Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2010 Jun 2;48(8):2929–2933. doi: 10.1128/JCM.00339-10

Three-Hour Molecular Detection of Campylobacter, Salmonella, Yersinia, and Shigella Species in Feces with Accuracy as High as That of Culture

Scott A Cunningham 1, Lynne M Sloan 1, Lisa M Nyre 1, Emily A Vetter 1, Jayawant Mandrekar 2, Robin Patel 1,3,*
PMCID: PMC2916566  PMID: 20519461

Abstract

Campylobacter jejuni and Salmonella, Shigella, and Yersinia species (along with Shiga toxin-producing Escherichia coli) are the most common causes of acute bacterial diarrheal disease in the United States. Current detection techniques are time-consuming, limiting usefulness for patient care. We developed and validated a panel of rapid PCR assays for the detection and identification of C. jejuni, C. coli, Salmonella, and Yersinia species and Shigella and enteroinvasive E. coli in stool samples. A total of 392 archived stool specimens, previously cultured for enteric pathogens, were evaluated by PCR. Overall, 104 stool specimens had been culture positive (C. jejuni/coli [n = 51], Salmonella species [n = 42], Shigella species [n = 6], and Yersinia species [n = 5]). Compared to culture, the overall sensitivity and specificity of PCR detection of these organisms were 92 and 98% (96/104 and 283/288), respectively, from fresh or Cary Blair stool (P = 0.41); 87 and 98% (41/47 and 242/246), respectively, from fresh stool (P = 0.53); and 96 and 98% (55/57 and 41/42), respectively, from Cary Blair stool (P = 0.56). For individual genera, PCR was as sensitive as the culture method, with the exception of Salmonella culture using selenite enrichment for which PCR was less sensitive than culture from fresh, but not Cary Blair (P = 0.03 and 1.00, respectively) stools. This PCR assay panel for the rapid diagnosis of acute infectious bacterial diarrheal pathogens has a sensitivity and specificity equivalent to that of culture for stools in Cary Blair transport medium. Paired with reflexive culture of stools testing positive, this should provide an improvement in care for patients with acute infectious diarrheal disease.


Despite advances in water treatment, food safety, and sanitary conditions, acute diarrheal disease remains a leading cause of morbidity and mortality worldwide. Most bacterial enteric infections in the United States originate within the food supply chain. According to the Centers for Disease Control and Prevention, 43% of laboratory-confirmed bacterial enteric infections in the United States are caused by Salmonella species, followed by Campylobacter species (33%), Shigella species (17%), Shiga toxin-producing Escherichia coli (4.1%), and Yersinia species (0.9%) (4).

Although most common agents of bacterial enteric infection are easily cultivated on standard selective and differential bacteriologic media, isolation and final identification are time-consuming, leaving patients without a diagnosis for several days, and putting them at risk for untreated infection and spread of infection to others. Alternatively, empirical antimicrobial therapy may have adverse consequences for some diarrheal pathogens, such as E. coli O157:H7 (16). At Mayo Clinic (Rochester, MN), the time to final identification for Salmonella, Shigella, and Yersinia species from stool culture ranges from 3 to 5 days and that for Campylobacter species ranges from 2 to 4 days.

We recently described a rapid real-time PCR assay for detecting Shiga toxin-producing E. coli in stool that showed performance equivalent to that of culture for detecting E. coli O157:H7 and which additionally detects non-O157 Shiga toxin-producing E. coli (6). We have also developed a stool PCR assay that is as accurate as culture for detecting toxigenic Clostridium difficile in stool samples (12). These assays are currently the only ones used for detection of the associated pathogens in our laboratory. Based upon the success of Shiga toxin and C. difficile stool PCR, we developed and validated assays to rapidly detect and differentiate Campylobacter, Salmonella, and Yersinia species, and Shigella species/enteroinvasive E. coli in stool and compared the results to those of routine stool cultures on specimens submitted for testing for enteric pathogens.

(This study was presented in part at the 110th General Meeting of the American Society for Microbiology, San Diego, CA, 23 to 27 May 2010.)

MATERIALS AND METHODS

Clinical specimens.

A total of 392 stool specimens, submitted as fresh stools (n = 293) or in Cary Blair transport medium (n = 99) for routine culture of enteric pathogens, were cultured and stored at −70°C between October 2007 and February 2009. This study was reviewed and approved by the Mayo Clinic Institutional Review Board.

Stool culture.

Stool culture for Salmonella, Shigella, Campylobacter, and Yersinia species was performed using BBL Hektoen enteric, BBL cefsulodin irgasan novobiocin, and BBL Campy CVA agars (BD Diagnostics, Sparks, MD) incubated at 35°C in room air, 30°C in room air, and 42°C in a microaerophilic environment, respectively. Stool was also inoculated into selenite broth and incubated at 35°C in room air for 8 to 16 h, followed by subculture to BBL Hektoen enteric agar. Stool was additionally cultured to Trypticase soy agar with 5% sheep blood and eosin methylene blue agar. Suspicious colonies were tested by using standard methods.

Primer and probe design.

Primers and probes (Table 1) were designed by using the LightCycler Probe Design Software 2.0 (Roche Diagnostics, Indianapolis, IN) and Oligo 6.71 (Molecular Biology Insights, Cascade, CO).

TABLE 1.

Primers and probes

Strain seta Primer or probe Sequence (5′-3′)
C. jejuni/C. coli cadF (set 602)
    Primers CAMP 221F CTGCTAAACCATAGAAATAAAATTTCTCAC
CAMP 221R CTTTGAAGGTAATTTAGATATGGATAATCG
    Probes CAMP 221fl ACATCAGAATAATGCTCTAACCCAAATTCTAAT-FITC
CAMP 221fl2 TCCGAGTAATGTTCTAAACCTAGTTCTAAT-FITC
CAMP 221iLC610 Red610-CATCACCATCTTCATAGGCTACTTGACCTATAGT-PO4
Salmonella sp. invA (set 604)
    Primers SALM 178F TGCATAATGCCAGACGAAAGAG
SALM 178R ATCATTTCTATGTTCGTCATTCCA
    Probes SALM 178fl GAGGATTCTGTCAATGTAGAACGACCC-FITC
SALM 178iLC610 Red610-TAAACACCAATATCGCCAGTACGATATTCAGTGCG-PO4
Shigella sp./enteroinvasive E. coli ipaH (set 663)
    Primers SHIG 172F ATAGAAGTCTACCTGGCCT
SHIG 172R GGGAGAACCAGTCCGTAA
    Probes SHIG 172fl CAAATGACCTCCGCACTGCC-FITC
SHIG 172iLC670 Red610-AGCCACGGTCAGAAGCCG-PO4
Yersinia sp. lysP (set 664)
    Primers lysP 156F GGCATCATGAAAGGCGG
lysP 156R TGATTCACCAGCAGCAATAC
    Probes lysP 156fl GGTTCTCGGCGATGATTGGTGTGG-FITC
lysP 156iLC670 Red610-ATGATTGTCGGTTTCTCCTTCCAGGGAACTGAGC-PO4
a

Sets: TIB MolBio, Adelphia, NJ.

Positive PCR controls.

Positive control plasmids were constructed for the four target genes (Table 1) by using the pCR2.1 TOPO TA cloning kit (Invitrogen Corp., Carlsbad, CA) according to the manufacturer's instructions. Sources for the inserted target sequences were Campylobacter jejuni ATCC 35919, Campylobacter coli ATCC 43472, Salmonella enterica ATCC 35987, Shigella sonnei ATCC 25931, and Yersinia enterocolitica ATCC 9610. Plasmids were purified by using a High Pure plasmid isolation kit (Roche Applied Science, Indianapolis, IN). The sizes of the cloned inserts were confirmed by restriction enzyme digestion (EcoRI; Invitrogen Corp). Plasmid inserts were sequenced by using the M13 forward and reverse primers included in the TOPO TA cloning kit to assure proper insert orientation. Plasmids were diluted in Tris-EDTA buffer (pH 8.0) and stored at 4°C.

Stool processing and extraction for PCR.

Sterile cotton swabs were used to transfer a pea-sized amount of formed or semiformed fresh stool into 1 ml of 1:1 Stool Transport and Recovery medium (STAR; Roche Applied Science, Indianapolis, IN) buffer-sterile water. For liquid specimens and those transported in Cary Blair medium, a 100-μl aliquot was placed in 1 ml of 1:1 STAR buffer-sterile water. The resultant stool slurries were vortexed and centrifuged at 20,800 × g for 10 s. Then, 200 μl of the supernatant was transferred to a MagNA Pure sample cartridge (Roche Applied Science). DNA extraction was performed on a MagNA Pure LC 2.0 using the MagNA Pure LC total nucleic acid isolation kit (Roche Applied Science).

PCR.

The four assays were independently optimized on the LightCycler 2.0 platform using LightCycler software version 4.1 (Roche Applied Science). Next, 15-μl portions of PCR master mix containing final concentrations of 1× Roche LC Fast Start DNA Master HybProbe (Taq DNA polymerase, PCR buffer, deoxyribonucleoside triphosphate with dUTP substituted for dTTP, 1 mM MgCl2), 3 mM (additional) MgCl2, and 1× concentrations of each of the LightCycler primer-probe sets (Table 1) were added to a 20-μl LightCycler cuvette. Extracted nucleic acid (5 μl) was then added to each cuvette containing the respective master mix. The cycling program was as follows: denaturation at 95°C for 10 min; amplification for 45 cycles of 10 s at 95°C, 15 s at 55°C (single acquisition), and 15 s at 72°C; melting-curve analysis/amplicon detection for 0 s at 95°C, 20 s at 59°C, 20 s at 40°C (ramp rate of 0.2°C/s), and 0 s at 85°C (ramp rate of 0.2°C/s and continuous acquisition); and finally cooling 30 s at 40°C. Positive and negative controls were included in each run. The positive control consisted of plasmids constructed for each of the aforementioned assays diluted in 1:1 STAR buffer-sterile water at a final concentration of 1,000 targets/μl. The negative control contained 1,000 CFU of Escherichia coli ATCC 25922/μl.

Analytical sensitivity and specificity, cross-reactivity, and inhibition.

Analytical sensitivity was assessed by spiking a series of dilutions of clinical isolates of C. jejuni, C. coli, Salmonella enterica serovar Typhimurium, Shigella boydii, and Yersinia enterocolitica into fresh and Cary Blair transported stools. To determine the analytical specificity, predicted amplified product, primer, and probe sequences were subjected to BLAST searches using the National Center for Biotechnology Information (NCBI) genomic database (http://www.ncbi.nlm.nih.gov). Cross-reactivity studies were performed using a previously described panel of 66 organisms (6), Helicobacter pylori (n = 3) and Helicobacter cinaedi, and an enteric pathogens inclusivity panel (Table 2). Inhibition studies were performed by spiking 50 stool extracts negative for enteric pathogens with each plasmid control (final concentration, 100 targets/μl) and assaying the resultant mixtures by PCR.

TABLE 2.

Enteric pathogen inclusivity panel

Organism Strain Detected
Campylobacter jejuni ATCC 29428 Yes
Campylobacter jejuni ATCC 35919 Yes
Campylobacter jejuni ATCC 33560 Yes
Campylobacter jejuni ATCC 33291 Yes
Campylobacter coli Patient isolate Yes
Campylobacter coli ATCC 33559 Yes
Campylobacter coli ATCC 43472 Yes
Campylobacter upsaliensis Patient isolate
Campylobacter fetus ATCC 33248
Campylobacter sputorum ATCC 33710
Campylobacter hyointestinalis ATCC 35217
Campylobacter lari ATCC 35221
Escherichia colia ATCC 43893 Yes
E. colia CDC TD215 Yes
E. colia CDC EDL 1282 Yes
Salmonella arizonae Patient isolate Yes
Salmonella bongori ATCC 43975 Yes
Salmonella choleraesuis ATCC 23565 Yes
Salmonella enterica ATCC 35987 Yes
Salmonella enterica serovar Paratyphi CDC AB9-C12 Yes
Salmonella enterica serovar Typhi CAP D-2-79 Yes
Salmonella enterica serovar Typhimurium ATCC 14028 Yes
Shigella boydii CAP D-01-96 Yes
Shigella dysenteriae CDC 82-002-72 Yes
Shigella flexneri ATCC 29903 Yes
Shigella sonnei ATCC 25931 Yes
Yersinia enterocolitica ATCC 9610 Yes
Yersinia kristensenii NYS 3-85
Yersinia pseudotuberculosis CAP LPS A-01 Yes
Yersinia frederiksenii/Yersinia intermedia Patient isolate Yes
Yersinia frederiksenii ATCC 29912 Yes
Yersinia intermedia ATCC 29909 Yes
Yersinia pseudotuberculosis ATCC 907 Yes
Yersinia aldovae DSMZ 18303 Yes
Yersinia alecsiciae DSMZ 14987 Yes
Yersinia bercovieri DSMZ 18528 Yes
Yersinia massiliensis DSMZ 21859 Yes
Yersinia mollaretii DSMZ 18520 Yes
Yersinia rohdei DSMZ 18270 Yes
Yersinia ruckeri DSMZ 18506 Yes
Yersinia similis DSMZ 18211 Yes
a

That is, an enteroinvasive E. coli strain.

Clinical sensitivity and specificity.

The clinical sensitivity and specificity were assessed by assaying the aforementioned stools by PCR and comparing the results to those of culture. For Salmonella PCR, results were compared to culture with or without selenite enrichment. Discordant results were subjected to repeat extraction and PCR, attempted cultivation using enrichment methods, and isolate testing (when available) by PCR. For organisms cultured from fewer than 30 human stool specimens, additional spiking studies were performed by adding a known low quantity of organism to stool specimens from 30 uninfected (i.e., culture- and PCR-negative) subjects.

Statistical analysis.

The clinical sensitivity and specificity of the PCR assays for detection of enteric pathogens were determined. Comparisons of culture and PCR for Salmonella, Shigella, Campylobacter, and Yersinia species were made by using McNemar's test, a test of paired proportions. P values of <0.05 were considered statistically significant. Statistical analysis was performed by using SAS software version 9.1 (SAS, Inc., Cary, NC).

RESULTS

Analytical sensitivity and specificity, cross-reactivity, and inhibition.

The analytical sensitivity of the Campylobacter PCR assay for the detection of C. jejuni was 16 CFU/ml in fresh and Cary Blair stools, and for the detection of C. coli it was 4,000 CFU/ml in fresh stools and 400 CFU/ml in Cary Blair stools. For the Salmonella PCR assay, the analytical sensitivity was 990 CFU/ml in fresh and 99 CFU/ml in Cary Blair stools. The Shigella/enteroinvasive E. coli PCR assay had an analytical sensitivities of 52 CFU/ml in both fresh and Cary Blair stools for Shigella spp. and 500 CFU/ml in both fresh and Cary Blair stools for enteroinvasive E. coli. The Yersinia PCR assay had analytical sensitivities of 700 CFU/ml in fresh stools and 70 CFU/ml in Cary Blair stools. Amplified product, primer, and probe sequences for each of the assays were subjected to NCBI database searches using BLAST software; no significant homology was noted outside of the genera targeted by these assays. Isolates of Salmonella, Shigella, Campylobacter, and Yersinia species (n = 12) included in the cross-reactivity panel were detected with the respective assays. The remaining isolates in the cross-reactivity panel and the Helicobacter species were not detected with the four assays. The C. jejuni/C. coli PCR assay detected all isolates of both species within the inclusivity panel; however, other members of the genus Campylobacter were not detected (Table 2). The Salmonella and Shigella/enteroinvasive E. coli assays detected all Salmonella and Shigella species tested, respectively; the Shigella/enteroinvasive E. coli assay detected enteroinvasive E. coli. Thirteen species of Yersinia were detected; however, the assay did not detect Yersinia kristensenii. PCR inhibition was not detected in any of the 50 spiked extracts evaluated by all four assays.

Clinical sensitivity and specificity.

Overall, 104 stool specimens were culture-positive for C. jejuni/coli (n = 51), Salmonella species (n = 42), Shigella species (n = 6), and Yersinia species (n = 5). Compared to culture, the overall clinical sensitivity and specificity of PCR detection of these organisms were 92 and 98% (96/104 and 283/288), respectively, from fresh or Cary Blair stool (p, 0.41); 87 and 98% (41/47 and 242/246), respectively, from fresh stool (p, 0.53); and 96 and 98% (55/57 and 41/42), respectively, from Cary Blair stool (p, 0.56). The clinical sensitivities of the PCR assays performed on fresh (87%; 95% confidence interval [CI], 74 to 95%] and Cary Blair (96%; 95% CI, 88 to 100%) stools were not significantly different from one another (P = 0.14).

The Campylobacter PCR assay had a clinical sensitivity and specificity of 96 and 99%, respectively (Table 3). Repeat PCR testing on the two samples missed by PCR was negative; isolates from these samples were unavailable to test by PCR. Five specimens tested PCR positive and culture negative. Repeat PCR testing was negative in all five. The associated stools were placed into Campylobacter enrichment broth (Neogen Corp., Lansing, MI) and incubated for 48 h, followed by subculture to Campy CVA agar; no growth was observed.

TABLE 3.

Clinical sensitivity and specificity of the PCR assays for the detection of enteric pathogens

Organism Stool type No. of strains/total no. of strains (%)
Pf
Sensitivity Specificity
C. jejuni/C. colia Any stool type 49/51 (96) 336/341 (99) 0.26
Fresh stool 23/23 (100) 266/270 (99) 0.05
Cary Blair stool 26/28 (93) 70/71 (99) 0.56
Salmonella spp. (HE)b Any stool type 34/34 (100) 355/358 (99) 0.08
Fresh stool 12/12 (100) 281/281 (100) 1.00
Cary Blair stool 22/22 (100) 74/77 (96) 0.08
Salmonella spp. (SE+HE)c Any stool type 37/42 (88) 350/350 (100) 0.03
Fresh stool 12/17 (71) 276/276 (100) 0.03
Cary Blair stool 25/25 (100) 74/74 (100) 1.00
Shigella spp.d Any stool type 6/6 (100) 386/386 (100) 1.00
Fresh stool 5/5 (100) 288/288 (100) 1.00
Cary Blair stool 1/1 (100) 98/98 (100) 1.00
Yersinia spp.e Any stool type 4/5 (80) 387/387 (100) 0.32
Fresh stool 1/2 (50) 291/291 (100) 0.32
Cary Blair stool 3/3 (100) 96/96 (100) 1.00
a

C. jejuni(n = 49) and C. coli(n = 2).

b

HE, direct culture to Hektoen enteric agar.

c

Salmonella enterica serovars Typhimurium(n = 11), II 2:b:enxz15(n = 1), I 6,8:NM(n = 1), I 45:b:minus(n = 1), Hadar(n = 1), Montevideo(n = 2), Enteritidis(n = 5), II 58:Iz13z28:26(n = 1), Litchfield (n = 1), Hartford(n = 1), Nigeria(n = 2), Muenchen(n = 1), Agona(n = 1), I 4,5,12:i:(n = 1), Saintpaul(n = 1), Anatum(n = 2), Reading(n = 1), and unknown(n = 8). SE+HE, selenite enrichment and subculture to HE agar.

d

S. flexneri(n = 1), S. boydii(n = 1) and S. sonnei(n = 4).

e

Y. enterocolitica(n = 3), Y. fredricksenii(n = 1), and Y. intermedia(n = 1).

f

That is, the P value determined using McNemar's test comparing the culture and PCR results.

The Salmonella PCR assay had a clinical sensitivity and specificity of 100 and 99%, respectively, compared to direct culture to Hektoen enteric agar, and 88 and 100%, respectively, compared to selenite enrichment with subculture to Hektoen enteric agar (Table 3). There were three PCR-positive and five PCR negative stools that were Salmonella culture positive only following selenite broth enrichment culture with subculture to Hektoen enteric agar. For stool transported in Cary Blair medium, the Salmonella PCR assay was 100% sensitive and 96% specific compared to direct culture to Hektoen enteric agar. The assay had a sensitivity and specificity of 100% compared to culture with preparatory selenite enrichment for stool in Cary Blair. Overall, for Salmonella culture using selenite enrichment, PCR was less sensitive than culture from fresh, but not Cary Blair transport medium-preserved stools (P = 0.03 and 1.00, respectively).

The clinical sensitivity and specificity for the Shigella/enteroinvasive E. coli assay were both 100% for detection of Shigella species, but the number of positive specimens with culture-confirmed shigellosis was small (Table 3). A total of 30 uninfected stools were spiked with ∼4,000 CFU of S. boydii/ml and ∼5,000 CFU of enteroinvasive E. coli/ml to add supportive data. The spiking studies were concordant with the expected results. The Yersinia assay was 80% sensitive and 100% specific (Table 3). The PCR assay missed a single culture positive specimen, which had grown Yersinia enterocolitica; the isolate yielded a positive result when tested by PCR. Repeat PCR testing of the stool sample was negative. Although there was an apparent difference in the sensitivity between fresh stool (50%) and Cary-Blair stool (100%), the overall number of culture positive stools was low. In order to supplement the clinical data, 30 uninfected stools were spiked with ∼7,000 CFU of Y. enterocolitica/ml and tested by PCR. Spiking studies were concordant with the expected results.

DISCUSSION

We validated a panel of PCR assays for the detection of Salmonella, Campylobacter, and Yersinia species and of Shigella species/enteroinvasive E. coli. This panel performed comparably to culture for the detection of these organisms in stool but yields results in 3 h (or less) versus 2 to 5 days with conventional culture. Overall, the PCR assay panel performed well on fresh stool or stool in Cary Blair medium. The sensitivity of the Salmonella PCR assay was not as good as culture when using selenite enrichment for fresh stool but was as good as culture when using selenite enrichment for stool in Cary Blair medium (or culture without selenite enrichment for either fresh stool or stool in Cary Blair medium). Cary Blair medium provides stability, through pH buffering activity, to fecal specimens submitted for routine culture (3). With the described PCR assay, processing, extraction, and amplification/detection take 2.5 to 3 h per run of up to 30 patient specimens. Paired with reflexive culture of stools testing positive (e.g., for antimicrobial susceptibility testing as needed), this assay panel should (i) improve the care of patients with acute bacterial gastroenteritis through improved turnaround time, “leading to more timely and directed therapeutic intervention” (15), (ii) mitigate the inappropriate use of antibiotics, and (iii) aid epidemiologic investigations (14).

Although there have been publications describing conventional and real-time PCR assays for the detection of Salmonella species, Shigella species, enteroinvasive E. coli, and/or Campylobacter species in stool, we believe this to be the most comprehensive real-time PCR assay panel described for the detection of enteric pathogens and that this panel was evaluated against the largest number of human stool samples to date. Iijima et al. described a real-time PCR assay for detection of S. enterica and C. jejuni in stool samples; however, of the human stool specimens tested, only nine were culture positive for S. enterica, and 16 were culture positive for C. jejuni (8). Our PCR panel also includes Shigella and Yersinia species and enteroinvasive E. coli, and our clinical evaluation included a substantially larger number of culture-positive samples.

Conventional PCR assays require gel electrophoresis of amplified PCR product, which, when applied in clinical laboratories, increases the risk of amplified product contamination and turnaround time (i.e., compared to closed-system real-time PCR assays, as described here). Abu Elamreen et al. described a conventional PCR panel that included detection of Shigella and Salmonella species and C. jejuni/coli; however, only nine of the specimens studied were culture positive for any of these organisms (1). Other investigators have described conventional PCR assays for the detection of Campylobacter species in stool (2, 11). Huong et al. described a conventional PCR assay for the detection of C. jejuni and coli in stool samples (7). Although that assay yielded more positive results than did culture (275/358 [77%] versus 202/358 [56%]), culture was performed on frozen stools, which likely decreased its sensitivity (7). In addition, 16/202 (8%) of the culture-positive stools were PCR negative, apparently as a result of inhibitors, which were shown to be effectively removed by our specimen-processing approach (7). Takeshi et al. described conventional PCR assays for detection of C. jejuni and Salmonella species in patients with bloody diarrhea but studied only 24 patients (13). Finally, Dutta et al. described a conventional PCR assay for enteroinvasive E. coli and Shigella detection in stool (5).

Logan et al. described a nested PCR assay for the detection of Campylobacter species which increases the possibility of contamination versus a non-nested assay (10). Further, these researchers only evaluated stools from 38 subjects (of whom half were culture positive) (10).

Although Y. enterocolitica is the most frequently isolated Yersinia species in diarrheal stools, other species of Yersinia, including Y. intermedia and Y. fredericksenii, may be encountered from clinical specimens (9) and are detected by our Yersinia assay. A limitation of the assay is that it does not detect Y. kristensenii, a species that accounted for 3/194 (1.5%) Yersinia stool isolates at our institution from 1985 to 1999 (9).

A limitation of our study is that culture for enteroinvasive E. coli was not routinely performed; however, this type of E. coli is rare in the United States. In addition, the ideal enteric-pathogen PCR study would be prospectively performed; however, such as single-institution study would require several years to yield the number of culture-positive specimens studied here.

Clinical application of the PCR assay panel described will offer a substantially shorter turnaround time compared to conventional culture, although the cost benefit of this assay panel versus conventional culture deserves further study. Real-time, closed-system PCR is arguably easier to perform than is conventional culture and identification. Accordingly, clinical application of these assays may circumvent the need for skilled microbiology technologists to interpret stool cultures, which is important since many laboratories are struggling to find experienced technologists. Rapid testing for enteric bacterial disease is a new tool for clinicians in their care of patients and public health personnel in their investigation and control of the spread of enteric bacterial diseases. It may provide cost savings in that PCR positive specimens can be selected for focused culture for antimicrobial susceptibility testing.

Acknowledgments

We thank Franklin C. Cockerill III for his thoughtful review of the manuscript and the outstanding staff of the Mayo Clinic Bacteriology Laboratory for performing the stool cultures reported herein.

Footnotes

Published ahead of print on 2 June 2010.

REFERENCES

  • 1.Abu Elamreen, F. H., A. A. Abed, and F. A. Sharif. 2007. Detection and identification of bacterial enteropathogens by polymerase chain reaction and conventional techniques in childhood acute gastroenteritis in Gaza, Palestine. Int. J. Infect. Dis. 11:501-507. [DOI] [PubMed] [Google Scholar]
  • 2.Al Amri, A., A. C. Senok, A. Y. Ismaeel, A. E. Al-Mahmeed, and G. A. Botta. 2007. Multiplex PCR for direct identification of Campylobacter spp. in human and chicken stools. J. Med. Microbiol. 56:1350-1355. [DOI] [PubMed] [Google Scholar]
  • 3.Cary, S. G., and E. B. Blair. 1964. New transport medium for shipment of clinical specimens. I. Fecal specimens. J. Bacteriol. 88:96-98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Centers for Disease Control and Prevention. 2009. Preliminary FoodNet Data on the incidence of infection with pathogens transmitted commonly through food-10 states, 2008. MMWR Morb. Mortal. Wkly. Rep. 58:333-337. [PubMed] [Google Scholar]
  • 5.Dutta, S., A. Chatterjee, P. Dutta, K. Rajendran, S. Roy, K. C. Pramanik, and S. K. Bhattacharya. 2001. Sensitivity and performance characteristics of a direct PCR with stool samples in comparison to conventional techniques for diagnosis of Shigella and enteroinvasive Escherichia coli infection in children with acute diarrhoea in Calcutta, India. J. Med. Microbiol. 50:667-674. [DOI] [PubMed] [Google Scholar]
  • 6.Grys, T. E., L. M. Sloan, J. E. Rosenblatt, and R. Patel. 2009. Rapid and sensitive detection of Shiga toxin-producing Escherichia coli from nonenriched stool specimens by real-time PCR in comparison to enzyme immunoassay and culture. J. Clin. Microbiol. 47:2008-2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Houng, H. S., O. Sethabutr, W. Nirdnoy, D. E. Katz, and L. W. Pang. 2001. Development of a ceuE-based multiplex polymerase chain reaction (PCR) assay for direct detection and differentiation of Campylobacter jejuni and Campylobacter coli in Thailand. Diagn. Microbiol. Infect. Dis. 40:11-19. [DOI] [PubMed] [Google Scholar]
  • 8.Iijima, Y., N. T. Asako, M. Aihara, and K. Hayashi. 2004. Improvement in the detection rate of diarrhoeagenic bacteria in human stool specimens by a rapid real-time PCR assay. J. Med. Microbiol. 53:617-622. [DOI] [PubMed] [Google Scholar]
  • 9.Loftus, C. G., G. C. Harewood, F. R. Cockerill III, and J. A. Murray. 2002. Clinical features of patients with novel Yersinia species. Dig. Dis. Sci. 47:2805-2810. [DOI] [PubMed] [Google Scholar]
  • 10.Logan, J. M., K. J. Edwards, N. A. Saunders, and J. Stanley. 2001. Rapid identification of Campylobacter spp. by melting peak analysis of biprobes in real-time PCR. J. Clin. Microbiol. 39:2227-2232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Maher, M., C. Finnegan, E. Collins, B. Ward, C. Carroll, and M. Cormican. 2003. Evaluation of culture methods and a DNA probe-based PCR assay for detection of Campylobacter species in clinical specimens of feces. J. Clin. Microbiol. 41:2980-2986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sloan, L. M., B. J. Duresko, D. R. Gustafson, and J. E. Rosenblatt. 2008. Comparison of real-time PCR for detection of the tcdC gene with four toxin immunoassays and culture in diagnosis of Clostridium difficile infection. J. Clin. Microbiol. 46:1996-2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Takeshi, K., T. Ikeda, A. Kubo, Y. Fujinaga, S. Makino, K. Oguma, E. Isogai, S. Yoshida, H. Sunagawa, T. Ohyama, and H. Kimura. 1997. Direct detection by PCR of Escherichia coli O157 and enteropathogens in patients with bloody diarrhea. Microbiol. Immunol. 41:819-822. [DOI] [PubMed] [Google Scholar]
  • 14.Thielman, N. M., and R. L. Guerrant. 2004. Clinical practice: acute infectious diarrhea. N. Engl. J. Med. 350:38-47. [DOI] [PubMed] [Google Scholar]
  • 15.Turgeon, D. K., and T. R. Fritsche. 2001. Laboratory approaches to infectious diarrhea. Gastroenterol. Clin. N. Am. 30:693-707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Wong, C. S., S. Jelacic, R. L. Habeeb, S. L. Watkins, and P. I. Tarr. 2000. The risk of the hemolytic-uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 infections. N. Engl. J. Med. 342:1930-1936. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES