Epidermal growth factor inhibits intestinal NHE8 expression via reducing its basal transcription

Abstract

Sodium/hydrogen exchangers (NHEs) play a major role in Na⁺ absorption, cell volume regulation, and intracellular pH regulation. Of the nine identified mammalian NHEs, three (NHE2, NHE3, and NHE8) are localized on the apical membrane of epithelial cells in the small intestine and the kidney. Although the regulation of NHE2 and NHE3 expression has been extensively studied in the past decade, little is known about the regulation of NHE8 gene expression under physiological conditions. The current studies were performed to explore the role of epidermal growth factor (EGF) on NHE8 expression during intestinal maturation. Brush-border membrane vesicles (BBMV) were isolated from intestinal epithelia, and Western blot analysis was performed to determine NHE8 protein expression of sucking male rats treated with EGF. Real-time PCR was used to quantitate NHE8 mRNA expression in rats and Caco-2 cells. Human NHE8 promoter activity was characterized through transfection of Caco-2 cells. Gel mobility shift assays (GMSAs) were used to identify the promoter sequences and the transcriptional factors involved in EGF-mediated regulation. Our results showed that intestinal NHE8 mRNA expression was decreased in EGF-treated rats and Caco-2 cells, and NHE8 protein abundance was also decreased in EGF-treated rats. The activity of the human NHE8 gene promoter transfected in Caco-2 cells was also reduced by EGF treatment. This could be explained by reduced binding of transcription factor Sp3 on the NHE8 basal promoter region in the presence of EGF. Pretreatment with MEK1/2 inhibitor UO-126 could prevent EGF-mediated inhibition of NHE8 gene expression. In conclusion, this study showed that EGF inhibits NHE8 gene expression through reducing its basal transcription, suggesting an important role of EGF in regulating NHE expression during intestinal maturation.

sodium is an electrolyte that is essential to volume regulation and maintenance of blood pressure. Sodium absorption is mediated by several transporter families including Na⁺/H⁺ exchangers (NHEs). The NHEs are plasma membrane-bound antiporters that mediate the movement of extracellular Na⁺ into cells in exchange for intracellular H⁺. They are widely expressed in mammalian cells, with broad physiological functions including intracellular pH homeostasis, cell volume regulation, acid-base regulation, and electroneutral NaCl transport. To date, nine mammalian NHEs are discovered, and five of them (NHE1–4, 8) are located in intestinal enterocytes (36, 40). These NHEs have different membrane localization and functions. NHE1 and NHE4 are expressed in the basolateral membrane of the intestinal epithelial cells (26, 30, 32), whereas NHE2, NHE3, and NHE8 are expressed in the brush-border membrane (BBM) of the intestinal epithelial cells (10, 12, 36). NHE1 contributes to cell volume regulation and intracellular pH (pH_i) regulation (26). Lack of NHE1 expression results in decreased postnatal growth rate, ataxia, and seizures (4). NHE2 is involved in gastric function. Loss of NHE2 results in altered oxyntic mucosa, markedly reduced parietal and zymogenic cell number (5, 21), and impaired intestinal barrier recovery (24). NHE3 is important for Na⁺ absorption. Lack of NHE3 expression displays altered acid-base balance and Na⁺-fluid volume homeostasis (27). NHE4 is involved in acid secretion in the stomach (6). Targeted interruption of NHE4 exhibits abnormal gastric acid secretion, gastric epithelial cell differentiation, and secretory canalicular and tubulovesicular membranes development (11). NHE8 also contributes to sodium absorption, and it is maximally active in the early developmental period when NHE2 and NHE3 are absent (36).

NHE activity is tightly regulated by many physiological factors such as osmotic stress (2, 28, 29, 33), dietary Na⁺ content (15), steroids (19, 41), and growth hormones (7, 38). Epidermal growth factor (EGF), an important growth factor found in many human tissues, induces cell division, DNA synthesis, tissue proliferation, and cellular differentiation. It can also cause changes in electrolyte and nutrient absorption (13, 25, 37). EGF stimulates NHE1 activity in the gastrointestinal tract and other organs (8, 16, 17, 22, 23). EGF also activates NHE2 function in the intestine by enhancing NHE2 gene expression (38). Since NHE8 expression in the intestine is high early in development and decreases as the organism ages, we hypothesize that reduction of NHE8 expression during intestinal maturation may be linked to EGF.

In the current study, we explored the effect of EGF on NHE8 expression in suckling rats and the mechanism of EGF's effect on NHE8 expression in Caco-2 cells. Our results showed that EGF reduced intestinal NHE8 expression in suckling rats and in human intestinal cells (Caco-2 cells). This decrease is the result of reduced NHE8 gene transcription. In addition, we found that inhibition of NHE8 gene transcription in Caco-2 cells involved the EGF receptor-mitogen-activated protein kinase (EGFR-MAPK) p42/p44 pathway. Activation of p42/44 MAPK by EGF reduced Sp3 transcriptional factor bind at the NHE8 promoter. These findings suggest that EGF might be an important regulator involved in modulating intestinal NHE isforms during intestinal maturation process.

MATERIALS AND METHODS

Animals.

Male Sprague-Dawley rats (16 days old) received subcutaneous injections of human recombinant EGF (1 μg/g body wt; Peprotech, Rock Hill, NJ) or saline twice a day for 3 days. Eighteen hours after the last injection, rats were euthanized, and intestinal mucosa were harvested and used for RNA purification and BBM vesicle (BBMV) isolation. All animal work was approved by the University of Arizona Institutional Animal Care and Use Committee. The experiments were repeated four times with different groups of animals (4 rats/group).

Cell culture.

Human intestinal epithelial cells (Caco-2) were purchased from American Type Culture Collection (ATCC) and cultured according to ATCC guidelines. Cells were cultured at 37°C in a 95% air-5% CO₂ atmosphere and passaged every 48–72 h. In the EGF treatment experiments, cells were incubated with different concentrations of human recombinant EGF (Peprotech; Rock Hill, NJ) for 18 h before they were harvested.

BBM protein purification from rat intestinal mucosa and Western blot analysis.

BBMs were prepared from rat intestinal mucosa, as previously described (36), and 30 μg BBMV proteins were used for Western blot. NHE8 antibody was used as a 1:3,000 dilution in these experiments (36). A 1:5,000 dilution of the β-actin antiserum (Sigma; St. Louis, MO) was used to detect β-actin protein abundance. Western detection was performed with the BM Chemiluminescence Western Blotting kit (Roche Diagnostics; Indianapolis, IN). For protein expression level quantitation, a ratio of NHE8 protein intensity over β-actin protein intensity was used. Western blotting experiments were done in BBMV preps isolated from four different groups of animals.

RNA purification and PCR analysis to detect NHE8 expression.

RNA was purified from rat intestinal mucosa and Caco-2 cells by using the TRIzol reagent (Invitrogen; Carlsbad, CA). Total RNA (500 ng) was reverse transcribed by using the iScript kit (Bio-Rad, Hercules, CA), and 10% of the RT reaction was used for real-time PCR analysis using TaqMan technology to determine the expression levels of NHE8 gene. Rat and human NHE8 and TATA-box binding protein (TBP) primers were purchased from Applied Biosystems (Foster City, CA). Resulting data were analyzed by the comparative cycle threshold (Ct) method as means of relative quantitation of gene expression, normalized to an endogenous reference (TBP) and relative to a calibrator (normalized Ct value obtained from control groups) and expressed as 2^−ΔΔCt (Applied Biosystems User Bulletin no. 2: Rev B “Relative Quantitation of Gene Expression”).

Assembly of reporter gene constructs.

A series of progressively shorter human NHE8 (hNHE8) promoter constructs in the pGL-3/basic luciferase reporter vector (Promega, Madison, MI) were made by restriction enzyme digestion or PCR as described previously (35). Briefly, pGL3/-671 construct was made by subcloning a SacI-EcoRV fragment from pCR2.1-TOPO vector into SacI/XmaI-digested pGL3Basic vector. Construct pGL3b/-89 was made by SacI/SmaI digestion followed by blunt end reaction with Klenow treatment and subsequent ligation with T4 DNA ligase. Constructs pGL3b/-32 was made by PCR method. All promoter constructs were sequenced to ensure the accuracy.

Transient transfection and functional promoter analysis.

Caco-2 cells were cultured in 24-well plates. Promoter constructs containing various length of hNHE8 gene promoter region were used to identify the response region on EGF regulation. When cell density reached 60–70%, Caco-2 cells were transfected with the promoter constructs using Effectene (Qiagen; Valencia, CA) according to the manufacturer's instructions. Cells were harvested for promoter reporter assays 40 h after transfection. Promoter reporter assays were performed using a dual luciferase assay kit according to the manufacturer's instructions (Promega). Luciferase activities were measured with a luminometer (Femtomaster FB 12; Berthold Detection System, Pforzheim, Germany). Renilla luciferase activity driven by pRL-CMV (Promega) was used as an internal control to calculate the relative luciferase activity. To test the effect of EGF on hNHE8 promoter activity, transfected cells were treated with 100 ng/ml human recombinant EGF for 18 h before promoter reporter assay. To determine the involvement of EGF receptor (EGFR) activation pathways, cells were treated with H7 (10 μM, an inhibitor of protein kinase C), SB-202190 (10 μM, an inhibitor of p38 MAPK), or UO-126 (25 μM, an inhibitor of MEK) for 2 h before the addition of EGF.

Nuclear protein isolation and gel mobility shift assay.

Nuclear extracts were prepared from Caco-2 cells treated with EGF (100 ng/ml 18 h) or vehicle by a previously described method (39). Synthetic double-stranded oligonucleotides were designed to span the targeted promoter region (−18 GCCGAGGCCCCGCCTCCCGCTCTCGCC +7). DNA oligonucleotides were end-labeled with [³²P]ATP, and 4 μg of nuclear extract were incubated with 1 ng of labeled probe in gel mobility shift assay (GMSA) binding buffer containing 10 mM HEPES (pH 7.5), 1 mM EDTA, 50 mM NaCl, 1 mM dithiothreitol, and 50 μg/ml poly[d(I-C)]. After incubation at room temperature for 20–30 min, the mixture was electrophoresed on a 6% polyacrylamide gel in 0.25× Tris-boric acid-EDTA buffer. Gels were dried and exposed to X-ray film. For competition experiments, a 100-fold molar excess of unlabeled probe was added to the reaction mixture before the labeled probe was added. For supershift assays, 4 μg of Sp1 or Sp3 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) were added to the reaction mixtures.

Statistical analysis.

Student's t-test was used to compare values of the experimental data. P values <0.05 were considered significant.

RESULTS

Effect of EGF on the intestinal NHE8 protein expression in rats.

Sixteen-day-old male rats were administrated with EGF (1 μg/kg body wt, twice a day for 3 days). Eighteen hours after the last EGF administration, rats were euthanized, and BBM protein was isolated from intestinal mucosa. BBM protein was then used for Western blot to determine NHE8 protein abundance. NHE8 immunoreactive protein abundance is indicated by the ratio of optical densities of the NHE8 band to that of the β-actin band. Western blot results showed that the effect of EGF on apical NHE8 protein expression differs between the jejunum and the ileum in rats. In the jejunum, EGF administration had no inhibitory effect on the NHE8 immunoreactive protein abundance (0.48 ± 0.03 in control rats and 0.58 ± 0.04 in EGF-treated rats). In the ileum, EGF administration significantly reduced NHE8 protein expression from 0.51 ± 0.01 in control rats to 0.25 ± 0.01 in EGF-treated rats (P ≤ 0.01, n = 4) (Fig. 1).

Fig. 1.

Effect of epidermal growth factor (EGF) on the intestinal Na⁺/H⁺ exchanger NHE8 expression in rats. Brush-border membrane vesicles (BBMVs) were isolated from the jejunal (A) or ileal (B) mucosa of control (CT) rats and EGF rats. BBM protein (30 μg) was loaded on SDS-PAGE gels, and immunoblots were performed. Rat NHE8 antibody and β-actin antibody were used to detect NHE8 and β-actin, respectively. The expression of NHE8 protein is calculated by the density of NHE8 band over that of β-actin band. Bar chart shows the NHE8 protein expression indicated as means ± SE in the sum of 4 independent experiments. *P ≤ 0.01 for control groups vs. EGF groups. Inset: corresponding Western blot image.

Effect of EGF on the intestinal NHE8 mRNA expression in rats.

Since NHE8 protein abundance was reduced in the rat ileum, we focused on detection NHE8 mRNA in that part of the intestine. Ileal mucosa was collected from rats 18 h after the last EGF administration. RNA was purified and was used for real-time PCR to determine the abundance of NHE8 mRNA. Similar to protein expression changes, NHE8 mRNA expression in the ileum was decreased about 45% from 1.03 ± 0.02 in control rats to 0.56 ± 0.05 in EGF-treated rats (P ≤ 0.001, n = 4) (Fig. 2).

Fig. 2.

Effect of EGF on the intestinal NHE8 mRNA expression in rats. RNAs were isolated from the ileal mucosa of control rats or EGF rats and used for real-time PCR. NHE8 mRNA and TATA box binding protein (TBP) mRNA were amplified with rat-specific NHE8 and TBP primers. The changes in NHE8 gene expression is analyzed by the comparative cycle threshold (Ct) method. Data are means ± SE from total 18 rats (9 for EGF group, 9 for control group). *P ≤ 0.01 for control group vs. EGF group.

Effect of EGF on NHE8 expression in Caco-2 cells.

The expression of NHE8 mRNA in Caco-2 cells exposed to standard or EGF-containing medium was assessed by real-time PCR. Since the physiological concentration of EGF in mice milk ranges from 50 to 500 ng/ml (3), we chose 25–100 ng/ml as our study concentration. As shown in Fig. 3, human NHE8 gene expression was significantly reduced in Caco-2 cells treated with EGF. All tested EGF concentrations (25, 50, and 100 ng/ml, respectively) reduced NHE8 gene expression by 35–47% in Caco-2 cells when compared with untreated cells (n = 5; P < 0.02). The reduction level of NHE8 by EGF in Caco-2 cells is in agreement with the observation in EGF-injected rats.

Fig. 3.

Effect of EGF on the endogenous NHE8 mRNA expression in human intestinal epithelial (Caco-2) cells. Caco-2 cells were cultured in normal medium or EGF-containing medium for 18 h before harvest. RNAs were isolated from these cells and were used for RT-PCR. Real-time PCR was performed with human NHE8 or TBP primers in separate reactions. Results are means ± SE from 3 to 5 separate experiments. *P < 0.01 for control vs. EGF treatment.

Effect of EGF on human NHE8 gene promoter activity.

To explore whether EGF-mediated NHE8 expression downregulation is due to reduced gene transcription, Caco-2 cells were transfected with hNHE8 gene promoter constructs and then treated with 100 ng/ml EGF for 18 h before analyzing promoter activity. As shown in Fig. 4, NHE8 promoter activity was significantly reduced in EGF-treated Caco-2 cells (P < 0.01). About 40% reduction of the promoter activity was seen in all tested hNHE8 gene promoter constructs (pGL3B/-671, pGL3B/-89, and pGL3B/-32).

Fig. 4.

Effect of EGF on human NHE8 gene promoter activity. Cells were cotransfected with pGL3 basic (pGL3b) or human NHE8 promoter constructs (pGL3b/-671, pGL3b/-89, pGL3b/-32) and pRL-CMV. EGF was applied 18 h before harvesting cells for measuring promoter activities. Promoter reporter assay was performed 40 h after transfection. Promoter activity is shown as a relative activity that is a ratio of firefly luciferase activity driven by NHE8 promoter over Renela luciferase activity driven by CMV promoter. The degree of inhibition is shown as the ratio of luciferase activity in EGF-treated cells over luciferase activity in vehicle-treated cells. Results are means ± SE from 6 separate experiments. *P < 0.01 for control vs. EGF treatment.

Identification of transactivation factor and cis-element involved in the EGF response of the hNHE8 promoter.

GMSA method was applied to study the DNA-protein interaction involved in the EGF response. Since pGL3b/-32 contains a GC box and this region recruits Sp3 protein to activate NHE8 gene transcription (35), we want to test whether EGF impairs hNHE8 basal promoter activation by interfering Sp3 binding at this DNA region. GMSA results showed that EGF indeed reduced the DNA-protein interaction at the basal promoter region of the hNHE8 gene (Fig. 5A). Supershift experiments indicated that this DNA/protein complex could be further shifted by Sp3 antibody but not by Sp1 antibody in nuclear protein isolated from control and EGF-treated cells (Fig. 5B).

Fig. 5.

Effect of EGF on DNA/protein interaction at the proximal promoter region of the human NHE8 gene. A: identification of DNA-protein interaction on the basal promoter region of the human NHE8 gene by gel mobility shift assays (GMSAs). Nuclear proteins were isolated from EGF-treated (EGF) and non-EGF-treated (CT) Caco-2 cells. DNA oligos containing GC box region on the minimal promoter region of the human NHE8 gene were end labeled with [³²P]ATP and used as a probe for GMSAs. Results shown are representative of 3 separate experiments. B: identification of the transcriptional factor involving in EGF regulation. DNA Oligos were end-labeled with [³²P]ATP and used as a probe in GMSAs. Nuclear protein was isolated from non-EGF-treated (CT) and EGF-treated (EGF) cells, and GMSAs were performed as indicated in the materials and methods. Sp1 and Sp3 antibodies (4 μg/binding) were used for supershift experiments. The exposure time on supershift GMSAs was longer for EGF-treated cells due to these cells having weaker protein-DNA interaction. SS, supershift DNA-protein interaction complex.

Signaling pathways involved in EGF-mediated NHE8 expression inhibition.

EGFR activation by EGF affects gene expression through various signal transduction pathways. To elucidate the pathway involved in EGF regulation of hNHE8 expression, various EGF receptor-signaling pathway blockers were used. Caco-2 cells were transfected with promoter construct pGL3/-32 bp and pretreated with various inhibitors for 2 h before EGF was added. As shown in Fig. 6, hNHE8 gene promoter activity was reduced ∼40% by 100 ng/ml EGF in transfected Caco-2 cells. Administration of inhibitors SB-202190 (10 μM) and H7 (10 μM) could not restore the inhibitory effect of EGF on NHE8 promoter activity. Administration of UO-126 (25 μM) completely blocked the response of hNHE8 promoter to EGF.

Fig. 6.

Signaling pathway studies of EGF regulation of hNHE8 gene expression. Caco-2 cells were transfected with promoter construct pGL3/-32 bp and pretreated with various inhibitors for 2 h before EGF was added. Relative change is shown as the ratio of luciferase activity in EGF-treated cells to luciferase activity in vehicle-treated cells in the presence or absence of various inhibitors. Results are means ± SE from 4 independent experiments. *P < 0.03 for EGF-, SB-, H7-treated cells vs. others.

DISCUSSION

The intestinal epithelium plays an important role in barrier function, transport of water, nutrients, and electrolytes in a vertical manner. Apically expressed NHEs are major players for electroneutral sodium absorption. NHE isoforms 2, 3, and 8 are expressed in the apical membrane of the intestinal epithelial cells with distinctive patterns. All three isoforms are expressed in the intestine throughout the life of the organism, but NHE8 has the highest expression at a young age, whereas NHE2 and NHE3 both have significantly lower expression at that time (9, 10, 36).

EGF is an important growth factor that is involved in many physiological processes, such as cell growth, tissue injury recovery, and cancers. It is also produced in many tissue types, including the intestine. Loss of EGF or overexpression of EGF cause growth retardation (34). In the intestine, this hormone is known to accelerate intestinal maturation and to enhance Na⁺ absorption (25, 31, 34). Although EGF has been shown to stimulate intestinal NHE2 activity, it was unclear whether EGF affects intestinal NHE8 expression. To decipher the role of EGF on NHE8 expression, we used the young rat as an in vivo model to characterize NHE8 expression in the intestine and Caco-2 cells as an in vitro model to study the mechanism of EGF regulation on NHE8 gene expression. Previous studies showed that EGF not only stimulates NHE2 activity by enhancing NHE2 gene expression in the jejunum (38), it also increases NHE3 expression in the ileum (18). In our present study, we have shown that EGF administration significantly reduced the expression of the ileal NHE8 but not the jejunal NHE8. These observations suggest that the effect of EGF on NHE gene expression is isoform specific and intestinal segment specific. This type of regulation was also seen in glucocorticoids-mediated NHE3 regulation, where glucocorticoids only stimulate NHE3 expression in the jejunum but not in the ileum in young rats (19). The unchanged jejunal NHE8 protein expression after EGF administration suggests that a different regulation mechanism might be involved in the jejunum, such as posttranslational regulation. Future studies will be conducted to address this question. Considering the different expression pattern of NHE2, NHE3, and NHE8 in the intestine and the differential regulation of EGF on these intestinal NHEs, we postulate that EGF may function as a switch to control different NHE isoform expression during intestinal maturation.

We showed that EGF treatment reduced endogenous NHE8 gene expression in Caco-2 cells, with a reduction level similar to what was seen in EGF-treated rats. So EGF is capable of impairing NHE8 function by inhibiting NHE8 expression in the intestine. To address whether the EGF's inhibition of NHE8 expression is at a promoter activity level, we conducted promoter reporter assay in Caco-2 cells transfected with human NHE8 gene promoter constructs. When transfected cells were exposed to EGF the promoter activity was reduced by ∼40%. This reduction is consistent with NHE8 mRNA abundance levels observed in EGF-treated rats and in EGF-treated Caco-2 cells. To identify the promoter region responsive to EGF, various shortened promoter constructs were also tested in Caco-2 cells. EGF treatment significantly reduced promoter activity in all tested human NHE8 gene promoter constructs. These observations suggest that EGF-mediated NHE8 expression inhibition is due to reduced NHE8 promoter activity. EGF most likely acts on the proximal promoter region of the human intestinal NHE8 gene to regulate NHE8 gene transcription.

To locate the DNA region EGF used to downregulate NHE8 gene expression, we isolated nuclear protein from Caco-2 cells and performed GMSAs with DNA oligos spanning the proximal promoter region of the human intestinal NHE8 gene. We found that DNA-protein interaction complexes were formed on the human NHE8 proximal promoter region (−18 bp/+7 bp), and this interaction was reduced after EGF treatment. Since Sp3 transcription factor binds at this DNA region to activate NHE8 expression in Caco-2 cells (35), we hypothesize that Sp3 might involve in this regulation. Supershift indicated that the transcription factor bound at the human NHE8 proximal promoter region was indeed Sp3. These results suggest that EGF reduces NHE8 gene expression by inhibiting basal promoter activation through reducing Sp3 binding at the NHE8 basal promoter region. Interestingly, Sp3 is also the basal activator for NHE2 and NHE3 gene expression in the intestine (14, 20). The isoform-specific effect of EGF may be a result of decreasing Sp3 affinity for NHE8 promoter region to make more Sp3 protein available for other NHE gene promoters. It is logical to conclude that EGF-mediated effects are increased during maturation, so the isoform-specific regulation of NHEs may explain the expression changes of NHE2 and NHE8 during intestinal development. In turn, Sp3 availability to NHE gene promoters may contribute to NHE expression patterns during intestinal maturation.

Although Sp3 has been shown to be phosphorylated by protein kinase A (PKA) in NHE3 expression regulation in C2BBe (1), we do not know whether a similar mechanism is involved in EGF-mediated NHE8 regulation. In our experiments, we found that neither the administration of H7, a potent inhibitor of both protein kinase C (PKC) and cAMP-dependent PKA, nor the administration of SB-202190, an inhibitor of p38 MAPK, could block the inhibitory effect of EGF on NHE8 promoter activity. Therefore, it is unlikely that the protein kinase activation pathway and the p38 MAPK pathway are involved in this regulation. However, cotreatment of EGF and UO-126, an inhibitor of MEK, restores NHE8 promoter activity suggesting that EGF-mediated downregulation of NHE8 is through activation of MEK pathway (Fig. 7).

Fig. 7.

EGF regulation on intestinal NHE8. In the intestinal epithelial cells, EGF binds to EGF receptor (EGFR) and activates mitogen-activated protein kinase (MAPK) pathway. Activated ERK reduces Sp3 binding at the NHE8 promoter region. This ultimately results in the reduced NHE8 gene expression in the intestinal epithelial cells.

In summary, we have shown that the intestinal NHE8 expression is reduced in rats treated with EGF. We also showed that Sp3 is a key transcriptional factor involved in EGF-mediated NHE8 gene expression downregulation in Caco-2 cells. Inhibition of NHE8 by EGF is through the activation of the MEK pathway. Furthermore, EGF may regulate different NHE isoform expression by altering Sp3 binding on their basal promoter regions. Our work adds new insight on understanding the hormonal regulation of NHE8 under normal physiological conditions. These studies also suggest that a single factor, EGF, might regulate switches in the expression of NHEs during intestinal maturation.

GRANTS

This investigation was funded by National Institutes of Health Grant R01-DK073638.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).