DNA sequences of the E promoter inserts were confirmed by DNA sequencing (Genomics Core Research Facility-UNL). All plasmids were prepared from bacterial cultures by alkaline lysis and two rounds of cesium chloride centrifugation.

To further localize bICP0 E promoter elements that are responsive to E2F, upstream regions of the bICP0 E promoter (ERRs) were cloned into a minimal-promoter CAT vector (E186A; Promega) containing the simian virus 40 (SV40) early promoter cloned upstream of CAT.

ERR1 constructs.

ERR1/40 was created using synthesized duplex sequences (IDT, IA). Duplex oligonucleotides were digested with XhoI and KpnI and cloned into the minimal-promoter CAT vector.

ERR2 constructs.

ERR2/254 was generated by a PCR using the forward primer 5′-GCGACGGCGGCAATAAAGACGAGT-3′ and the reverse primer 5′-CGGGGTTCTGCGTCTTGGC-3′. ERR2/180, ERR2/120, ERR2/1-60, and ERR2/61-120 were created using synthesized duplex sequences (IDT, IA). Duplex oligonucleotides were digested with KpnI and XhoI and cloned into the minimal-promoter CAT vector at the unique KpnI and XhoI sites. The identity of each construct was confirmed by DNA sequencing (Genomics Core Research Facility-UNL). Schematics of the ERR1 and ERR2 constructs are shown in Fig. 4 and 5, respectively. All plasmids were prepared from bacterial cultures by alkaline lysis and two rounds of cesium chloride centrifugation.

FIG. 4.

FIG. 4.

Localization of ERR1 within the bICP0 E promoter. (A) Schematic of the bICP0 E promoter and the positions of EP-133 and EP-71. A 40-nucleotide fragment that spans EP-133 and EP-71 was synthesized and cloned upstream of the SV40 E promoter (ERR1/40). (B) Neuro-2A cells were cotransfected with 1 μg of the designated fragment of the bICP0 E promoter cloned upstream of the SV40 minimal-promoter CAT vector (ERR1/40) and with 1 μg of the E2F1 expression plasmid. At 48 h posttransfection, cells were collected and processed for CAT activity as described in Materials and Methods. The CAT activity of cells transfected with the control CAT vector was set to 1. All other values are expressed as fold activation with respect to the control. The results constitute the averages for three independent experiments.

FIG. 5.

FIG. 5.

Localization of ERR2 within the bICP0 E promoter. (A) To localize sequences within ERR2 that are responsive to E2F1, bICP0 E promoter sequences were cloned into a minimal-promoter CAT vector containing an SV40 promoter cloned upstream of the CAT gene as described in Materials and Methods. (B) Neuro-2A cells were cotransfected with 1 μg of the designated fragment of the bICP0 E promoter cloned upstream of the SV40 minimal-promoter CAT vector and with 1 μg of E2F1. At 48 h posttransfection, cells were collected and processed for CAT activity as described in Materials and Methods. The CAT activity of cells transfected with the control CAT vector was set to 1. All other values are expressed as fold activation with respect to the control. Experiments constitute the averages for three independent experiments.

Measurement of CAT activity.

Neuro-2A cells grown in 60-mm dishes were cotransfected with the designated plasmids as indicated in the respective figure legends. Neuro-2A cells were transfected with NeuroTransIt (MIR2145; Mirus) according to the manufacturer's instructions. After 48 h, cell extract was prepared by three freeze-thaw cycles in 0.25 M Tris-HCl, pH 7.4. Cell debris was pelleted by centrifugation, and protein concentrations were determined. CAT activity was measured by incubating the extract with 0.1 μCi [14C]chloramphenicol (CFA754; Amersham Biosciences) and 0.5 mM acetyl-coenzyme A (acetyl-CoA) (A2181; Sigma). The reaction mixture was incubated at 37°C for 15 to 30 min. All forms of chloramphenicol were separated by thin-layer chromatography. CAT activity was quantified using a Bio-Rad FX molecular imager (Molecular Dynamics, CA). Levels of CAT activity are expressed as fold induction relative to the vector control.

Electrophoretic mobility shift assay (EMSA).

Neuro-2A cells were transfected with 100 ng of E2F1 by using NeuroTransIT (Mirus) according to the manufacturer's instructions. Forty-eight hours after transfection, whole-cell lysate was prepared. Cells were washed with phosphate-buffered saline (PBS) and suspended in NP-40 lysis buffer (100 mM Tris [pH 8.0], 1 mM EDTA, 100 mM NaCl, 1% NP-40, 1 mM phenylmethylsulfonyl fluoride, and one tablet of Complete protease inhibitor [Roche Molecular Biochemicals] per 10 ml). Cell lysate was incubated on ice for 30 min, sonicated, and then clarified by centrifugation at 10,000 × g at 4°C for 15 min.

CRIB cells were infected with wt BoHV-1 at a multiplicity of infection (MOI) of 5 and cultured in EMEM containing 10% FCS. At various times after infection, cells were collected and suspended in NP-40 lysis buffer. Cell lysate was incubated on ice for 30 min, sonicated, and then clarified by centrifugation at 10,000 × g at 4°C for 15 min. Protein concentrations were quantified by the Bradford assay.

Twenty micrograms of protein extract was incubated in 16 μl of binding buffer (10 mM Tris-HCl, pH 8, 150 mM KCl, 0.5 mM EDTA, 0.1% Triton X-100, 12.5% glycerol) in the presence of 1 μg poly(dI-dC) (P4929; Sigma) and 0.5 pmol of double-stranded DNA probe labeled with 10 μCi of [γ-32P]ATP. Incubation proceeded for 1 h at room temperature. For competition assays, 500 ng of cold E2F1 consensus probe or a C/EBP-alpha consensus probe was incubated with cell lysate for 20 min prior to addition of radiolabeled probe. DNA-protein complexes were run in a 5% polyacrylamide gel in 0.5× Tris-borate-EDTA (TBE) for 3 h at 100 V. To improve band resolution, 1 M sodium acetate, pH 5.3, was added to the lower buffer chamber during electrophoresis. The gel was exposed to a phosphorimager plate and analyzed using a Bio-Rad FX molecular imager. Probes used for EMSA were as follows: E2F consensus, ATTTAAGTTTCGCGCCCTTTCTCAA; C/EBP-alpha consensus, CGCAATATTGCGCAATATTGCAAT; 40-bp probe of bICP0 E promoter that was used to construct ERR1/40, CGGCGCCCTGCCCCCGCCCCGCCCCCCCGCCCTCGCGGCC; and probe of bICP0 E promoter (bp 1 to 60) that was used to construct ERR2/1-60, CCGGCGCGCGGCGCGCGGGGCGGGCCCCGGGGCGCGAAGCCCGGGAGGGACGCGGGCGTG.

SDS-PAGE and Western blotting of E2F expression.

RS cells were transfected with 1 μg of pcDNA3.1 empty vector or 100 mM E2F1 siRNA (sc-35247; Santa Cruz Biotechnology) or control siRNA (44-2926; Invitrogen) by use of Lipofectamine 2000 according to the manufacturer's specifications (Invitrogen). Block-iT-Fluorescent oligonucleotide was used as a control siRNA (44-2926; Invitrogen). This oligonucleotide is a fluorescently conjugated control containing a scrambled sequence that does not reduce the level of any known mammalian gene. Forty-eight hours after transfection, whole-cell lysate was prepared as previously described (47). Protein concentrations were quantified by the Bradford assay. Standard 12% SDS gels were prepared and used for these studies. Proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore), blocked for 4 h in 5% nonfat dry milk with Tris-buffered saline-0.1% Tween 20 (TBS-T), and incubated with primary antibody overnight at 4°C. The E2F1 antibody (sc-193X; Santa Cruz Biotechnology) was diluted 1:10,000 in blocking solution. The E2F2 antibody (sc-633X; Santa Cruz Biotechnology) was diluted 1:10,000 in blocking solution. Antiserum directed against cleaved caspase 3 (catalogue no. 9661; Cell Signaling) was also used for these studies, at a 1:1,000 dilution in blocking solution. After 45 min of washing with TBS-T, blots were incubated with horseradish peroxidase-conjugated donkey anti-rabbit immunoglobulin G (Amersham Biosciences), which was diluted 1:2,000 in 5% nonfat milk in TBS-T. Blots were washed for 45 min with TBS-T and exposed to Amersham ECL reagents, and then autoradiography was performed. The β-actin protein was used as a loading control, and this protein was detected using a polyclonal antiserum (Santa Cruz Biotechnology, Santa Cruz, CA).

Analysis of LacZ gene expression in productively infected cells.

RS cells grown in 60-mm dishes were transfected with 1 μg of blank pcDNA3.1 vector, 100 nM E2F1 siRNA, or 100 nM control siRNA by use of Lipofectamine 2000 according to the manufacturer's specifications (Invitrogen). Twenty-four hours after transfection, cells were transfected with 1 μg of the gCBlue virus genome. After 24 h, cells were fixed (2% formaldehyde, 0.2% glutaraldehyde in PBS) and stained (1% Bluo-Gal, 5 mM ferric potassium, 5 mM ferrous potassium, 0.5 M MgCl2 in PBS), and the number of blue cells was counted as described previously (8-10). The number of blue cells in cultures expressing the blank vector was set to 100. To calculate percent plaque formation, the number of blue cells in cultures transfected with the E2F1 or control siRNA was divided by the number of blue cells in cultures transfected with the blank vector. The results are averages for three independent experiments.

Confocal microscopy.

CRIB cells were infected with wt BoHV-1 at an MOI of 5. Sixteen hours after infection, cells were fixed in 4% paraformaldehyde for 10 min, followed by three washes with PBS. Cells were permeabilized by incubation with 100% ethanol at −20°C for 5 min. Coverslips were then washed three times and blocked in 3% bovine serum albumin (BSA) in PBS for 1 h to reduce nonspecific binding. The E2F1 primary antibody (sc-193X; Santa Cruz Biotechnology) was diluted 1:3,000 in PBS with 0.05% Tween 20 and 1% BSA and incubated on coverslips for 2 h at room temperature. After three washes, coverslips were incubated with Cy5-conjugated donkey anti-rabbit antibody (A-31573; Invitrogen) at a dilution of 1:400 for 1 h in the dark. After slides were washed, DAPI (4′,6-diamidino-2-phenylindole) staining was performed to visualize the nucleus. Coverslips were then mounted on slides by use of Gelmount aqueous mounting medium (Electron Microscopy Sciences). Images were obtained with a Bio-Rad confocal laser scanning microscope (MRC-1024ES).

RESULTS

Suppression of E2F1 reduces the level of productive infection.

Our previous studies indicated that overexpression of E2F4, but not E2F1 or E2F2, stimulated productive BoHV-1 infection (9). In contrast, the same study demonstrated that E2F1 and E2F2, but not E2F4, stimulated the IEtu1 promoter. Since E2F1 and E2F2, but not E2F4, are potent transactivators (2, 13, 35), this result was surprising. Overexpression of E2F1 can induce apoptosis (2, 25), suggesting that E2F1 and E2F2 were unable to stimulate productive infection because they were toxic to transfected cells.

To test whether E2F1-specific siRNA affected productive infection, RS cells were transfected with E2F1 siRNA and BoHV-1 genomic DNA. RS cells were used for these studies because they are permissive for BoHV-1 and can be transfected efficiently. For this study, we used the BoHV-1 strain gCblue, which contains the LacZ gene inserted downstream of the gC promoter. Twenty-four hours after transfection, cells were fixed and the number of β-galactosidase-positive (β-Gal+) cells identified. This time point was used to minimize the number of virus-positive cells resulting from virus spread. At later times, many β-Gal+ cells lift off the dish, making it difficult to count virus-positive cells (10, 16). The number of β-Gal+ cells directly correlates with the number of plaques produced following transfection with the gCblue virus (9, 10, 16). Relative to the case with a control siRNA, cotransfection of E2F1 siRNA with BoHV-1 genomic DNA reduced the number of β-Gal+ cells approximately 4-fold (Fig. 1A). The control siRNA reduced the number of β-Gal+ cells approximately 20% compared to results obtained when RS cells were transfected with just BoHV-1 DNA. Western blot analysis demonstrated that the E2F1 siRNA, but not the control siRNA, reduced E2F1 steady-state protein levels (Fig. 1B). Conversely, the E2F1-specific siRNA had no obvious effect on E2F2 or β-actin protein levels. The E2F1 siRNA reduced the percentage of cells in S phase 24 h after transfection (data not shown), suggesting that in RS cells there is a correlation between reducing E2F1 protein levels and cell cycle progression.

FIG. 1.

FIG. 1.

Suppression of E2F1 reduces levels of productive infection. (A) RS cells were transfected with pcDNA3.1 empty vector, 100 nM E2F1 siRNA, or 100 nM control siRNA. Twenty-four hours later, cells were transfected with 1 μg of BoHV-1 gCBlue DNA. Twenty-four hours after transfection, cells were fixed and β-Gal+ cells were counted. The results constitute the averages for four independent experiments. (B) RS cells were transfected with 100 nM E2F1 siRNA or 100 nM control siRNA. Forty-eight hours after transfection, cells were collected and lysed with NP-40 lysis buffer, and 100 μg of protein was electrophoresed by 12% SDS-PAGE. Proteins in the gel were transferred to a polyvinylidene difluoride membrane and probed with E2F1 antiserum diluted 1:10,000. As a control, 100 μg cell lysate was probed with antiserum that specifically recognized E2F2 or β-actin.

The bICP0 E promoter is transactivated by E2F.

As with HSV-1 and HSV-2, there are two copies of the bICP0 and bICP4 genes in the BoHV-1 repeats (Fig. 2A). However, the organization of the BoHV-1 ICP4 and ICP0 genes is unique because a common IE promoter (IEtu1 promoter) drives expression of bICP0 and bICP4 mRNAs (44) (Fig. 2B). bICP0 also contains an E promoter located near the 5′ end of the bICP0 coding exon (e2). Recent evidence indicated that the bICP0 E promoter, but not the IEtu1 promoter, is stimulated by DEX treatment (47). Expression of the cellular transcription factor C/EBP-alpha is stimulated by DEX, thus stimulating bICP0 E promoter activity. Since repression of E2F1 protein levels by specific siRNAs reduced productive infection, we hypothesized that E2F1 may transactivate the bICP0 early promoter.

To test this hypothesis, neuro-2A cells were cotransfected with a bICP0 E promoter construct (Fig. 2C) plus an E2F1 or E2F2 expression plasmid, and CAT activity was measured. Neuro-2A cells were use for this study because these cells are neuron-like and it was of interest to begin to understand whether E2F regulates gene expression in neurons. E2F1 and E2F2 are potent stimulators of E2F-responsive promoters (2, 13, 24, 40) and thus were used for these studies. E2F1 transactivated the EP-943 and EP-638 promoter constructs approximately 200-fold, and E2F2 transactivated the same promoter constructs >100-fold (Fig. 2C). EP-172, EP-143, and EP-133 were transactivated >40-fold by E2F1 and at least 11-fold by E2F2. EP-72, EP-50, EP-42, and the promoter-lacking CAT vector (pCAT-Basic) were not transactivated by E2F1 or E2F2.

Transfection of neuro-2A cells with increasing concentrations of a plasmid expressing E2F1 led to increased levels of cleaved caspase 3 in neuro-2A cells (Fig. 2D). Although low levels of cleaved caspase 3 were detected in mock-transfected cells, increasing levels of E2F1 correlated with increased levels of cleaved caspase 3, which is considered to be the point of “no return” during apoptosis (39, 42). We believe that low levels of apoptosis in mock-transfected cells were due to the fact that these cells have a tendency to lift off the plate if they are not subcultured every 3 to 4 days and due to the stress of transfection. Cultures that were transfected with the highest levels of E2F1 contained cells that were rounded up and appeared to be dead. When neuro-2A cells were cotransfected with 0.1 or 1 μg E2F1, many cells had a similar morphology to that of mock-transfected cells (data not shown). Although E2F1 can induce apoptosis (2, 25), we do not believe that merely inducing apoptosis accounts for transactivation of the bICP0 E promoter by E2F1, as we used a low level of E2F1 (0.1 μg) for the transactivation studies and this amount of E2F1 did not alter the morphology of neuro-2A cells or dramatically increase cleaved caspase 3 levels relative to those in mock-transfected cells (Fig. 2D). Furthermore, Bax, a known apoptotic gene (39, 42), did not transactivate the bICP0 E promoter (data not shown).

The ability of E2F1 or E2F2 to transactivate the IEtu1 promoter was also examined because a previous study demonstrated that E2F1 transactivated the IEtu1 promoter 15- to 20-fold in bovine testicle cells (9). However, in neuro-2A cells, E2F1 and E2F2 transactivated the three IEtu1 promoters (Fig. 3A) only 3- to 5-fold (Fig. 3B). In summary, this study demonstrates that E2F1 and E2F2 efficiently transactivate the bICP0 E promoter, but not the IEtu1 promoter, in neuro-2A cells.

FIG. 3.

FIG. 3.

E2F transactivation of IEtu1 promoter deletion mutants. (A) Schematic of IEtu1cat constructs used to identify regions of the promoter that are responsive to E2F1. IEtu1cat contains IEtu1 promoter sequences cloned upstream of pSV0CAT (a promoter-lacking CAT expression vector). The IEtu1cat plasmid was provided by V. Misra, Saskatoon, Canada. Two deletion constructs, IEtu1catΔ1024 and IEtu1catΔ1391, have 1,024 or 1,391 bp removed from the 5′ terminus. The locations of cis-acting sequences within IEtu1cat and the details of the respective plasmid constructs were described previously (22). (B) Neuro-2A cells were cotransfected with an IEtu1 promoter construct (1 μg DNA) and the E2F1 or E2F2 (0.1 μg) expression plasmid as described in the legend to Fig. 1C. The CAT activity of cells transfected with the control CAT vector was set to 1 for each experiment. All other values are expressed as fold activation with respect to the control. The results are averages for three independent experiments.

The bICP0 E promoter contains two E2F-responsive regions.

The results in Fig. 2 suggest that the bICP0 E promoter contains two separate E2F-responsive regions: (i) ERR1, spanning the 5′-terminal 60 bases of EP-133; and (ii) ERR2, located at or near the 5′ terminus of EP-638.

To test whether ERR1 conferred E2F responsiveness to a heterologous promoter, a 40-bp segment spanning the 5′ terminus of EP-133 to EP-71 was synthesized and cloned upstream of a CAT reporter construct containing a minimal SV40 E promoter construct (see Fig. 4A for a schematic of the predicted ERR1 region). This construct (ERR1/40) was transactivated approximately 5-fold by E2F1 (Fig. 4B). A 60-bp fragment between EP-133 and EP-71 was not transactivated more efficiently than ERR1/40 (data not shown). In contrast, the SV40 E promoter (SV40 minCAT) was not efficiently transactivated by E2F1.

Sequences spanning the 5′ terminus of EP-638 and adjacent regions within EP-943 (ERR2) were also synthesized and then cloned into the SV40 minCAT construct (see Fig. 5A for a schematic of these constructs). A construct containing 254 bp of the bICP0 E promoter (ERR2/254), 180 bp of the E promoter (ERR2/180), or 120 bp of the E promoter (ERR2/120) was transactivated approximately 20-fold by E2F1 (Fig. 5B). The 120-bp fragment within ERR2 was further divided into two equal pieces (ERR2/1-60 and ERR2/61-120) and then tested for transactivation by E2F1. ERR2/1-60, but not ERR2/61-120, was transactivated >15-fold by E2F1 (Fig. 5B). In summary, these studies identified a 60-bp fragment within ERR2 that was transactivated by E2F1 when cloned upstream of a minimal SV40 E promoter.

In Fig. 6A and B, the DNA sequences of ERR1 and ERR2 are shown. ERR1 is located within sequences that are present in EP-133 but lacking in EP-72. Within this region, there are two regions of overlapping Sp1 binding sites (Fig. 6A). The E2F transcriptional activator is a heterodimer consisting of an E2F family member and a Dp family member (2, 13, 24). The core DNA binding site of an E2F-Dp heterodimer is G/CGCGCC/G (49). Within ERR1, there is one E2F-Dp core consensus sequence. Two binding sites for LSF (late SV40 transcription factor), a transcription factor that interacts with the SV40 21-base repeats and activates late transcription (21), and binding sites for a transcription factor that preferentially interacts with CAC sequences were also identified. Finally, a Yi binding site, which is present in the mouse thymidine kinase promoter, was detected (5). Proteins that interact with the Yi binding site exhibit G1/S-phase-inducible binding. Within sequences of ERR1/40, binding sites for E2F/Dp, Sp1 Yi, LSF, and CAC are clustered.

FIG. 6.

FIG. 6.

Nucleotide sequences of ERR1 and ERR2 within the bICP0 E promoter. (A) Nucleotide sequence spanning from EP-133 to the 5′ terminus of the bICP0 E mRNA. The vertical black arrows denote sequences used in the ERR1/40 construct. (B) Nucleotide sequence spanning ERR2. The 120 nucleotides that span ERR2 are shown to allow for comparison between the first 60 nucleotides, which comprised the minimal fragment that was efficiently stimulated by E2F1, and the last 60 nucleotides, which were not efficiently transactivated by E2F1. Shown are locations of Sp1 binding sites from various promoters, C/EBP-alpha binding sites previously identified within the bICP0 E promoter (47), Sp1 sites from the designated promoters, Yi consensus binding sites (CCNCNCCCN), E2F-Dp core binding sites, CAC binding sites, and LSF binding sites.

Within the first 60 bp of ERR2 (Fig. 6B), 5 Sp1 binding sites were identified: 3 match those of the mouse Erk1 gene (29), 1 is present in the SV40 E promoter (11), and 1 is a target for binding to SP1 (36). In addition, 5 core E2F-Dp binding sites were present. Four of these were overlapping and located near the 5′ terminus of this fragment. Conversely, DNA sequences spanning nucleotides 61 to 120 of ERR2, which were not efficiently transactivated by E2F1, contained just 2 E2F-Dp consensus binding sites and one Sp1 binding site present in the human heat shock binding protein 70 promoter (12). In summary, these studies suggested that a cluster of E2F-Dp core binding sites and Sp1 binding sites located within the 60 bp of ERR2 may be important for E2F-mediated transactivation.

Cellular factors interact with ERR1 and ERR2.

To test whether E2F interacts with ERR1 or ERR2, EMSAs were performed with oligonucleotides derived from ERR1, ERR2, or a consensus E2F binding site and with whole-cell extracts prepared from neuro-2A cells. Shifted bands were readily detected when the respective probes were incubated with neuro-2A cell extracts (Fig. 7A, shifted bands are denoted by brackets). E2F interacted with the E2F consensus probe as well as with the ERR1 and ERR2 probes, since an oligonucleotide containing a consensus E2F binding site, but not a C/EBP-alpha binding site, competed for binding of nuclear factors (Fig. 7A).

FIG. 7.

FIG. 7.

Interaction between E2F and ERR1 or ERR2. (A) EMSA was performed using a probe that contains a consensus E2F binding site (E2F consensus) or sequences spanning ERR1/40 (ERR1) or ERR2/1-60 (ERR2), as described in Materials and Methods. The respective 32P-radiolabeled probe was incubated with 20 μg of neuro-2A cell lysate from cells transfected with the E2F1 expression construct (100 ng). For competition assays, 500 ng of the cold E2F consensus probe (lanes E2F) or the C/EBP-alpha consensus probe (lanes C) was incubated with cell extracts as described in Materials and Methods. Brackets indicate the regions of shifted bands. (B) CRIB cells were infected with wt BoHV-1 at an MOI of 5 for 8, 16, or 24 h. The respective 32P-radiolabeled probes, i.e., E2F binding sites (E2F consensus) or sequences spanning ERR1/40 (ERR1) or ERR2/1-60 (ERR2), were incubated with 20 μg of CRIB cell lysate (lanes M) or CRIB cell lysate prepared from cells infected for 8, 16, or 24 h after infection. For competition assays, 500 ng of the cold E2F consensus probe (lanes E2F) or C/EBP-alpha consensus probe (lanes C) was incubated with cell extracts as described in Materials and Methods. Brackets indicate the regions of shifted bands, and the closed circles denote shifted bands that were reduced when samples were incubated with the cold E2F consensus probe.

Additional studies were performed to test whether productive infection stimulated binding to the E2F consensus binding site, ERR1, or ERR2. For these studies, we used bovine kidney cells (CRIB cells) because they are permissive for BoHV-1 infection, whereas neuro-2A cells are not. Sixteen or 24 h after infection, increased binding to the E2F consensus, ERR1, and ERR2 was observed (Fig. 7B, enhanced binding is denoted by closed circles). A consensus E2F sequence, but not a C/EBP-alpha binding site, reduced the intensity of certain bands when samples were incubated with the respective radioactive probes (Fig. 7B). Although these studies indicated that E2F interacted with ERR1 and ERR2, this was not readily detectable until late stages of productive infection, suggesting that E2F family members are not the major activators of bICP0 E promoter activity.

Western blot analysis determined that E2F1 protein levels, but not those of E2F2, increased during the course of productive infection (Fig. 8). Sixteen and 24 h after infection, E2F1 protein levels were dramatically higher, which correlated with enhanced binding to the E2F consensus, ERR1, or ERR2 oligonucleotide. Confocal microscopy was performed to determine if E2F1 was detected in the nuclei of infected cells 16 h after infection (Fig. 8B). Higher levels of E2F1 were detected in infected cells, and the E2F1 protein was localized in the nucleus, which was in agreement with the Western blot studies shown in Fig. 8A. Previous studies have demonstrated that BoHV-1 E transcripts (thymidine kinase and ribonucleotide reductase) are readily detected 2 h after infection (MOI of 0.02) by use of poly(dT) as a primer for reverse transcription-PCR (RT-PCR) (31). Using an MOI of 5, most CRIB cells were rounded up and some were beginning to detach from the dish between 16 and 24 h after infection (Fig. 8B).

FIG. 8.

FIG. 8.

Analysis of E2F1 protein levels during productive infection. (A) Western blot analysis of E2F1, E2F2, and β-actin expression following infection with BoHV-1. CRIB cells were infected with wt BoHV-1 at an MOI of 5 for 2, 4, 8, 16, or 24 h. Lanes M2 and M24 are mock-infected cells that were collected 2 and 24 h, respectively, after the other cells were infected with BoHV-1. One hundred micrograms of total cell lysate was loaded into each lane. (B) CRIB cells were infected with wt BoHV-1 at an MOI of 5. Sixteen hours after infection, cells were fixed in 4% paraformaldehyde and stained for confocal microscopy as described in Materials and Methods. E2F1 primary antibody was used at a 1:3,000 dilution, and Cy5-conjugated donkey anti-rabbit secondary antibody was used at a 1:400 dilution.

DISCUSSION

In this study, we demonstrated that the bICP0 E promoter, but not the IEtu1 promoter, was transactivated >100-fold by E2F1 or E2F2 in neuro-2A cells. Silencing of E2F1 reduced virus infection approximately 4-fold, indicating that E2F1 has the potential to stimulate productive infection. Previous studies also suggested that E2F family members stimulated productive BoHV-1 infection (9, 43). With respect to productive HSV-1 infection, the level of E2F that is not associated with Rb family members increases following infection of human cells (C33-A) (14). Relocalization of E2F4 to the nucleus occurs in human C33-A and U2-OS cells following HSV-1 infection (28). Further support for E2F4 playing a role in HSV-1 replication comes from the finding that infection of p107−/− p130−/− mouse cells leads to a reduced level of infectious virus (6). In primary human fibroblasts or HeLa cells, the subcellular distribution of E2F4 is altered following HSV-1 infection, which is assumed to inactivate E2F4 activity (1). The same study also concluded that HSV-1 infection leads to posttranslational modification of E2F1 and E2F5, translocation of E2F family members from the nucleus to the cytoplasm, and reduced E2F binding to consensus E2F binding sites. In contrast, enhanced binding to a consensus E2F binding site was detected at late times after infection with BoHV-1 (Fig. 7B). Many DNA synthetic genes are activated by E2F family members (13), suggesting that transient induction of E2F family members may stimulate viral synthesis in highly differentiated cells. It is also possible that induction of E2F binding activity occurs because BoHV-1 induces p53-dependent apoptosis during productive infection (4).

The bICP0 E promoter contains two separate regions that are transactivated by E2F: an upstream region localized to a 60-bp fragment (ERR2) and sequences located near the 5′ terminus of the EP-133 construct (ERR1). Since ERR2 was transactivated approximately 20-fold by E2F1 but EP-638 was transactivated approximately 200-fold by E2F1, we suggest that other sequences within the bICP0 E promoter play a role in transactivation by E2F. EMSAs suggested that E2F interacted with ERR1 and ERR2, because a consensus E2F sequence, but not a C/EBP-alpha binding site, competed for binding of nuclear factors (Fig. 7). ERR2 contains 5 core E2F-Dp binding sites (Fig. 6B) (49), suggesting that these elements may be important for E2F-mediated transactivation. The 5 Sp1 binding sites located in ERR2 may also be crucial for transactivation, because E2F family members can interact with and transactivate certain promoters containing GC-rich motifs that resemble Sp1 binding sites. For example, E2F1 can transactivate GC-rich motifs in the HSV-1 thymidine kinase promoter (35) and in the human ASK (activator of S-phase kinase) gene, encoding the regulatory subunit for human cdc7-related kinase (48). In addition, a subunit of the mouse DNA polymerase alpha promoter contains a GC-rich element that is crucial for cell cycle regulation (26). Finally, 3 GC-rich motifs in the human thymidine kinase promoter are bound by E2F and are crucial for cell cycle-dependent expression (38). Not all GC-rich promoters are transactivated by E2F, as we previously demonstrated that the BoHV-1 IEtu2 promoter was not efficiently transactivated by E2F1 or E2F2 (9).

In trigeminal ganglia of latently infected calves, bICP0 transcription is stimulated from the E promoter during DEX-induced reactivation from latency, regardless of whether infectious virus is detected (47). In addition, the bICP0 E promoter is stimulated by DEX, in part because of the cellular transcription factor C/EBP-alpha. Conversely, the IEtu1 promoter does not appear to be as active during reactivation from latency, since bICP4 is not consistently detected. This may be important because activating bICP0, but not bICP4, during the early stages of reactivation may allow BoHV-1 to “test the waters” and determine whether important cellular factors are present for production of infectious virus without extensive viral gene expression occurring, which could lead to neuronal death. If bICP4 and bICP0 are expressed equally, then extensive viral gene expression may occur in too many neurons that cannot support production of infectious virus. The ability of E2F1 or E2F2 to strongly transactivate the bICP0 E promoter, but not the IEtu1 promoter, may play a role in this process. It will be of interest to test whether E2F1 or E2F2 can cooperate with bICP0 or bICP4 to stimulate E or L genes, since they also contain GC-rich promoters.

Acknowledgments

This research was supported by grants from the USDA and the Agriculture and Food Research Initiative Competitive Grants program (08-00891 and 09-01653). A grant to the Nebraska Center for Virology (1P20RR15635) also supported certain aspects of these studies. Aspen Workman was partially supported by a fellowship from a Ruth L. Kirschstein National Research Service Award (1 T32 AIO60547; National Institute of Allergy and Infectious Diseases).

Footnotes

▿

Published ahead of print on 21 April 2010.

REFERENCES

  • 1.Advani, S. J., R. R. Weichselbaum, and B. Roizman. 2000. E2F proteins are posttranslationally modified concomitantly with a reduction in nuclear binding activity in cells infected with herpes simplex virus 1. J. Virol. 74:7842-7850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Attwooll, C., E. L. Denchi, and K. Helin. 2004. The E2F family: specific functions and overlapping interests. EMBO J. 23:4709-4716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.DeGregori, J., T. Kowalik, and J. R. Nevins. 1995. Cellular targets for activation by the E2F1 transcription factor include DNA synthesis- and G1/S-regulatory genes. Mol. Cell. Biol. 15:4215-4224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Devireddy, L. R., and C. Jones. 1999. Activation of caspases and p53 by bovine herpesvirus 1 infection results in programmed cell death and efficient virus release. J. Virol. 73:3778-3788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Dou, Q.-P., J. L. Fridovich-Keil, and A. B. Pardee. 1991. Inducible binding to the murine thymidine kinase promoter in late G1/S phase. Proc. Natl. Acad. Sci. U. S. A. 88:1157-1161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ehmann, G. L., H. A. Burnett, and S. L. Bachenheimer. 2001. Pocket protein p130/Rb2 is required for efficient herpes simplex virus type 1 gene expression and viral replication. J. Virol. 75:7149-7160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Fraefel, C., J. Zeng, Y. Choffat, M. Engels, M. Schwyzer, and M. Ackermann. 1994. Identification and zinc dependence of the bovine herpesvirus 1 transactivator protein BICP0. J. Virol. 68:3154-3162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Geiser, V. 2001. Regulation of productive bovine herpesvirus 1 infection by bICP0, latency related gene, and pocket proteins, and E2F family members. M.S. thesis. University of Nebraska, Lincoln, NE.
  • 9.Geiser, V., and C. Jones. 2003. Stimulation of bovine herpesvirus 1 productive infection by the adenovirus E1A gene and a cell cycle regulatory gene, E2F-4. J. Gen. Virol. 84:929-938. [DOI] [PubMed] [Google Scholar]
  • 10.Geiser, V., M. Inman, Y. Zhang, and C. Jones. 2002. The latency related (LR) gene of bovine herpes virus 1 (BHV-1) can inhibit the ability of bICP0 to activate productive infection. J. Gen. Virol. 83:2965-2971. [DOI] [PubMed] [Google Scholar]
  • 11.Gidoni, D., W. S. Dynan, and R. Tjian. 1984. Multiple specific contacts between a mammalian transcription factor and its cognate promoter. Nature 312:409-413. [DOI] [PubMed] [Google Scholar]
  • 12.Greene, J. M., Z. Larin, I. C. A. Taylor, H. Prentice, A. Gwinn, and R. E. Kingston. 1987. Multiple basal elements of a human hsp70 promoter function differently in human and rodent cell lines. Mol. Cell. Biol. 7:3646-3655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Harbour, J. W., and D. C. Dean. 2000. The Rb/E2F pathway: expanding roles and emerging paradigms. Genes Dev. 14:2393-2409. [DOI] [PubMed] [Google Scholar]
  • 14.Hilton, M. J., D. Mounghane, T. McLean, N. V. Contractor, J. O'Neil, K. Carpenter, and S. L. Bachenheimer. 1995. Induction by herpes simplex virus of free and heteromeric forms of E2F transcription factor. Virology 213:624-638. [DOI] [PubMed] [Google Scholar]
  • 15.Inman, M., L. Lovato, A. Doster, and C. Jones. 2002. A mutation in the latency-related gene of bovine herpesvirus 1 interferes with the latency-reactivation cycle of latency in calves. J. Virol. 76:6771-6779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Inman, M., Y. Zhang, V. Geiser, and C. Jones. 2001. The zinc ring finger in the bICP0 protein encoded by bovine herpes virus-1 mediates toxicity and activates productive infection. J. Gen. Virol. 82:483-492. [DOI] [PubMed] [Google Scholar]
  • 17.Jones, C. 1998. Alphaherpesvirus latency: its role in disease and survival of the virus in nature. Adv. Virus Res. 51:81-133. [DOI] [PubMed] [Google Scholar]
  • 18.Jones, C. 2003. Herpes simplex virus type 1 and bovine herpesvirus 1 latency. Clin. Microbiol. Rev. 16:79-95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Jones, C., T. J. Newby, T. Holt, A. Doster, M. Stone, J. Ciacci-Zanella, C. J. Webster, and M. W. Jackwood. 2000. Analysis of latency in cattle after inoculation with a temperature sensitive mutant of bovine herpesvirus 1 (RLB106). Vaccine 18:3185-3195. [DOI] [PubMed] [Google Scholar]
  • 20.Jones, C., V. Geiser, G. Henderson, Y. Jiang, F. Meyer, S. Perez, and Y. Zhang. 2006. Functional analysis of bovine herpesvirus 1 (BHV-1) genes expressed during latency. Vet. Microbiol. 113:199-210. [DOI] [PubMed] [Google Scholar]
  • 21.Kim, C. H., C. Heath, A. Bertuch, and U. Hansen. 1987. Specific stimulation of simian virus 40 late transcription in vitro by a cellular factor binding the simian virus 40 21 base pair repeat promoter element. Proc. Natl. Acad. Sci. U. S. A. 84:6025-6029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Misra, V., A. C. Bratanich, D. Carpenter, and P. O'Hare. 1994. Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor. J. Virol. 68:4898-4909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Misra, V., S. Walker, S. Hayes, and P. O'Hare. 1995. The bovine herpesvirus alpha gene trans-inducing factor activates transcription by mechanisms different from those of its herpes simplex virus type 1 counterpart VP16. J. Virol. 69:5209-5216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Nevins, J. R., J. DeGregori, L. Jakoi, and G. Leone. 1997. Functional analysis of E2F transcription factor. Methods Enzymol. 283:205-219. [DOI] [PubMed] [Google Scholar]
  • 25.Nip, J., D. K. Strom, B. E. Fee, G. Zambetti, J. L. Cleveland, and S. W. Hiebert. 1997. E2F-1 cooperates with topoisomerase II inhibition and DNA damage to selectively augment p53-independent apoptosis. Mol. Cell. Biol. 17:1049-1056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Nishikawa, N. S., M. Izumi, H. Uchida, M. Yokoi, H. Miyazawa, and F. Hanaoka. 2000. Cloning and characterization of the 5′-upstream sequence governing the cell cycle-dependent transcription of mouse DNA polymerase alpha 68 kDa subunit gene. Nucleic Acids Res. 28:1525-1534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ohtani, K., J. DeGregori, and J. R. Nevins. 1995. Regulation of the cyclin E gene by transcription factor E2F1. Proc. Natl. Acad. Sci. U. S. A. 92:12146-12150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Olgiate, J., G. L. Ehmann, S. Vidyarthi, M. J. Hilton, and S. L. Bachenheimer. 1999. Herpes simplex virus induces intracellular redistribution of E2F4 and accumulation of E2F pocket protein complexes. Virology 258:257-270. [DOI] [PubMed] [Google Scholar]
  • 29.Pages, G., E. R. Stanely, M. L. Gall, A. Brunet, and J. Pouyssegur. 1995. The mouse p44 mitogen-activated protein kinase (extracellular signal-regulated kinase 1) gene. J. Biol. Chem. 270:26986-26992. [DOI] [PubMed] [Google Scholar]
  • 30.Rock, D., J. Lokensgard, T. Lewis, and G. Kutish. 1992. Characterization of dexamethasone-induced reactivation of latent bovine herpesvirus 1. J. Virol. 66:2484-2490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Schang, L., and C. Jones. 1997. Analysis of bovine herpesvirus 1 transcripts during a primary infection of trigeminal ganglia of cattle. J. Virol. 71:6786-6795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Schulze, A., K. Zerfass, D. Spitkovsky, S. Middendorp, J. Berges, K. Helin, P. Jansen-Durr, and B. Henglein. 1995. Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site. Proc. Natl. Acad. Sci. U. S. A. 92:11264-11268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Schwyzer, M., U. V. Wirth, B. Vogt, and C. Fraefel. 1994. BICP22 of bovine herpesvirus 1 is encoded by a spliced 1.7 kb RNA which exhibits immediate early and late transcription kinetics. J. Gen. Virol. 75:1703-1711. [DOI] [PubMed] [Google Scholar]
  • 34.Sheffy, B. E., and D. H. Davies. 1972. Reactivation of a bovine herpesvirus after corticosteroid treatment. Proc. Soc. Exp. Biol. Med. 140:974-976. [DOI] [PubMed] [Google Scholar]
  • 35.Shin, E. K., S. G. Tevosian, and A. S. Yee. 1996. The N-terminal region of E2F-1 is required for transcriptional activation of a new class of target promoter. J. Biol. Chem. 271:12261-12268. [DOI] [PubMed] [Google Scholar]
  • 36.Thiese, H.-J., and C. Bach. 1990. Target detection assay (TDA): a versatile procedure to determine DNA binding sites as demonstrated on Sp1 protein. Nucleic Acids Res. 18:3203-3209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tikoo, S. K., M. Campos, and L. A. Babiuk. 1995. Bovine herpesvirus 1 (BHV-1): biology, pathogenesis, and control. Adv. Virus Res. 45:191-223. [DOI] [PubMed] [Google Scholar]
  • 38.Tommasi, S., and G. P. Pfeifer. 1997. Constitutive protection of E2F recognition sequences in the human thymidine kinase promoter during cell cycle progression. J. Biol. Chem. 272:30483-30490. [DOI] [PubMed] [Google Scholar]
  • 39.Wang, X. 2001. The expanding role of mitochondria in apoptosis. Genes Dev. 15:2922-2933. [PubMed] [Google Scholar]
  • 40.Weintraub, S. J., C. A. Prater, and D. C. Dean. 1992. Retinoblastoma protein switches the E2F site from positive to negative element. Nature 358:259-261. [DOI] [PubMed] [Google Scholar]
  • 41.Wells, J. M., S. Illenye, J. Magae, C. L. Wu, and N. H. Heintz. 1997. Accumulation of E2F-4.DP-1 DNA binding complexes correlates with induction of dhfr gene expression during the G1 to S phase transition. J. Biol. Chem. 272:4483-4492. [DOI] [PubMed] [Google Scholar]
  • 42.White, E. 1996. Life, death, and the pursuit of apoptosis. Genes Dev. 10:1-15. [DOI] [PubMed] [Google Scholar]
  • 43.Winkler, M. T., L. S. Schang, A. Doster, T. Holt, and C. Jones. 2000. Analysis of cyclins in trigeminal ganglia of calves infected with bovine herpesvirus-1. J. Gen. Virol. 81:2993-2998. [DOI] [PubMed] [Google Scholar]
  • 44.Wirth, U. V., C. Fraefel, B. Vogt, C. Vlcek, V. Paces, and M. Schwyzer. 1992. Immediate-early RNA 2.9 and early RNA 2.6 of bovine herpesvirus 1 are 3′ coterminal and encode a putative zinc finger transactivator protein. J. Virol. 66:2763-2772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Wirth, U. V., K. Gunkel, M. Engels, and M. Schwyzer. 1989. Spatial and temporal distribution of bovine herpesvirus 1 transcripts. J. Virol. 63:4882-4889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wirth, U. V., B. Vogt, and M. Schwyzer. 1991. The three major immediate-early transcripts of bovine herpesvirus 1 arise from two divergent and spliced transcription units. J. Virol. 65:195-205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Workman, A., S. Perez, A. Doster, and C. Jones. 2009. Dexamethasone treatment of calves latently infected with bovine herpesvirus 1 (BHV-1) leads to activation of the bICP0 early promoter, in part by the cellular transcription factor C/EBP-alpha. J. Virol. 83:8800-8809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Yamada, M., N. Sato, C. Taniyama, K. Ohtani, K. Arai, and H. Masai. 2002. A 63-base pair DNA segment containing an Sp1 site but not a canonical E2F site can confer growth-dependent and E2F-mediated transcriptional stimulation of the human ASK gene encoding the regulatory subunit for human Cdc7-related kinase. J. Biol. Chem. 277:27668-27681. [DOI] [PubMed] [Google Scholar]
  • 49.Zheng, N., E. Fraenkel, C. O. Pabo, and N. P. Pavletich. 1999. Structural basis of DNA recognition by the heterodimeric cell cycle transcription factor E2F-DP. Genes Dev. 13:666-674. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES