Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Apr 1.
Published in final edited form as: FEMS Microbiol Lett. 2010 Feb 9;305(2):177–183. doi: 10.1111/j.1574-6968.2010.01926.x

Polar localization of the Coxiella burnetii Type IVB Secretion System

J Kent Morgan 1,†, Brandon E Luedtke 1,†, Edward I Shaw 1,*
PMCID: PMC2908181  NIHMSID: NIHMS191481  PMID: 20199576

Abstract

Coxiella burnetii is a Gram-negative pleomorphic bacterium and the causative agent of Q fever. During infection, the pathogen survives and replicates within a phagosome-like parasitophorous vacuole while influencing cellular functions throughout the host cell, indicating a capacity for effector protein secretion. Analysis of the C. burnetii (RSA 493 strain) genome sequence indicates that C. burnetii contains genes with homology to the Legionella pneumophila Dot/Icm type IVB secretion system (T4BSS). T4BSSs have only been described in L. pneumophila and C. burnetii, marking it as a unique virulence determinate. Characterization of bacterial virulence determinants ranging from autotransporter proteins to diverse secretion systems suggests that polar localization may be a virulence mechanism hallmark. To characterize T4BSS subcellular localization in C. burnetii, we analyzed C. burnetii infected Vero cells by indirect immunofluorescent antibody (IFA) and immunoelectron microscopy. Using antibodies against the C. burnetii T4BSS homologues IcmT, IcmV, and DotH, IFA show these proteins are localized to the poles of the bacterium. Immunoelectron microscopy supports this finding, showing that antibodies against C. burnetii IcmT and DotH preferentially localize to the bacterial cell pole(s). Together, these data demonstrate that the C. burnetii T4BSS localizes to the pole(s) of the bacterium during infection of host cells.

Keywords: Coxiella, Type four secretion system, polar localization, obligate intracellular

Introduction

The zoonotic disease Q fever is caused by Coxiella burnetii, an obligate intracellular bacterial pathogen (Maurin & Raoult, 1999) that has only recently been propagated in a cell-free media (Omsland, et al., 2009). C. burnetii undergoes a biphasic life cycle initiated by the metabolically inactive, environmentally stable Small Cell Variant (SCV) form of the bacteria. The SCV then goes on to develop into the replicative Large Cell Variant (LCV) form. This may occur with 8 hours of host cell infection (McCaul, 1991, Coleman, et al., 2004). During the infectious cycle, C. burnetii lives within a parasitophorous vacuole (PV) that has attributes of a mature phagolysosome (Akporiaye, et al., 1983, Heinzen, et al., 1996, Ghigo, et al., 2002, Gutierrez, et al., 2005, Sauer, et al., 2005, Howe & Heinzen, 2006, Romano, et al., 2007). Recent studies indicate that C. burnetii protein synthesis is required for the pathogen to influence host cell processes such as apoptosis (Voth & Heinzen, 2009) and vesicular trafficking (Howe, et al., 2003, Howe, et al., 2003) from within the PV. A possible explanation for this ability was discovered during analysis of the C. burnetii strain (RSA493) Nine Mile phase I genomic sequence, which revealed a set of genes with significant homology to the Dot/Icm type IV secretion system (T4BSS) of Legionella pneumophila. In L. pneumophila, the T4BSS system consists of twenty-six ORFs of which twenty-three share significant homology with C. burnetii ORFs (Seshadri, et al., 2003). Studies show that the L. pneumophila T4BSS is required for intracellular survival, effector protein secretion, and replication within host cells (Marra, et al., 1992, Berger & Isberg, 1993, Vogel, et al., 1998, Bruggemann, et al., 2006, Ninio & Roy, 2007, Kubori, et al., 2008, Shin & Roy, 2008) thus playing a vital role in the infectious process of L. pneumophila. Moreover, the genome sequence revealed C. burnetii ORFs containing eukaryotic Ankyrin binding repeat domains (Pan, et al., 2008, Voth, et al., 2009). Subsequently, these ORFs were shown to be secreted by L. pneumophila in a T4BSS dependant manner (Pan, et al., 2008, Voth, et al., 2009), further implicating the C. burnetii T4BSS as a significant contributor to cellular pathogenesis, yet characterization of the T4BSS structure in C. burnetii is lacking..

In general, Type IV secretion systems serve to export virulence factors, which include nucleoprotein complexes and effector proteins, into a host or into the extracellular milieu (Christie & Vogel, 2000, Sexton & Vogel, 2002, Cascales & Christie, 2003). Type IV secretion systems have been subdivided into two families, (i) the VirB/D4 (T4ASS) and (ii) the Dot/Icm (T4BSS) systems (Christie & Vogel, 2000). The T4ASS of Agrobacterium tumefaciens directly injects effector molecules into adjacent cells (Christie & Vogel, 2000) as well as into the extracellular environment (Dillard & Seifert, 2001, Hofreuter, et al., 2001). Interestingly, VirB8, part of the core complex, was reported to localize at the pole of A. tumefaciens cells (Kumar, et al., 2000), and the bacterium attaches to host plant cells perpendicular to the bacterial poles (Matthysse, 1987). In L. pneumophila, the T4BSS is essential for cellular pathogenesis via secretion of effector proteins into a host cell (Sexton & Vogel, 2002, Christie, et al., 2005). In L. pneumophila, the T4BSS component, DotF, appears to demonstrate polar localization (Jeong, 2006).

Virulence factors localize or are dispersed about the pole(s) of a wide range of bacteria, and include alternate secretion systems, effector protein molecules, and surface membrane-associated proteins. Evidence suggests that the type III secretion system of Shigella flexneri is present at the poles of the bacteria prior to the secretion of IpaC (Jaumouille, et al., 2008). Recently, the Mycobacterium marinum Esx-1 type VII secretion system was shown to secrete Mh3864 at the poles and that a core Esx-1 component, Mh3870, localized preferentially to the poles (Carlsson, et al., 2009). Analysis of essential Type V autotransporter secretion proteins showed AIDA-I (Escherichia coli), BrkA (Bordetella pertussis), IcsA and SepA (Shigella flexneri), to localize at the cell pole(s) (Jain, et al., 2006). The NalP autotransporter from Neisseria meningitidis localizes to the poles of E. coli during heterologous expression of the protein (Jain, et al., 2006). In addition, the Listeria monocytogenes surface protein ActA localizes to the bacterial pole where it is involved in actin-based motility (Rafelski & Theriot, 2006). These examples indicate that an array of bacterial virulence stratagems employ polar localization as a means to secrete effector proteins into host cells.

C. burnetii’s ability to affect host cell function while sequestered in the PV, and the lack of understanding of its T4BSS structure, led us to investigate the subcellular localization of the C. burnetii T4BSS. Using antibodies specific to the C. burnetii IcmT, IcmV, and DotH homologs, indirect immunofluorescent antibody (IFA) assays demonstrated that IcmT, IcmV, and DotH localized to one or both poles of the bacterium. We confirmed these findings with immunoelectron microscopy (IEM). To our knowledge, this is the first demonstration of the specific subcellular localization of this virulence machinery during C. burnetii infection.

Materials and Methods

Bacterial cultivation and purification

Coxiella burnetii Nine Mile Phase II Clone 4 (NMII) was propagated in African green monkey kidney (Vero) cells in RPMI 1640 medium, 5% fetal bovine serum (FBS) at 37°C in an atmosphere of 5% CO2, and the Small Cell Variant form of the organism was isolated as previously described (Coleman, et al., 2004). The SCVs were resuspended in SPG buffer (0.7 M sucrose, 3.7 mM KH2PO4, 6.0 mM K2HPO4, 0.15 M KCl, 5.0 mM glutamic acid, pH 7.4) and stored at −80°C. C. burnetii genome equivalents were calculated using qPCR (Brennan & Samuel, 2003).

Cell culture and infection

Uninfected Vero cells were propagated as described in medium containing 20 μg/ml gentamicin. The medium was exchanged with fresh RPMI 1640, 5% FBS without antibiotics two hours prior to bacterial infection. Vero cells were infected with C. burnetii NMII using a genome equivalent MOI of 100. Infections were propagated as described for 3 weeks with periodic medium changes and maintenance of cell confluency as needed.

Expression plasmid construction

Oligonucleotide primers used for the PCR amplification of icmT, icmV, and dotH from C. burnetii NMII genomic DNA were, icmT: 5′– CACCATGAAATCTCTCGATGAGG (Forward) and 5′ – TTAGTTATCCCACCATGCTATGG (Reverse), icmV: 5′ – CACCATGATTCTTTTGGAGTCTTCC (Forward) and 5′ –TTATTGTTTGGACCCCTTAAAGGTG (Reverse), dotH: 5′ –CACCATGGTGATTCGAAAAATTTTCC (Forward) and 5′ –TTACAACCCTTCAATCATCAAC (Reverse). Underlined and italicized bases, CACC and TTA, are non-C. burnetii sequences used for directional cloning and stop codon insertion, respectively. PCR products from each gene were ligated into the pET200/D-TOPO vector and transformed into E. coli TOP10 cells according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Selected clones were cultivated at 37° C in Luria-Bertani (LB) broth containing 50 μg/ml Kanamycin and sequence verified. The clones were designated GA39 (icmT), GA44 (icmV), and GA36 (dotH).

Recombinant protein purification

Plasmids pGA39, pGA44, and pGA36 were electroporated into E. coli BL21 (DE3) cells and recombinant protein expression was induced with 1 mM IPTG following the manufacturer’s instructions (Invitrogen). Induced E. coli BL21 cells were then pelleted by centrifugation at 6,000×g for 20 minutes and disrupted in lysis buffer (50 mM Tris, 200 mM NaCl) using sonication. Inclusion bodies were pelleted at 27,000×g for 15 minutes and then solubilized using a modification to the previously described method (Burgess, 1996). Briefly, inclusion body pellets were washed in lysis buffer containing 10% (v/v) sodium lauroyl sarcosinate (sarkosyl). The repelleted inclusion bodies were then solubilized using 0.3% sarkosyl in Tris buffer (50 mM Tris, 300 mM NaCl) and allowed to incubate at room temperature with agitation. Insoluble particulates were removed by centrifugation at 20,400×g for 15 minutes. The solubilized His-tagged proteins were purified using nickel chelation chromatography according to the manufacturer’s instructions (Thermo Fisher Scientific, Rockford, IL). SDS-PAGE gels and mass spectrometry analysis (Oklahoma State University Recombinant DNA/Protein Core Facility) was used to confirm that the purified recombinant protein fractions contained the target protein. The quantity of purified recombinant proteins were determined using a BCA™ protein assay kit according to the manufacture’s specifications (Pierce, Rockford, IL). Purified recombinant proteins were stored at −80°C.

Antibody production and purification

The production of polyclonal antibodies against recombinant IcmT, IcmV, and DotH protein was performed in accordance with the Oklahoma State University Institutional Animal Care and Use Committee guidelines. Briefly, New Zealand White rabbits were innoculated with 1 mg/ml of recombinant protein in Freund’s complete adjuvant (Sigma-Aldrich). Subsequent innoculations used Freund’s incomplete adjuvant. IgG antibodies were preferentially enriched from serum using a Pierce Protein-A cross-linked agarose bead kit according to the manufacturer’s instructions (Pierce). Each antibody was then dialyzed against PBS and concentrated using iCON™ spin concentrators (Pierce). The antibodies were then absorbed against E. coli BL21 (DE3) cells previously fixed in PBS, 4% (v/v) paraformaldehyde, 0.05% (v/v) Tween-20. IFA and immunoblotting were used to confirm antibody titer, and protein specificity (Data not shown).

IFA analysis

Vero cells infected with C. burnetii NMII as previously described were seeded (105 cells) on 12 mm glass coverslips in 24 well tissue culture plates and allowed to adhere overnight. Adherent cells were then fixed in PBS, 4% (v/v) paraformaldehyde, 0.05% (v/v) Tween-20 for 15 minutes at room temperature. IFA analyses were performed by dual staining using guinea pig antibody against formalin killed C. burnetii NMII and rabbit antibodies against either C. burnetii IcmT, IcmV, or DotH. Secondary antibodies used were goat anti-guinea pig IgG Alexa Fluor® 555 and goat anti-rabbit IgG Alexa Fluor® 488 (Molecular Probes, Eugene, OR). To stain bacterial and Vero cell nucleic acids, 4′, 6-diamidino-2-phenylindole (DAPI) was included during the secondary incubation. Micrograph images were captured using a Nikon DS FI1 camera on a Nikon Eclipse TE 2000-S microscope at 600× magnification, with NIS-Elements F 3.00 software. All micrograph size and merge functions were performed universally for the associated micrographs using ImageJ version 1.42n (Wayne Rasband, NIH).

EM analysis

To observe the localization of IcmT, IcmV, and DotH at the ultra-structural level, infected Vero cells as previously described were prepared for IEM. To do this, infected cells were trypsinized, pelleted, and fixed on ice for 1 hour in PBS, 4% paraformaldehyde (v/v), 0.05% glutaraldehyde (v/v). The Imaging Facility in the Department of Molecular Microbiology Center for Infectious Disease Research, Washington University, St. Louis, MO, performed the subsequent sample processing and IEM analyses following published techniques (Presti, et al., 2009). After incubation with primary antibodies against IcmT, IcmV, and DotH, respectively, sections were then washed in blocking buffer and probed with anti-rabbit IgG (H+L) conjugated to 18 nm colloidal gold (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) for 1 hour at room temperature. After extensive buffer washing, water rinse and uranyl acetate and lead citrate staining, samples were viewed with a JEOL 1200EX transmission electron microscope (JEOL USA Inc., Peabody, MA). The labeling experiments were conducted in parallel with controls omitting the primary antibody. These controls were consistently negative at the concentration of colloidal gold conjugated secondary antibodies used in these studies. C. burnetii-infected Vero cells were fixed with 2.5% paraformaldehyde (v/v)/2.5% glutaraldehyde (v/v) for transmission electron microscopic analysis as previously described (Belland, et al., 2003).

Results and Discussion

In an effort to determine the subcellular localization of the C. burnetii T4BSS, IFA analyses using antibodies against IcmT, IcmV, and DotH, respectively, were employed. Continuously infected cells were used in this analysis in an effort to observe all possible aspects of the C. burnetii infectious cycle, which includes newly infected cells, cells at mid-infection, and cells at or near lysis. IFA microscopy of C. burnetii infected Vero cells shows bacterial cells with both polar and bi-polar localization of theT4BSS proteins as indicated by fluorescence of the protein specific antibodies (Fig. 1A–D). Polar localization of the C. burnetii T4BSS proteins is readily discernable in the enlarged panels (Figure 1, panel B and panels C and D insets, arrows). In addition, we observe bi-polar localization in approximately 60% of the cells that demonstrate polarity (Fig. 1, panel B). While cell specific localization was difficult to differentiate in densely populated PVs; polarity was readily detectable in spacious PVs (Fig. 1, panels A–D).

Fig. 1. IFA localization of Coxiella burnetii NMII IcmT, IcmV, and DotH.

Fig. 1

Open in a new tab

Panels A–D are representative IFAs of 3 weeks post infection cell cultures. Panel A-Merged IFA micrograph showing whole C. burnetii cells in red, IcmT in green, and Vero cell nucleus in blue (DAPI stain). Panel B is an enlargement of the outlined section of Panel A. Panel C, the merged image showing IcmV localization. Panel D, the merged image showing DotH localization. Enlargements of isolate cells are shown within inset panels for IcmV, and DotH, within Panels C and D, respectively.

To increase resolution of the IFA observations, C. burnetii infected Vero cells were analyzed by IEM using C. burnetii IcmT, IcmV, and DotH specific antibodies. IEM analyses revealed polar localization of the gold-particle conjugated secondary antibodies to one or both poles of C. burnetii cells when using antibodies against IcmT and DotH (Fig. 2). Interestingly, based on the length of a C. burnetii LCV (0.5 to 1.0 μm), the IEM staining of IcmT and DotH indicates that the polar localization is primarily observed on LCVs using this methodology (Fig. 2), (McCaul & Williams, 1981, McCaul, 1991, Heinzen, et al., 1999). Attempts to obtain conclusive IEM results for IcmV localization were unsuccessful, however, both IcmT and DotH clearly localized to the bacterial pole(s), thus supporting the IFA observations.

Fig. 2. IEM localization of Coxiella burnetii NMII IcmT and DotH.

Fig. 2

Open in a new tab

Panels A and B -Representative IEM micrographs of C. burnetii infected Vero cells probed with antibodies to IcmT. Panels C and D - Representative IEM micrographs of C. burnetii infected Vero cells probed with antibodies to DotH. Black arrows indicate immune-gold particles at the ends of C. burnetii cells. Size bars are indicated.

Using Vero cell cultures infected with C. burnetii NMII for 3 weeks allowed for ready identification of T4BSS polar localization by IEM; however, biological questions remain about the ultrastructure of the T4BSS. Does the C. burnetii T4BSS initially localize medial to the polar region(s) and then migrate laterally to the poles during the course of cellular development, or does it initially nucleate at the pole(s) and recruit other T4BSS components to the nucleation site. The IEM images show immuno reactivity at sites somewhat medial to the C. burnetii cell pole (Fig. 2, panel B), making this a possibility. Another observation is that the T4BSS of C. burnetii may localize on one or both pole(s) of the bacterium. The bi-polar localization of the T4BSS on C. burnetii cells may correlate to cells that are approaching cell division. In such a case, the bipolar localization would ensure that daughter cells are equipped with the components for a functional T4BSS after binary fission, hence, the observation of bacteria with T4BSS localized at a single pole (Fig. 1 and 2).

The utility of having the T4BSS localized on the pole(s) of C. burnetii cells and how this relates to the pathogen’s interactions with the host cell is not clear. The observation that A. tumefaciens intimately interfaces with a host cell at the bacterial pole (Matthysse, 1987) and that this T4ASS machinery then secretes effector molecules into the host (Christie & Vogel, 2000) would indicate that direct association of a T4SS with a membrane may allow effector secretion across/into the membrane. An analogous interface between pathogen and membrane has been observed in the intra-vacuolar pathogen Chlamydia trachomatis, which secretes effector proteins into the host cell via a Type III Secretion System (T3SS) (Fields, et al., 2003) and closely associates with the PV membrane during infection (Matsumoto, 1988, Hackstadt, et al., 1997). An obvious and consistent interface between a pole of C. burnetii and the PV membrane has not been demonstrated. However, a study of published EM micrographs (McCaul, 1991, Coleman, et al., 2004, Voth & Heinzen, 2007) including our own (Fig. 3) indicates that instances occur where the poles of C. burnetii are in contact with the PV membrane. It has been suggested that C. burnetii-PV membrane contact may be required for effector secretion (Voth & Heinzen, 2007). In a C. burnetii dense PV, determining whether these are simply random events, or whether the transient association of the bacterial pole with the PV could allow C. burnetii to secrete effector proteins into/through the PV membrane remains to be determined. Additional studies defining the temporal nature of C. burnetii T4BSS expression and polar localization will aid in the understanding of this crucial virulence determinant.

Fig. 3. Electron micrograph of Coxiella burnetii dense PV.

Fig. 3

Open in a new tab

Box Inset: Arrows indicate C. burnetii cells with poles adjacent to the PV membrane boundary. Size bar is 1.0-micron.

In summary, our studies provide the first known evidence that the C. burnetii T4BSS localizes at one or both poles of the bacterium during infection. The combined IFA and IEM analyses revealed C. burnetii with single or bi-polar localization of the T4BSS homologs IcmT, IcmV, and DotH. The polar expression of the C. burnetii T4BSS may prove itself to be crucial to the pathogens ability to secrete effector proteins into or across the PV membrane.

Acknowledgments

We wish to thank Dr. Wandy Beatty, Washington University School of Medicine, for technical expertise and advice on the immunoelectron microscopy analysis. We also thank Dr. Wendy Picking and Dr. Bill Picking for the critical reading of this manuscript.

This research was supported by National Institutes of Health grant R15 A1072710 (E.I.S.).

References

  1. Akporiaye ET, Rowatt JD, Aragon AA, Baca OG. Lysosomal response of a murine macrophage-like cell line persistently infected with Coxiella burnetii. Infect Immun. 1983;40:1155–1162. doi: 10.1128/iai.40.3.1155-1162.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Belland RJ, Zhong G, Crane DD, et al. Genomic transcriptional profiling of the developmental cycle of Chlamydia trachomatis. Proc Natl Acad Sci U S A. 2003;100:8478–8483. doi: 10.1073/pnas.1331135100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Berger KH, Isberg RR. Two distinct defects in intracellular growth complemented by a single genetic locus in Legionella pneumophila. Mol Microbiol. 1993;7:7–19. doi: 10.1111/j.1365-2958.1993.tb01092.x. [DOI] [PubMed] [Google Scholar]
  4. Brennan RE, Samuel JE. Evaluation of Coxiella burnetii antibiotic susceptibilities by real-time PCR assay. J Clin Microbiol. 2003;41:1869–1874. doi: 10.1128/JCM.41.5.1869-1874.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bruggemann H, Cazalet C, Buchrieser C. Adaptation of Legionella pneumophila to the host environment: role of protein secretion, effectors and eukaryotic-like proteins. Curr Opin Microbiol. 2006;9:86–94. doi: 10.1016/j.mib.2005.12.009. [DOI] [PubMed] [Google Scholar]
  6. Burgess RR. Purification of overproduced Escherichia coli RNA polymerase sigma factors by solubilizing inclusion bodies and refolding from Sarkosyl. Methods Enzymol. 1996;273:145–149. doi: 10.1016/s0076-6879(96)73014-8. [DOI] [PubMed] [Google Scholar]
  7. Carlsson F, Joshi SA, Rangell L, Brown EJ. Polar localization of virulence-related Esx-1 secretion in mycobacteria. PLoS Pathog. 2009;5:e1000285. doi: 10.1371/journal.ppat.1000285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cascales E, Christie PJ. The versatile bacterial type IV secretion systems. Nat Rev Microbiol. 2003;1:137–149. doi: 10.1038/nrmicro753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Christie PJ, Vogel JP. Bacterial type IV secretion: conjugation systems adapted to deliver effector molecules to host cells. Trends Microbiol. 2000;8:354–360. doi: 10.1016/s0966-842x(00)01792-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Christie PJ, Atmakuri K, Krishnamoorthy V, Jakubowski S, Cascales E. Biogenesis, architecture, and function of bacterial type IV secretion systems. Annu Rev Microbiol. 2005;59:451–485. doi: 10.1146/annurev.micro.58.030603.123630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Coleman SA, Fischer ER, Howe D, Mead DJ, Heinzen RA. Temporal analysis of Coxiella burnetii morphological differentiation. J Bacteriol. 2004;186:7344–7352. doi: 10.1128/JB.186.21.7344-7352.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dillard JP, Seifert HS. A variable genetic island specific for Neisseria gonorrhoeae is involved in providing DNA for natural transformation and is found more often in disseminated infection isolates. Mol Microbiol. 2001;41:263–277. doi: 10.1046/j.1365-2958.2001.02520.x. [DOI] [PubMed] [Google Scholar]
  13. Fields KA, Mead DJ, Dooley CA, Hackstadt T. Chlamydia trachomatis type III secretion: evidence for a functional apparatus during early-cycle development. Mol Microbiol. 2003;48:671–683. doi: 10.1046/j.1365-2958.2003.03462.x. [DOI] [PubMed] [Google Scholar]
  14. Ghigo E, Capo C, Tung CH, Raoult D, Gorvel JP, Mege JL. Coxiella burnetii survival in THP-1 monocytes involves the impairment of phagosome maturation: IFN-gamma mediates its restoration and bacterial killing. J Immunol. 2002;169:4488–4495. doi: 10.4049/jimmunol.169.8.4488. [DOI] [PubMed] [Google Scholar]
  15. Gutierrez MG, Vazquez CL, Munafo DB, Zoppino FC, Beron W, Rabinovitch M, Colombo MI. Autophagy induction favours the generation and maturation of the Coxiella-replicative vacuoles. Cell Microbiol. 2005;7:981–993. doi: 10.1111/j.1462-5822.2005.00527.x. [DOI] [PubMed] [Google Scholar]
  16. Hackstadt T, Fischer ER, Scidmore MA, Rockey DD, Heinzen RA. Origins and functions of the chlamydial inclusion. Trends Microbiol. 1997;5:288–293. doi: 10.1016/S0966-842X(97)01061-5. [DOI] [PubMed] [Google Scholar]
  17. Heinzen RA, Hackstadt T, Samuel JE. Developmental biology of Coxiella burnettii. Trends Microbiol. 1999;7:149–154. doi: 10.1016/s0966-842x(99)01475-4. [DOI] [PubMed] [Google Scholar]
  18. Heinzen RA, Scidmore MA, Rockey DD, Hackstadt T. Differential interaction with endocytic and exocytic pathways distinguish parasitophorous vacuoles of Coxiella burnetii and Chlamydia trachomatis. Infect Immun. 1996;64:796–809. doi: 10.1128/iai.64.3.796-809.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hofreuter D, Odenbreit S, Haas R. Natural transformation competence in Helicobacter pylori is mediated by the basic components of a type IV secretion system. Mol Microbiol. 2001;41:379–391. doi: 10.1046/j.1365-2958.2001.02502.x. [DOI] [PubMed] [Google Scholar]
  20. Howe D, Heinzen RA. Coxiella burnetii inhabits a cholesterol-rich vacuole and influences cellular cholesterol metabolism. Cell Microbiol. 2006;8:496–507. doi: 10.1111/j.1462-5822.2005.00641.x. [DOI] [PubMed] [Google Scholar]
  21. Howe D, Melnicakova J, Barak I, Heinzen RA. Fusogenicity of the Coxiella burnetii parasitophorous vacuole. Ann N Y Acad Sci. 2003;990:556–562. doi: 10.1111/j.1749-6632.2003.tb07426.x. [DOI] [PubMed] [Google Scholar]
  22. Howe D, Melnicakova J, Barak I, Heinzen RA. Maturation of the Coxiella burnetii parasitophorous vacuole requires bacterial protein synthesis but not replication. Cell Microbiol. 2003;5:469–480. doi: 10.1046/j.1462-5822.2003.00293.x. [DOI] [PubMed] [Google Scholar]
  23. Jain S, van Ulsen P, Benz I, Schmidt MA, Fernandez R, Tommassen J, Goldberg MB. Polar localization of the autotransporter family of large bacterial virulence proteins. J Bacteriol. 2006;188:4841–4850. doi: 10.1128/JB.00326-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Jaumouille V, Francetic O, Sansonetti PJ, Tran Van Nhieu G. Cytoplasmic targeting of IpaC to the bacterial pole directs polar type III secretion in Shigella. EMBO J. 2008;27:447–457. doi: 10.1038/sj.emboj.7601976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jeong KC, Vincent CD, Buford E, Vogel JP. Subcellular localization of the Dot/Icm Type IV Secretion Proteins. In: Cianciotto NP, Kwaik YA, Edelstein PH, Fields BS, Geary DF, Harrison TG, Joseph CB, Ratcliff RM, Stout JE, editors. Legionella: State of the Art 30 Years After Its Recognition. ASM Press; 2006. pp. 192–194. [Google Scholar]
  26. Kubori T, Hyakutake A, Nagai H. Legionella translocates an E3 ubiquitin ligase that has multiple U-boxes with distinct functions. Mol Microbiol. 2008;67:1307–1319. doi: 10.1111/j.1365-2958.2008.06124.x. [DOI] [PubMed] [Google Scholar]
  27. Kumar RB, Xie YH, Das A. Subcellular localization of the Agrobacterium tumefaciens T-DNA transport pore proteins: VirB8 is essential for the assembly of the transport pore. Mol Microbiol. 2000;36:608–617. doi: 10.1046/j.1365-2958.2000.01876.x. [DOI] [PubMed] [Google Scholar]
  28. Marra A, Blander SJ, Horwitz MA, Shuman HA. Identification of a Legionella pneumophila locus required for intracellular multiplication in human macrophages. Proc Natl Acad Sci U S A. 1992;89:9607–9611. doi: 10.1073/pnas.89.20.9607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Matsumoto A. Structural characteristics of chlamydial bodies. In: Barron AL, editor. Microbiology of Chlamydia. CRC Press; Boca Ratan, FL: 1988. pp. 21–45. [Google Scholar]
  30. Matthysse AG. Characterization of nonattaching mutants of Agrobacterium tumefaciens. J Bacteriol. 1987;169:313–323. doi: 10.1128/jb.169.1.313-323.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Maurin M, Raoult D. Q fever. Clin Microbiol Rev. 1999;12:518–553. doi: 10.1128/cmr.12.4.518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. McCaul TF. The developmental cycle of Coxiella burnetii. In: Williams JC, Thompson HA, editors. Q Fever: The Biology of Coxiella burnetii. CRC Press; Boca Raton, Fl: 1991. pp. 223–258. [Google Scholar]
  33. McCaul TF. The Developmental Cycle of Coxiella burnetii. In: Williams JC, Thompson HA, editors. Q Fever: The Biology of Coxiella burnetii. CRC Press; Boca Ratan, FL: 1991. pp. 223–258. [Google Scholar]
  34. McCaul TF, Williams JC. Developmental cycle of Coxiella burnetii: structure and morphogenesis of vegetative and sporogenic differentiations. J Bacteriol. 1981;147:1063–1076. doi: 10.1128/jb.147.3.1063-1076.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Ninio S, Roy CR. Effector proteins translocated by Legionella pneumophila: strength in numbers. Trends Microbiol. 2007;15:372–380. doi: 10.1016/j.tim.2007.06.006. [DOI] [PubMed] [Google Scholar]
  36. Omsland A, Cockrell DC, Howe D, et al. Host cell-free growth of the Q fever bacterium Coxiella burnetii. Proc Natl Acad Sci U S A. 2009;106:4430–4434. doi: 10.1073/pnas.0812074106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Pan X, Luhrmann A, Satoh A, Laskowski-Arce MA, Roy CR. Ankyrin repeat proteins comprise a diverse family of bacterial type IV effectors. Science. 2008;320:1651–1654. doi: 10.1126/science.1158160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Presti RM, Zhao G, Beatty WL, et al. Quaranfil, Johnston Atoll, and Lake Chad viruses are novel members of the family Orthomyxoviridae. J Virol. 2009;83:11599–11606. doi: 10.1128/JVI.00677-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Rafelski SM, Theriot JA. Mechanism of polarization of Listeria monocytogenes surface protein ActA. Mol Microbiol. 2006;59:1262–1279. doi: 10.1111/j.1365-2958.2006.05025.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Romano PS, Gutierrez MG, Beron W, Rabinovitch M, Colombo MI. The autophagic pathway is actively modulated by phase II Coxiella burnetii to efficiently replicate in the host cell. Cell Microbiol. 2007;9:891–909. doi: 10.1111/j.1462-5822.2006.00838.x. [DOI] [PubMed] [Google Scholar]
  41. Sauer JD, Shannon JG, Howe D, Hayes SF, Swanson MS, Heinzen RA. Specificity of Legionella pneumophila and Coxiella burnetii vacuoles and versatility of Legionella pneumophila revealed by coinfection. Infect Immun. 2005;73:4494–4504. doi: 10.1128/IAI.73.8.4494-4504.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Seshadri R, Paulsen IT, Eisen JA, et al. Complete genome sequence of the Q-fever pathogen Coxiella burnetii. Proc Natl Acad Sci U S A. 2003;100:5455–5460. doi: 10.1073/pnas.0931379100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Sexton JA, Vogel JP. Type IVB secretion by intracellular pathogens. Traffic. 2002;3:178–185. doi: 10.1034/j.1600-0854.2002.030303.x. [DOI] [PubMed] [Google Scholar]
  44. Shin S, Roy CR. Host cell processes that influence the intracellular survival of Legionella pneumophila. Cell Microbiol. 2008;10:1209–1220. doi: 10.1111/j.1462-5822.2008.01145.x. [DOI] [PubMed] [Google Scholar]
  45. Vogel JP, Andrews HL, Wong SK, Isberg RR. Conjugative transfer by the virulence system of Legionella pneumophila. Science. 1998;279:873–876. doi: 10.1126/science.279.5352.873. [DOI] [PubMed] [Google Scholar]
  46. Voth DE, Heinzen RA. Lounging in a lysosome: the intracellular lifestyle of Coxiella burnetii. Cell Microbiol. 2007;9:829–840. doi: 10.1111/j.1462-5822.2007.00901.x. [DOI] [PubMed] [Google Scholar]
  47. Voth DE, Heinzen RA. Sustained activation of Akt and Erk1/2 is required for Coxiella burnetii antiapoptotic activity. Infect Immun. 2009;77:205–213. doi: 10.1128/IAI.01124-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Voth DE, Howe D, Beare PA, Vogel JP, Unsworth N, Samuel JE, Heinzen RA. The Coxiella burnetii ankyrin repeat domain-containing protein family is heterogeneous, with C-terminal truncations that influence Dot/Icm-mediated secretion. J Bacteriol. 2009;191:4232–4242. doi: 10.1128/JB.01656-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES