Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Jul 25.
Published in final edited form as: Cancer Biol Ther. 2010 Jan 21;9(2):122–133. doi: 10.4161/cbt.9.2.10379

Impairment of mitochondrial respiration in mouse fibroblasts by oncogenic H-RASQ6IL

Dianer Yang 1,†, Man-Tzu Wang 1,†, Yong Tang 1, Yakun Chen 1, Hongmei Jiang 1, Torrie T Jones 1, Krishna Rao 2, Gregory J Brewer 1, Keshav K Singh 3, Daotai Nie 1,*
PMCID: PMC2909490  NIHMSID: NIHMS217071  PMID: 19923925

Abstract

A common metabolic change in cancer is the acquisition of glycolytic phenotypes. Increased expression of glycolytic enzymes is considered as one contributing factor. The role of mitochondrial defects in acquisition of glycolytic phenotypes has been postulated but remains controversial. Here we show that functional defects in mitochondrial respiration could be induced by oncogenic H-RasQ61L transformation, even though the mitochondrial contents or mass was not reduced in the transformed cells. First, mitochondrial respiration, as measured by mitochondrial oxygen consumption, was suppressed in NIH-3T3 cells transformed with H-RasQ61L. Second, oligomycin or rotenone did not reduce the cellular ATP levels in the H-RasQ61L transformed cells, suggesting a diminished role of mitochondrial respiration in the cellular energy metabolism. Third, inhibition of glycolysis with iodoacetic acid reduced ATP levels at a much faster rate in H-RasQ61L transformed cells than in the vector control cells. The reduction of cellular ATP levels was reversed by exogenously added pyruvate in the vector control cells but not in H-RasQ61L transformed cells. Finally when compared to the HRasQ61L transformed cells, the vector control cells had increased resistance toward glucose deprivation. The increased resistance was dependent on mitochondrial oxidative phosphorylation since rotenone or oligomycin abolished the increased survival of the vector control cells under glucose deprivation. The results also suggest an inability of the H-RasQ61L transformed cells to reactivate mitochondrial respiration under glucose deprivation. Taken together, the data suggest that mitochondrial respiration can be impaired during transformation of NIH-3T3 cells by oncogeneic H-RasQ61L.

Keywords: Ras, mitochondrial respiration, glycolysis, Electron transport chain, complex IV, transformation, cellular energy metabolism, ATP

Introduction

Pioneering studies by Warburg over seven decades ago demonstrated that a vast majority of human and animal tumors display a high rate of glycolysis under aerobic conditions, a phenomenon known as the Warburg effect.1,2 The preferential utilization of aerobic glycolysis for cellular energy needs by cancer cells has been confirmed in a wide spectrum of cancers and successfully developed for tumor imaging with [18F] fluorodeoxyglucose positron emission tomography.3,4 Contributing factors toward acquisition of glycolytic phenotypes by cancer cells include, but not limited to, an increased expression of glucose transporters, glycolytic enzymes, lactate dehydrogenases, and dysfunctions in oxidative phosphorylation in mitochondria.1,2 Although originally posited by Warburg, the contribution of mitochondrial defects toward the glycolytic phenotypes of cancer cells remains controversial, partly because mitochondria as a cellular organelle can be readily observed in a majority of cancer cells and mutations or depletions of mitochondrial DNA cannot entirely account for the aerobic glycolysis observed in cancer cells.1,2

As integrators of cellular energy metabolism, generation of reactive oxygen species (ROS), aging, and the initiation of apop-tosis, mitochondria can contribute approximately 90% of cellular ATP through the citric acid cycle and the electron transport chain coupled with oxidative phosphorylation (OXPHOS). Generation of ATP through OXPHOS in the mitochondria is an efficient and preferred metabolic process, which produces far more ATP molecules from a given amount of glucose compared with glycolysis. The major substrates for mitochondria OXPHOS are NADH as the primary electron donor, oxygen as the terminal electron acceptor, and pyruvate, the end product of glycolysis, as the primary carbon source. It has been shown that hypoxiainducible factor 1 (HIF-1) can actively downregulate mitochondrial respiration during cellular adaptation to hypoxia.5–7

Emerging evidence suggests that oncogenes and/or tumor suppressors can regulate mitochondrial respiration and by extension, the cellular energy metabolism. It has been recently demonstrated that p53, a putative tumor suppressor frequently mutated in cancers, regulates mitochondrial respiration.8 Among various oncogenes, ras, myc and akt mutations are known to increase glycolysis. For example, in yeast, the Ras-cAMP pathway can activate the glycolytic enzyme 6-phosphofructo-1-kinase via cAMP-dependent protein kinase A.9 While the effects of oncogenes on the expression of glycolytic enzymes have been examined in a number of studies, it remains unknown whether mitochondrial respiration can be impacted by oncogenes during carcinogenesis.

The present study was undertaken to test the hypothesis whether oncogenes such as ras can affect mitochondrial respiration. Ras was chosen in our study because activating mutations in the K-, H- or N-Ras proto-oncogene family occur in a high percentage of human epithelial cancers. It is estimated that mutated Ras proteins are involved in 20% of all human cancers.10,11 Deregulated Ras activation in tumors is accounted for by mutations in codons 12, 13 and 61 that cause Ras to remain in the constitutive GTP-bound, activated state. Using mouse fibroblast NIH-3T3 cells as a model of oncogenic transformation, we herein demonstrate that oncogenic H-RasQ61L caused severe impairment in mitochondrial respiration and shifted the energy metabolism toward independence of mitochondria in NIH-3T3 cells. Our studies suggest that mitochondrial respiration is actively suppressed in cells transformed by oncogene H-RasQ61L.

Results

Effects of H-RasQ61L transformation on mitochondrial localization and mass in NIH-3T3 cells

To study the changes in cellular energy metabolism as a result of oncogenic transformation, NIH-3T3 cells were transfected with the activated form of H-RasQ61L or its backbone vector as the control. Ras proteins are converted from inactive (GDP-bound) to active (GTP-bound) states for cellular signaling pathways downstream of receptor tyrosine kinases, such as the epidermal growth factor receptor family.11,12 The mutation at position 61 of H-RasQ61L can result in a five-fold increase in exchange of GTP for GDP in addition to decreased GTP hydrolysis,13 leading to a high transformation rate in NIH-3T3 cells.14 As shown in Figure 1A, there was a large increase in GTP-bound Ras proteins in H-RasQ61L transfected cells (designated as H-Ras), compared to the vector control (designated as pUSE).

Figure 1.

Figure 1

Induction of glycolytic phenotype in NIH-3T3 cells by H-RasQ6ILQ6IL. (A) Increased expression and activation of H-Ras in NIH-3T3 cells transfected with an expression construct of H-RasQ6IL. GTP-bound Ras (active) was captured with GST-RafI-RBD and the levels determined by western blot. Shown here is a representative blot from two experiments demonstrating the increased expression of Ras as well as increased Ras activation in the H-RasQ6IL transformed cells, when compared with the vector control cells (pUSE). (B) Altered cellular distribution of mitochondria in live H-RasQ6IL transformed cells. The cells cultured on coverglass were stained with Mitotracker GreenFM for mitochondria. Shown here is a representative micrograph from six different experiments. Note the altered cellular distribution of mitochondria in H-RasQ6IL transformed cells (Right), when compared to the vector control cells (Left). (C) Flow cytometric analysis of mitochondrial mass. Cells were stained with 10 µM Mitotracker Green FM for 15 min and analyzed using flow cytometry. Data represent one of two experiments. Note the slight increase in mitochondrial mass in H-RasQ6IL transformed cells (Green line), when compared with the vector control (Red line). Mitochondrial contents as determined by the protein levels. The levels of mitochondrial proteins were determined using BCA assay and normalized with the number of cells from which mitochondria were isolated. Results are the average of three determinations of mitochondrial protein levels per cell with the standard deviation. Mitochondrial DNA content as determined by the ratio of M7/18s RNA, Results.

To study the effect of oncogenic transformation on mitochondria, we examined mitochondrial localization, content and mass in H-RasQ61L transformed cells. As shown in Figure 1B, mitochondria were dispersed in the live vector control cells as revealed by Mitotracker Green FM staining. In contrast, the mitochondria in H-RasQ61L transformed cells tended to form aggregates in the perinuclear regions (Fig. 1B), consistent with the observations made in cells transfected with K-Ras oncogene.15 Flow cytometrical analysis of cells stained with Mitotracker GreenFM revealed that H-RasQ61L transformed cells had slightly, but significantly, higher mitochondrial mass than pUSE control cells (Fig. 1C). Interestingly, there was a distinct sub-population of H-RasQ61L transformed cells with smaller mitochondrial mass (Fig. 1C and arrowed), suggesting a greater heterogeneity in mitochondrial mass in the H-RasQ61L transformed cells than those in the pUSE cells. To further study whether mitochondria content can be altered as part of oncogenic transformation, we examined mitochondria protein and DNA content in H-RasQ61L transformed cells in comparison with pUSE cells.

As shown in Figure 1D, there was no significant difference in the amounts of mitochondrial proteins isolated from NIH-3T3, pUSE or H-RasQ61L cells. Neither did we find significant differences in the amount of mitochondrial DNA in the mitochondrial preparations (Fig. 1E). The results suggest that H-RasQ61L transformation slightly increased mitochondrial mass and most significantly, altered cellular distribution of mitochondria.

Change in mitochondrial gene expressions in NIH-3T3 cells by H-RasQ61LQ61L

To further examine the effects of H-RasQ61L transformation on mitochondria, we evaluated the levels of mitochondrial gene expression by RT-PCR. As shown in the Figure 2A, there was no appreciable difference in the RNA levels of various mitochondrion-encoded genes. Western blot analysis of select mitochondrial proteins revealed a general increase in Complex II-Ip subunit, Complex III core 2 protein, and Complex V F1α subunit in the mitochondrial preparations isolated from the H-RasQ61L transformed cells than those from the vector control cells (Fig. 2B, left). In contrast, the Complex IV COX II was reduced in mitochondria isolated from H-RasQ61L transformed cells when compared to those from the vector control (Fig. 2B, left). To determine whether the changes in the levels of proteins in the mitochondrial observed are due to the changes of gene expression, we analyzed the protein levels in total cell lys-taes. Analysis of total cell lysates, however, did not confirm the increases in the levels of Complex II-Ip subunit or Complex III core 2 protein as observed in mitochondrial preparations (Fig. 2B, right). The reduction of Complex IV COX II subunit was confirmed in the analysis of total cell lystates. The discrepancy in the relative levels of select mitochondrial proteins observed in mitochondrial preparations versus total lysates may be due to an increased mitochondrial mass or biogenesis in the H-RasQ61L transformed cells.

Figure 2.

Figure 2

Effects of H-RasQ6IL transformation on expression of genes related to mitochondrion. (A) Mitochondrial gene expression at mRNA levels. RNAs were extracted from isolated mitochondria, treated with RNAse-free DNAse, reverse transcribed with random primers, and then subjected to PCR with primers specific to various mitochondrial genes. (B) Western blot analysis of select mitochondrial proteins in the mitochondrial extracts or total cell lysates (Representative from three experiments). (C) Immunocytochemical analysis of Complex IV and V (n = 3). Note the reduced staining for Complex IV COX II subunit and increased staining for Complex V subunits in the H-RasQ6IL transformed cells. II-Ip, Complex II Ip subunit; IIIcore2, Complex III core 2 subunit; IV-COXII, Complex IV cytochrome c oxidase II; V-FI, ATP synthase mitochondrial FI complex assembly factor 1; V-FIα, Complex V FI subunit α; V-FIβ, Complex V FI subunit β. (D) A representative composite for Complex IV oxidase activities as indicated by the time-dependent reductions in the absorbance at 550 nm (n = 3). Note that pUSE (green line) showed greater rate in the reduction in the absorbance when compared to H-RasQ6IL (red line). (E) The specific oxidase activities of the Complex IV after normalizing with the COX protein levels. Columns, mean values of three samples; bars, STD. The p value was calculated using two tailed Student’s t test.

Immunocytochemical staining further confirmed a reduction in Complex IV COXII subunit and an increase in Complex V F1α subunit in the H-RasQ61L transformed cells when compared to the pUSE vector control cells (Fig. 2C). In addition to Complex V F1α subunit, other subunits of Complex V were also found increased in the H-RasQ61L transformed cells (Fig. 2C and bottom two panels). We next determine whether the reduced levels of Complex IV COXII subunit can impact on the activities of Complex IV. As shown in the Figure 2D, there was a clear reduction in the complex IV activities in the mitochondrial preparations from the H-RasQ61L transformed cells (Red line) when compared to those from the pUSE vector control cells (Green line). However, after normalization with the protein levels of COX, there was no difference in the specific activities of Complex IV oxidase (Fig. 2E), suggesting that the reductions in the Complex IV activities observed in the mitochondrial preparations from H-RasQ61L transformed cells are probably due to the reduced levels of COX proteins, rather than the potential mutations or posttranslational modifications of Complex IV oxidases.

The activities of Complex V were found slightly higher in the mitochondrial preparations from the H-RasQ61L cells than those from pUSE vector control cells (Data not shown), in consonance with the increased levels of Complex V proteins in the H-RasQ61L transformed cells (Fig. 2C).

Suppression of mitochondrial respiration in NIH-3T3 cells by H-RasQ61LQ61L

As originally postulated by Otto Warburg, impairment in mitochondrial respiration is a major contributing factor to the increased glycolysis observed in culture tumor slices.1 A number of studies have examined the effects of Ras on oxygen consumption at the cellular level with different results. In yeast the Ras-cAMP pathway was shown to increase the levels of mitochondrial oxidative phosphorylation complexes.16 H-Ras transformation was shown to increase cellular oxygen consumption17 and increase mitochondrial metabolism in human bronchial epithelial cells.18

However, in rat embryo fibroblast cells, H-Ras stimulated glycolysis and inhibited oxygen consumption, but when combined with c-myc, stimulated oxygen consumption.19 Since other cellular elements, in addition to mitochondria, can also consume oxygen, it is important to measure oxygen consumption resulting from the respiration from mitochondria.

To this end, we utilized inhibitors of the mitochondrial electron transport chain to discern the effects of H-RasQ61L transformation on mitochondrial oxygen consumption. As shown in the Figure 3A, under the unperturbed condition, the rate of oxygen consumption was lower in H-RasQ61L transformed cells than that of the vector control cells (pUSE) or parental NIH-3T3 cells (not shown). Perturbation with antimycin A, an inhibitor of the complex III, reduced oxygen consumption in the pUSE and NIH-3T3 cells to the levels comparable to those in the H-RasQ61L cells (Fig. 3A and B). Similar results were obtained with rotenone, an inhibitor of the ‘ Complex I of mitochondrial electron transport chain (Fig. 3A). The results suggest an essential absence of mitochondrial oxygen consumption in the H-RasQ61L transformed cells. The results also suggest that the oxygen consumption in H-RasQ61L transformed cells was not due to mitochondrial respiration. Taken together, the data suggest that mitochondrial respiration, as measured by oxygen consumption, is impaired in H-RasQ61L transformed cells.

Figure 3.

Figure 3

Suppression of mitochondria respiration in the H-RasQ6IL transformed cells. (A) Effects of rotenone and antimycin A on oxygen consumption. Note the reduced oxygen consumption in H-RasQ6IL transformed cells when compared to the vector controls. Treatment with either rotenone (I µM) or antimycin A (I µM) reduced oxygen consumption in pUSE control cells to the levels comparable to H-RasQ6IL transformed cells (Representative data from at least three independent experiments). Also note the lack of significant reduction in oxygen consumption rate in H-RasQ6IL transformed cells in the presence of rotenone or antimycin A. Each column in the H-Ras group represents the average of two measurements with the error bars showing the standard deviations. (B) Rate of oxygen consumption of H-RasQ6IL transformed cells in the presence of graded levels of antimycin A. Results represent three separate measurements. Note the reduced oxygen consumption in H-RasQ6IL transformed cells (ap < 0.05). Also note that antimycin A reduced oxygen consumption in pUSE vector control cells (bp < 0.05), but not H-RasQ6IL transformed cells (p > 0.05), when compared with their respective solvent controls. *p < 0.05 when compared to their respective controls.

Contribution of mitochondrial oxidative phosphorylation to cellular energy metabolism after H-RasQ61L transformation

The impairment of mitochondrial respiration as result of H-RasQ61L transformation led us to examine the resultant changes in cellular energy metabolism. First we examined the changes in cellular ATP levels in the presence of rotenone, antimycin A, or FCCP. As shown in Figure 4A, rotenone reduced cellular ATP levels in a time dependent manner in pUSE cells but not in H-RasQ61L transformed cells. In pUSE cells, rotenone treatment significantly reduced the cellular ATP levels within 5 to 15 min (Fig. 4A). The cellular ATP levels rebounded back to the normal level after 60 min (p > 0.05, Fig. 4A). Similar results were obtained with antimycin A, another inhibitor of mitochondrial electron transport chain (Data not shown), or with FCCP, an uncoupler of oxidative phosphorylation (Fig. 4B).

Figure 4.

Figure 4

Alteration of cellular energy metabolism by H-RasQ6IL transformation. To evaluate the effects of perturbations on cellular ATP levels, cells (1 × 105) were seeded per well in 100 µl of culture media, and treated with rotenone, antimycin A, FCCP or oligomycin. After treatment, cells were lysed and cellular ATP levels measured using luminescent reagent as described in Materials and Methods. (A) Time-dependent reduction in cellular ATP levels by rotenone in pUSE but not in H-RasQ6IL transformed cells. Cells were treated with rotenone (I µM) for different durations and cellular ATP levels measured. Shown here is a representative experiment indicating a time-dependent reduction in pUSE cells by rotenone. *p < 0.05 and **p < 0.01 when compared to the vehicle control. (B) Time dependent reduction in cellular ATP levels by FCCP in pUSE but not in H-RasQ6IL transformed cells. Cells were treated with I µM FCCP at durations indicated and cellular ATP levels measured. Note the reduction of cellular ATP levels by FCCP within 5~15 min of treatment and the recovery of cellular ATP level at 60 min in pUSE cells. **p < 0.01 when compared to the solvent control. (C) Dose dependent effects of mitochondria respiration inhibitor on cellular ATP levels. The cellular ATP levels after 10 min treatment were measured with 100 µl of luminescent reagents. Note the reduction of cellular ATP levels by rotenone (Left) or antimycin (Right) in the vector control cells, but not in the H-RasQ6IL transformed cells. (D) Effects of mitochondrial F0-F1 ATPase inhibitor on cellular ATP levels. Cells (1 × 105) were seeded per well in 100 µl of culture media, and treated with oligomycin, an inhibitor of F0-F1 ATPase in mitochondria (Complex V), and the cellular ATP levels measured after 10 min treatment. White columns represent groups treated with solvent as controls. Black columns, oligomycin-treated groups. Note the reduction of cellular ATP levels by oligomycin treatment in the vector control cells, but not in the H-RasQ6IL transformed cells. **p < 0.01 when compared to the solvent control.

Next we examined the cellular ATP levels after treatment with graded levels of rotenone or antimycin A for 10 min. As shown in Figure 4C, the ATP levels in the pUSE control cells were reduced by treatment with rotenone or antimycin A at doses as low as 1 µM. In contrast, neither rotenone nor antimycin A had significant effects on the ATP levels in the H-RasQ61L transformed cells, even at highest dose tested (10 µM). The results further suggest that unlike the pUSE control cells, the energy metabolism in the H-RasQ61L transformed cells is independent on the mitochondrial electron transport chain.

We further examined the effects of oligomycin, an inhibitor of F0-F1 ATPase, on the ATP levels in H-RasQ61L transformed cells. As shown in Figure 4D, oligomycin reduced the ATP levels in the pUSE control cells. In contrast, under same treatment conditions, the ATP levels in H-RasQ61L transformed cells were only slightly reduced (Fig. 4D). The results further suggest that energy metabolism in H-RasQ61L transformed cells were less dependent upon mitochondrial oxidative phosphorylation for the energy generation than the pUSE control cells.

The temporal patterns of cellular ATP levels, in the presence of inhibitors of the oxidative phosphorylation chain in mitochondria, suggest that the reductions in cellular ATP levels observed within 5~15 min of treatment were due to inhibition of mitochondrial respiration. The rebound of cellular ATP levels after prolonged treatment (60 min) suggests that the cellular ATP levels are tightly controlled and other compensatory systems, such as reduced ATP consumption or increased ATP generation via mitochondrion independent pathways, can be activated to keep the steady state level of cellular ATP. The rebounds in cellular ATP levels after prolonged treatment also suggest that the reductions in cellular ATP levels within 5~10 min treatment were not due to a non-specific reduction in the number of viable cells. The difference in the temporal patterns observed between pUSE and HRasQ61L cells (Fig. 4A and B) suggest a diminished role for mitochondrial oxidative phosphorylation in cellular energy metabolism in H-RasQ61L transformed cells.

Increased dependence on glycolysis after H-RasQ61L transformation

To study whether the reduced contribution of mitochondria to cellular energy metabolism in HRasQ61L transformed cells is compensated by an increase in glycolysis, we measured glucose consumption. As shown in Figure 5A, the H-RasQ61L-transformed cells consumed glucose at higher rate than the vector control or parental NIH-3T3 cells. To determine the contribution of glycolysis toward cellular energy metabolism, we measured the changes in cellular ATP levels after treatment with IAA, an inhibitor of glyceraldehyde 3-phosphate dehydrogenase in the glycolytic pathway.20 As shown in Figure 5B, IAA reduced ATP levels in both H-RasQ61L transformed cells and their vector control cells. However, the kinetics in the changes of ATP levels revealed that H-RasQ61L transformed cells were more susceptible to IAA treatment when compared to the vector control cells, especially at earlier time points. The data suggest an increased dependence of the H-RasQ61L transformed cells on glycolysis to synthesize cellular ATP.

Figure 5.

Figure 5

Increased dependence of H-RasQ6IL transformed cells on glycolysis in energy metabolism. (A) Increased glucose consumption of H-RasQ6IL transformed cells. The levels of unconsumed glucose in culture supernatants were determined. Data represent one of three separate experiments. Note the reduced levels of glucose in culture supernatants, indicative of increased glucose consumption, in the H-RasQ6IL transformed cells (H-Ras), when compared to the vector control cells (pUSE) and parental NIH-3T3 cells. (B) Effects of glycolysis inhibitor, IAA, on cellular ATP levels in pUSE and H-RasQ6IL cells. 1 × 105 cells were seeded per well, treated with I mM IAA for different durations of treatment indicated, and cellular ATP levels measured. Note the time-dependent reduction of ATP levels in both H-Ras transformed cells and their vector control cells. (C) Restoration of IAA-depleted ATP by exogenous pyruvate. Cells were plated, treated with IAA (1 mM), in the absence or presence of pyruvate (20 mM), and cellular ATP levels were measured at 5 min of treatment. Note the significant attenuation of IAA-induced ATP depletion by pyruvate in the vector control cells, but not in the H-RasQ6IL transformed cells. Each datum represents the average of six repeats. Bars, STD.

Reduced utilization of pyruvate in H-RasQ61L transformed cells

Pyruvate is the product of glycolytic pathway that enters the TCA cycle in mitochondria. We examined whether pyruvate can restore ATP production when glycolysis is inhibited. H-RasQ61L transformed cells or pUSE control cells were treated with IAA, in the absence or presence of pyruvate, and then cellular ATP levels were measured. As shown in Figure 5C, pyruvate significantly prevented the depletion of cellular ATP induced by IAA in the pUSE cells. In contrast, pyruvate did not significantly attenuate the IAA-induced ATP depletion in the H-RasQ61L transformed cells (Fig. 5C), suggesting that mitochondria in the H-RasQ61L transformed cells could not utilize the exogenously added pyruvate for ATP generation. The results further suggest a diminished role of mitochondria in the energy metabolism in the H-RasQ61L transformed cells.

Increased sensitivity of H-RasQ61L transformed cells to inhibition of glycolysis or glucose deprivation

The switch in energy metabolism from mitochondrial oxidative phosphorylation toward glycolysis in the H-RasQ61L transformed cells led us to examine whether the altered energy metabolism can be targeted to kill the transformed cells selectively. As shown in Figure 6A, at low concentrations (5 and 10 µM), IAA killed H-RasQ61L transformed cells at much higher rates than the vector control cells, suggesting an enhanced sensitivity of H-RasQ61L transformed cells to inhibition of glycolysis. However, at higher concentration (25 µM), IAA killed both H-RasQ61L and pUSE cells at similar rates, indicating an essential role of glycolysis in energy metabolism in normal cells as well.

Figure 6.

Figure 6

Increased dependence of H-RasQ6IL transformed cells on glycolysis for survival. (A) Induction of cell death by glycolytic inhibitor IAA. Cells were treated with graded levels of IAA and the viability measured after 2 days of treatment using trypan blue exclusion. Note the enhanced sensitivity of H-RasQ6IL transformed cells toward IAA. (B) Increased susceptibility of H-RasQ6IL transformed cells toward glucose deprivation. Cells were cultured in glucose free medium and viability was determined at timepoints indicated. Note the increased cell death of H-RasQ6IL transformed cells when compared with pUSE vector controls. For (A and B), each datum represents the average of three repeats. Bars, STD. (C) Requirement of functional mitochondrial respiration for survival of cells under glucose deprivation. pUSE cells, cultured in glucose-free or glucose-containing media, were treated with rotenone (I µM) or oligomycin (I µml). Pictures were taken two days after treatment. Note the dramatic reduction in the number of viable cells when pUSE cells were treated with rotenone or oligomycin under glucose-free condition (right), but not in glucose containing media (left). (D) Synergistic induction of death of pUSE cells in glucose free media by rotenone or oligomycin. The viability of cells was measured 2 days after treatment. By comparing with the cell death rates under glucose deprivation or treatment with rotenone or oligomycin alone, a more than five-fold increase in cell death was noted for oligomycin, and a six-fold increase for rotenone, when combined with glucose deprivation. *p < 0.01. Columns, mean values of three samples; bars, STD.

Next we examined the effects of glucose deprivation on the survival of H-RasQ61L transformed cells. As shown in Figure 6B, when cultured in glucose-free media, significantly higher death rates were found in H-RasQ61L transformed cells when compared with those in pUSE cells, suggesting an increased dependence of H-RasQ61L transformed cells on glucose for survival.

To examine the importance of the mitochondrial respiratory chain in the survival of pUSE cells in glucose-free media, the cells were treated with rotenone or oligomycin in combination with glucose deprivation. As shown in Figure 6C and D, rotenone or oligomycin treatment increased cell death only slightly in the presence of glucose. However, when cultured in glucose free media, rotenone or oligomycin induced massive cell death, suggesting an essential role for mitochondrial respiration chain in the survival of cells under glucose deprivation.

Taken together, the data suggest that the impairment of mitochondrial respiration, either due to H-RasQ61L transformation or to treatment with inhibitors of mitochondrial respiration, causes an enhanced dependence on glucose, or glycolysis for their survival. On the other hand, the data also confirm the inability of the H-RasQ61L transformed cells to reactivate or utilize oxidative phosphorylation in mitochondria to cope with glucose deprivation, as pUSE vector control cells did.

Discussion

Otto Warburg postulated as early as the 1930s that mitochondrial respiration is impaired in cancer cells, leading to the observed elevation of glycolysis.1 Although the increased glycolysis later has been well documented in a spectrum of cancers and further utilized for imaging of tumors in situ via [18F] fluorodeoxyglucose positron emission tomography, the presumed impairment of mitochondrial respiration in cancer cells has never been convincingly demonstrated. This report provides direct evidence suggesting that although mitochondrial content and mass are not reduced by H-RasQ61L transformation, mitochondrial respiration is impaired in the transformed cells. First, oxygen consumption due to mitochondrial respiration was reduced to minimal levels in the H-RasQ61L transformed cells. Second, mitochondrial oxidative phosphorylation did not contribute to cellular ATP homeostasis in the H-RasQ61L transformed cells. Third, the H-RasQ61L transformed cells had reduced ability to utilize pyruvate to synthesize ATP, when compared to the vector control cells. Fourth, mitochondrial respiration was required for the vector control cells to resist glucose deprivation. The increased sensitivity of the H-RasQ61L transformed cells toward glucose deprivation, or inhibition of glycolysis, suggests that the transformed cells could not activate or utilize oxidative phosphorylation for their survival. Our data suggest that defects in mitochondrial respiration can be acquired as part of cellular transformation induced by oncogene H-RasQ61L.

In our study, we found that the mitochondria tended to form aggregates in the perinuclear region of H-RasQ61L transformed cells, while they were evenly distributed in the vector control cells. Similar observations regarding the altered cellular localization of mitochondria were also made in the K-Ras transformed cells.15 It should be noted that the formation of mitochondria aggregates was not due to the apoptotic process since we did not observe any significant reduction in viability in HRasQ61L transformed cells. It remains to be determined whether the altered cellular distribution of mitochondria is due to possible defects in the cytoskeleton in transporting mitochondria or altered fission and fusion of mitochondria in the H-RasQ61L transformed cells.

While mitochondrial respiration was significantly compromised in the H-RasQ61L transformed cells, we did not detect striking changes in mitochondrial DNA content or mitochondrial gene expression. In fact, we detected a slight increase in mitochondrial mass and increased incorporation of mitochondrial proteins that encoded by nuclear genes into mitochondria, as evidenced by the relative contents of the proteins in total cell lystaes and in mitochondrial preparations. In yeast, activation of Ras signaling pathway has been shown to increase the content of mitochondrial respiration complexes.16 In rat embryo cells, H-Ras transformation was found to reduce oxygen consumption, but when combined with c-myc, stimulated oxygen consumption.19 Oncogenic H-RasV12 was found to increase mitochondrial metabolism in human bronchial epithelial cells18 and may stimulate oxygen consumption.17 However, since the oxygen consumption can be ascribed to mitochondria (80~90% in normal cells) or to elements not related to mitochondria,22 we used a perturbation approach to differentiate the mitochondrial oxygen consumption from those due to other sources. Using this approach, we were able to determine that the respiration of mitochondria was significantly compromised in H-RasQ61L transformed cells. It was found that the rate of the oxygen consumption in the H-RasQ61L transformed cells was not significantly reduced by rotenone or antimycin A, suggesting that most of oxygen consumption in the transformed cells is due to cellular elements other than the mitochondrial respiratory chain. In contrast, 40~50% of oxygen consumption was inhibited by rotenone or antimycin A in the vector control cells. The data suggest that mitochondrial respiration, as measured by oxygen consumption, is suppressed in the H-RasQ61L transformed cells.

In consonance with the suppression of mitochondrial respiration, we observed that the energy metabolism of H-RasQ61L transformed cells was essentially independent of OXPHOS in mitochondria.

The cellular ATP levels in H-RasQ61L transformed cells were essentially recalcitrant to treatment with rotenone or antimycin A. Neither did treatment with oligomycin A, an inhibitor of F0-F1 ATP synthase (Complex V), have any significant effects on cellular ATP levels. In contrast, the cellular ATP levels in the pUSE control cells can be rapidly, albeit transiently, reduced by treatment with rotenone, antimycin A or oligomycin. Taken together, the findings further support a diminished role for mitochondrial respiratory chain in the energy metabolism in H-RasQ61L transformed cells.

Despite the diminished role of mitochondria in energy metabolism, the steady state levels of ATP in unperturbed H-RasQ61L transformed cells were found remarkably similar to those in the vector control cells. H-RasQ61L transformed cells presented a glycolytic phenotype as evidenced by increased consumption of glucose and increased acidosis. Perturbation experiments with a glycolysis inhibitor revealed that H-RasQ61L transformed cells were dependent on glycolysis for their energy needs to a greater extent than the pUSE control cells. Interestingly we found that exogenously added pyruvate could restore cellular ATP depleted by IAA in pUSE cells, but not in the H-RasQ61L transformed cells. As the end product of glycolysis, pyruvate enters mitochondria to generate ATP via the TCA cycle and oxidative phosphorylation. The inability of pyruvate to attenuate the IAA-induced ATP depletion in the H-RasQ61L transformed cells further suggest a diminished role for mitochondria in the energy metabolism in the transformed cells. Taken together, the data strongly suggest a switch from mitochondrial respiration to glycolysis in cellular energy metabolism as result of H-RasQ61L transformation. Recently it is shown that mitochondrial localization of STAT3 was required for oncogenic Ras to transform cells.21 Further studies are required to determine whether STAT3 is a downstream effector for Ras to exert its suppressive functions on mitochondrial respiration.

On one hand, the increased dependence on glycolysis for their energy needs makes the transformed cells vulnerable to glucose deprivation. When cultured in glucose-free but glutamine containing media, the pUSE control cells survived reasonably well. In contrast, the H-RasQ61L transformed cells were found highly susceptible to glucose deprivation. Functional mitochondrial respiration was required for the vector control cells to survive under glucose deprivation. Both rotenone and oligomycin abolished the resistance of the vector control cells toward glucose deprivation. The susceptibility of the H-RasQ61L transformed cells toward glucose deprivation, on the other hand, further suggests impairment in mitochondria respiration as result of transformation.

In conclusion, the experimental data presented herein demonstrate that mitochondria respiration can be functionally impaired during cellular transformation, even though mitochondria as organelles are abundantly present. In the cells transformed by the H-RasQ61L oncogene, mitochondrial respiration was suppressed as evidenced by the lack of mitochondrial oxygen consumption, the lack of mitochondrial contribution to cellular ATP, and the inability to utilize pyruvate or glutamate when deprived of glucose. Our studies demonstrate a profound change in cellular metabolism as result of oncogenic transformation, which can be potentially targeted to develop new approaches to treat cancer.

Materials and Methods

Materials

All cell culture, immunochemistry, and molecular biology reagents were purchased from Invitrogen unless otherwise indicated. The GenePORTER® liposome transfection reagent was from Genlantis (San Diego, CA). ATP assay kit was ordered from Promega. All other chemicals and reagents were ordered from Sigma unless indicated otherwise.

Cell culture and transfection

NIH-3T3 cells were purchased from ATCC and were cultured in DMEM medium containing 10% (v/v) bovine serum (BS) with 100 µg/ml each of penicillin/streptomycin at 37°C under an atmosphere of 95% air and 5% CO2. NIH-3T3 cells (~80% confluence) were transfected with a plasmid harboring activated Q61L mutant H-Ras13 or backbone vector pUSE (Millipore, Billerica, MA) formulated in GenePORTER transfection liposomes. An equal volume of complete medium without any antibiotics was added after 6 hours. After 24 h, the medium was changed to complete medium with 10% bovine serum, supplemented with 500 µg/ml of G418 to select stable transfectants. To rule out possible artifacts introduced during selection of single clones, stable transfectants were pooled and used for studies. Cells transfected with construct expressing constitutively active H-RasQ61L were designated H-RasQ61L or H-Ras or those with the backbone vector as pUSE.

Assessment of Ras activation

The levels of GTP-bound Ras (active form) in pUSE or H-RasQ61L cells were measured using EZ-Detect™ Ras Activation Kit (Pierce), according to the manufacturer’s instruction. Briefly, the cells were grown to 90–100% confluence in one 100 mm culture dish and harvested in 500 µl lysis/binding/washing buffers. The lysates (500 µg) were incubated with GST-Raf1-RBD (to pull down active Ras) in the presence of SwellGel Immobilized Glutathione at 4°C for 1 hour in a spin column. After incubation, the mixture was centrifuged at 8,000 xg to remove the unbound proteins. The resins were washed three times with lysis/binding/wash buffer and the sample was eluted by adding 50 µl of 2X SDS sample buffer and boiled at 95°C for 5 minutes. Half (25 µl) of the sample volumes were used for western blot analysis.

Western blot analysis

For analysis of Ras proteins, the samples above were resolved by SDS-PAGE (14% Polyacrylamide mini-gel) and transferred to a PVDF membrane. The level of Ras was detected by western blotting using a specific antibody. The membrane was washed (3x) with TBS-Tween (0.1%) and probed with goat anti-rabbit fluorescently labeled secondary antibody (1:5,000) for 1 h at room temperature and washed (3x) with TBS-T for a total of 15 min. The immunoblots were visualized by an Infrared imaging system (Odyssey, Lincoln, Nebraska).

For analysis of OXPHOS proteins, extracts of mitochondrial proteins or total cellular proteins were resolved by SDS-PAGE, blotted onto PVDF membrane and probed with the following antibodies: Complex I subunit NDUFB8 (MS105), Complex II subunit 30 kDa (MS203), Complex III subunit Core 2 (MS304), Complex IV subunit II (MS405), and ATP synthase subunit alpha (MS507) as an optimized premixed cocktail (1:200 dilutions) (MitoSciences, Eugene, Oregon). For staining, goat anti-mouse fluorescently-labeled secondary antibody (diluted 1:5,000 in blocking buffer) was used. The immunoblots were visualized and quantified by Infrared imaging system.

Glucose consumption assay

Cells were cultured in DMEM-10% BS for up to seven days without changing media. Culture supernatants were collected at 24 h intervals, and glucose levels were measured using a Glucose (HK) Assay kit, according to manufacture’s instruction (Sigma-Aldrich, St. Louis, MO). Basically, glucose was phosphorylated by hexokinase in the presence of ATP. Glucose-6-phosphate was then oxidized to 6-phospho-gluconate in the presence of oxidized nicotinamide adenine dinucleotide (NAD) in a reaction catalyzed by glucose-6-phosphate dehydrogenase. During this oxidation, an equimolar amount of NAD was reduced to NADH, which was measured by the absorbance at 340 nm using a spectrophotometer.

Cellular distributions of mitochondria in live cells

MitoTracker GreenFM dye (Molecular Probes, Invitrogen), which becomes fluorescent once it accumulates in the membrane lipids of mitochondria independent of membrane potential, was used to evaluate the distribution of mitochondria. Cells were cultured on coverglasses overnight, and then stained with MitoTracker Green dye at 37°C in the CO2 incubator for 30 minutes. The labeling solution was aspirated away and the cells were washed with pre-warmed media three times. The coverglasses were then removed and mounted on a slide for observation of the distribution of mitochondria under 40X or 60X objectives of an epifluorescence microscope (Olympus). Images were captured with a CCD camera linked with a computer.

Immunofluorescent staining

The cells were first seeded on the 6-well plates with coverglasses. After reaching to 50% to 70% confluency, the cells were fixed with 2% paraformaldhyde at room temperature for 20 minutes. After washing with 1X PBS for three times, the fixed cells were treated the 0.1% Triton X-100 for 1 minute at room temperature for increasing the permeability. The blocking step with 1% BSA for 30 minutes was followed. The cells were incubated with the primary antibodies indicated at room temperature for 2 hours and then after washing with 1X PBS for 3 times, incubated with Alexa Fluor® 488 goat anti-mouse IgG(H + L) secondary antibody for 1 h (1:100 dilution). After rinsing with IX PBS for 4 times, the slides were mounted with Prolong® Gold antifade reagent (Invitorgen) and observed under microscope.

Determination of mitochondrial mass

Mitochondrial mass was analyzed with a MitoTracker Green FM dye, which stains mitochondria independent of membrane potential. Live cells were stained with 10 µM MitoTracker Green FM for 15 min and subjected to flow cytometry analysis.

Isolation of intact mitochondria

Intact mitochondria were isolated by Cell Mitochondria Isolation Kit (Sigma). pUSE and HRasQ61L cells were grown to ~90% confluence. Cells were harvested by trypsin digestion, washed, resuspended in ice cold PBS, and counted. Equal numbers of cells were pelleted by centrifugation for 5 minutes at 600 xg at 4°C, and the cell pellets were re-suspended in 0.65–2 ml of Lysis Buffer per 3 × 107 cells. After incubation on ice for 5 min, the cells were pipeted up and down at 1 min intervals three times. Then 2 volumes of 1x extraction buffer were added. The homogenate was centrifuged at 600 xg for 10 min at 4°C. The supernatants were carefully transferred to a fresh tube and centrifuged at 3,500 xg for 10 min at 4°C. After careful removal of the supernatant, the pellet was resuspended in CelLytic M buffer for analysis including protein content using BCA kit (Pierce).

Analysis of mitochondrial DNA content

Mitochondrial DNA was extracted from mitochondria extracted from exponentially growing cells. Mitochondria preparations were resuspended in 0.5 ml 10% SDS extract buffer (containing 5% Proteinase K and 1% RNase), incubated at 37°C for 10 hours, and then incubated at 50°C water bath for 5 hours for thorough degradation of RNA and proteins. The mitochondrial DNA was extracted using 0.2 ml cholorform/isoamyl alcohol buffer, followed by isopropanol precipitation, and resuspended in TE buffer. The mitochondrial DNA contents were analyzed by the levels of M7 amplicons using GGA GCA GTG TTT GCT ATC ATA GC and TGA TGG CTA CAA CGA TTG GGA ATC as forward and reverse primer, respectively. For reference of cell number, genomic DNA content was extracted from identical sets of cells and analyzed by the levels of amplicons of 18 s RNA gene using ACC AAC TGG GAC GAT ATG GAG AAG A and TAC GAC CAG AGG CAT ACA GGG ACA A, as forward and reverse primer, respectively. The amplification was conducted at the following settings: 94°C × 3′ for one cycle; 94°C × 30″, 60–65°C × 1′, 72°C × 1′ for 30 cycles; 72°C × 5′ for one cycle. The PCR products were analyzed by 1.2% agarose gel and the density of bands was analyzed by Alpha Innotech software.

RT-PCR analysis of mitochondrial gene expression

Mitochondria RNA were extracted from the mitochondria preparations using TRI Reagent. To eliminate the possible contamination of mitochondrial DNA, the isolated mitochondrial RNA was treated with RNAase-free DNAase I at 37°C for 30 minutes. The RNA was precipitated by 60% volume of isopropyl alcohol, washed by 75% ethanol, and dissolved in 20 µl water (treated by DEPC). The RNA was reverse transcribed with random primers using SuperScript II reverse transcriptase according to manufacturer’s instruction (Invitrogen). The 1st strand cDNA was used for PCR under the following conditions: 94°C × 3′ for one cycle; 94°C × 30″, 60–65°C × 1′, 72°C × 1′ for 30 cycles; 72°C × 5′ for one cycle of extension using the primer sets listed in Table 1. The PCR products were analyzed using agarose gel. The primers used to assess the expression of mitochondrial genes at RNA levels were listed in Table 1.

Table I.

Primers used for analysis of mitochondrial gene expression

Gene name Forward primer Reverse primer
ATP8 ATGCCACAACTAGATACATC GGTTATTGTTGGGGTAATGGTAATG
NDI TATCCTAACACTCCTCGTCC CTATATGTATGGTGGTACTCCC
ND2 ATCCTATCACCCTTGCCATC GTAATTAGTTGGGGGGCTAG
COX I AGATATCGGAACCCTCTATC ATAGGTTGGTTCCTCGAATG
ATP6 TTTGCCTCATTCATTACCCC GATATAGGCTTACTAGGAGG
COX III ATGACCCACCAAACTCATGC CCTCATCAATAAATGGAGACG
ND3 ACCTGTACACTGTTATCTTC GTTCATTCATATGCTAGGCC
ND4L ATGCCATCTACCTTCTTCAAC TAGCATTGTAGTAGGTTGAG
ND4 CTCACTAATGCTACTACCAC AGTGGAATTATGTGAAGGGC
ND5 TTCTACTATCCCCAATCCTA TTGGTTGGTTGTTAAAGTGG
ND6 GATCACCCAGCTACTACC GGTTGGTTGTCTTGGGTTAG
CYTB CCACTCATTCATTGACCTAC TGAGAAGTATGAGATGGAGG

Measurement of complex IV and V activities

The activities of Complex IV and V in mitochondrial preparations were measured using kits from Mitosciences (MS443 and MS543), according to manufacture’s instructions.

Oxygen consumption assay

Measurement of cellular respiration was performed in a high performance Oxygraph (OROBOROS®, www.oroboros.at). The supplier’s DatLab software was used for data acquisition and analysis. pUSE and H-RasQ61L cells were suspended at a density of 1 million cells per ml in 1 ml stirred chambers in CO2 equilibrated DMEM medium with 10% bovine serum. Oxygen consumption was measured at 37°C polaragraphically over a period of 5 min. To differentiate oxygen consumption due to mitochondrial respiration or to non-mitochondrial sources, the following inhibitors of mitochondria respiration were added: Rotenone (Inhibitor of complex I, final concentration, 1 µM), and/or antimycin A (Inhibitor of complex III, 1~10 µM).

Measurement of cellular ATP levels

Cells (pUSEandH-RasQ61L) were harvested by Trypsin-EDTA, counted, and adjusted to 1 × 105 cells/ml in DMEM with 10% bovine serum. Cells (1 × 105) were added to each well in an opaque 96-well plate and then treated with oligomycin (final concentration 1 µg/ml), rotenone (1 µM), antimycin A (1 µM), or iodoacetic acid (IAA, 1 µM, or otherwise indicated) at different time intervals and incubate at 37°C. At the end of incubation, 100 µl CellTiter-Glo® reagent was added to each well. After mixing and incubation for 10 min at room temperature, the luminescence in each well was measured using Lumionoskan Ascent plate reader (Thermo Electro Corp., Waltham, MA).

Measurement of cell viability

Cells were cultured in glucose-free DMEM or glucose-containing media in the absence or presence of IAA, rotenone, antimycin A or oligomycin. At different time intervals, cells were harvested with trypsin-EDTA, combined with non-adherent cells in the culture supernatants, and the viability determined using trypan blue exclusion assay with Beckman Coulter ViaCell Analyzer. For each sample, at least 50 images were collected and analyzed.

Statistical analysis

Student’s t-test (two-tails) was used to analyze the difference between two groups. For comparisons among three or more groups, ANOVA was used. The statistical tests were performed using GraphPad Prism 4.00 for Windows (San Diego, CA). A p value less than 0.05 was considered statistically significant.

Acknowledgements

This work was partially supported by National Institute of Health Grant R01CA131445 (D.N.), R01AG013435 (G.B.), R01CA121904 (K.K.S.), and start-up funds from Southern Illinois University School of Medicine and SimmonsCooper Cancer Institute (D.N.).

Abbreviations

BS

bovine serum

COX

cytochrome c oidase

DMEM

dulbecco’s modified eagle medium

FCCP

carbonylcyanide-4-(trifluoromethoxy)-phenylhydrazone

IAA

iodoacetic acid or iodoacetate

MT

mitochondria

OXPHOS

oxidative phosphorylation

STD

standard deviation

References

  • 1.Warburg O. On respiratory impairment in cancer cells. Science. 1956;124:269–270. [PubMed] [Google Scholar]
  • 2.Warburg O. On the origin of cancer cells. Science. 1956;123:309–314. doi: 10.1126/science.123.3191.309. [DOI] [PubMed] [Google Scholar]
  • 3.Schwickert G, Walenta S, Sundfor K, Rofstad EK, Mueller-Klieser W. Correlation of high lactate levels in human cervical cancer with incidence of metastasis. Cancer Res. 1995;55:4757–4759. [PubMed] [Google Scholar]
  • 4.Walenta S, Wetterling M, Lehrke M, et al. High lactate levels predict likelihood of metastases, tumor recurrence and restricted patient survival in human cervical cancers. Cancer Res. 2000;60:916–921. [PubMed] [Google Scholar]
  • 5.Fukuda R, Zhang H, Kim JW, Shimoda L, Dang CV, Semenza GL. HIF-1 regulates cytochrome oxidase subunits to optimize efficiency of respiration in hypoxic cells. Cell. 2007;129:111–122. doi: 10.1016/j.cell.2007.01.047. [DOI] [PubMed] [Google Scholar]
  • 6.Simon MC. Coming up for air: HIF-1 and mitochondrial oxygen consumption. Cell Metab. 2006;3:150–151. doi: 10.1016/j.cmet.2006.02.007. [DOI] [PubMed] [Google Scholar]
  • 7.Papandreou I, Cairns RA, Fontana L, Lim AL, Denko NC. HIF-1 mediates adaptation to hypoxia by actively downregulating mitochondrial oxygen consumption. Cell Metab. 2006;3:187–197. doi: 10.1016/j.cmet.2006.01.012. [DOI] [PubMed] [Google Scholar]
  • 8.Matoba S, Kang JG, Patino WD, et al. p53 regulates mitochondrial respiration. Science. 2006;312:1650–1653. doi: 10.1126/science.1126863. [DOI] [PubMed] [Google Scholar]
  • 9.Dihazi H, Kessler R, Eschrich K. Glucose-induced stimulation of the Ras-cAMP pathway in yeast leads to multiple phosphorylations and activation of 6-phos-phofructo-2-kinase. Biochemistry. 2003;42:6275–6282. doi: 10.1021/bi034167r. [DOI] [PubMed] [Google Scholar]
  • 10.Brose MS, Volpe P, Feldman M, et al. BRAF and RAS mutations in human lung cancer and melanoma. Cancer Res. 2002;62:6997–7000. [PubMed] [Google Scholar]
  • 11.Downward J. Targeting RAS signalling pathways in cancer therapy. Nat Rev Cancer. 2003;3:11–22. doi: 10.1038/nrc969. [DOI] [PubMed] [Google Scholar]
  • 12.Malumbres M, Barbacid M. RAS oncogenes: the first 30 years. Nat Rev Cancer. 2003;3:459–465. doi: 10.1038/nrc1097. [DOI] [PubMed] [Google Scholar]
  • 13.Feig LA, Cooper GM. Relationship among guanine nucleotide exchange, GTP hydrolysis and transforming potential of mutated ras proteins. Mol Cell Biol. 1988;8:2472–2478. doi: 10.1128/mcb.8.6.2472-2478.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Der CJ, Finkel T, Cooper GM. Biological and biochemical properties of human rasH genes mutated at codon 61. Cell. 1986;44:167–176. doi: 10.1016/0092-8674(86)90495-2. [DOI] [PubMed] [Google Scholar]
  • 15.Chiaradonna F, Gaglio D, Vanoni M, Alberghina L. Expression of transforming K-Ras oncogene affects mitochondrial function and morphology in mouse fibroblasts. Biochim Biophys Acta. 2006;1757:1338–1356. doi: 10.1016/j.bbabio.2006.08.001. [DOI] [PubMed] [Google Scholar]
  • 16.Dejean L, Beauvoit B, Bunoust O, Guerin B, Rigoulet M. Activation of Ras cascade increases the mitochondrial enzyme content of respiratory competent yeast. Biochem Biophys Res Commun. 2002;293:1383–1388. doi: 10.1016/S0006-291X(02)00391-1. [DOI] [PubMed] [Google Scholar]
  • 17.Ramanathan A, Wang C, Schreiber SL. Perturbational profiling of a cell-line model of tumorigenesis by using metabolic measurements. Proc Natl Acad Sci USA. 2005;102:5992–5997. doi: 10.1073/pnas.0502267102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Telang S, Lane AN, Nelson KK, Arumugam S, Chesney J. The oncoprotein H-RasV12 increases mitochondrial metabolism. Mol Cancer. 2007;6:77. doi: 10.1186/1476-4598-6-77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Biaglow JE, Cerniglia G, Tuttle S, Bakanauskas V, Stevens C, McKenna G. Effect of oncogene transformation of rat embryo cells on cellular oxygen consumption and glycolysis. Biochem Biophys Res Commun. 1997;235:739–742. doi: 10.1006/bbrc.1997.6835. [DOI] [PubMed] [Google Scholar]
  • 20.Wu M, Neilson A, Swift AL, et al. Multiparameter metabolic analysis reveals a close link between attenuated mitochondrial bioenergetic function and enhanced glycolysis dependency in human tumor cells. American journal of physiology. 2007;292:125–136. doi: 10.1152/ajpcell.00247.2006. [DOI] [PubMed] [Google Scholar]
  • 21.Gough DJ, Corlett A, Schlessinger K, Wegrzyn J, Larner AC, Levy DE. Mitochondrial STAT3 supports Ras-dependent oncogenic transformation. Science. 2009;324:1713–1716. doi: 10.1126/science.1171721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Herst PM, Berridge MV. Cell surface oxygen consumption: a major contributor to cellular oxygen consumption in glycolytic cancer cell lines. Biochim Biophys Acta. 2007;1767:170–177. doi: 10.1016/j.bbabio.2006.11.018. [DOI] [PubMed] [Google Scholar]

RESOURCES