Skip to main content
American Journal of Physiology - Cell Physiology logoLink to American Journal of Physiology - Cell Physiology
. 2010 May 12;299(2):C381–C388. doi: 10.1152/ajpcell.00530.2009

Neonatal intermittent hypoxia impairs neuronal nicotinic receptor expression and function in adrenal chromaffin cells

Dangjai Souvannakitti 1, Barbara Kuri 3, Guoxiang Yuan 1, Anita Pawar 1, Ganesh K Kumar 1, Corey Smith 3, Aaron P Fox 2, Nanduri R Prabhakar 1,✉
PMCID: PMC2928622  PMID: 20664070

Abstract

We recently reported that adrenomedullary chromaffin cells (AMC) from neonatal rats treated with intermittent hypoxia (IH) exhibit enhanced catecholamine secretion by hypoxia (Souvannakitti D, Kumar GK, Fox A, Prabhakar NR. J Neurophysiol 101: 2837–2846, 2009). In the present study, we examined whether neonatal IH also facilitate AMC responses to nicotine, a potent stimulus to chromaffin cells. Experiments were performed on rats exposed to either IH (15-s hypoxia-5-min normoxia; 8 h/day) or to room air (normoxia; controls) from ages postnatal day 0 (P0) to P5. Quantitative RT-PCR analysis revealed expression of mRNAs encoding α3-, α5-, α7-, and β2- and β4-nicotinic acetylcholine receptor (nAChR) subunits in adrenal medullae from control P5 rats. Nicotine-elevated intracellular Ca2+ concentration ([Ca2+]i) in AMC and nAChR antagonists prevented this response, suggesting that nAChRs are functional in neonatal AMC. In IH-treated rats, nAChR mRNAs were downregulated in AMC, which resulted in a markedly attenuated nicotine-evoked elevation in [Ca2+]i and subsequent catecholamine secretion. Systemic administration of antioxidant prevented IH-evoked downregulation of nAChR expression and function. P35 rats treated with neonatal IH exhibited reduced nAChR mRNA expression in adrenal medullae, attenuated AMC responses to nicotine, and impaired neurogenic catecholamine secretion. Thus the response to neonatal IH lasts for at least 30 days. These observations demonstrate that neonatal IH downregulates nAChR expression and function in AMC via reactive oxygen species signaling, and the effects of neonatal IH persist at least into juvenile life, leading to impaired neurogenic catecholamine secretion from AMC.

Keywords: adrenal medullary chromaffin cells, nicotinic cholinergic receptors, recurrent apneas, reactive oxygen species, catecholamine secretion


adrenal medullary chromaffin cells (AMC) are sensitive to hypoxia in neonates, and low O2 stimulates catecholamine secretion (2, 10, 21, 31, 33, 35, 37). Hypoxia-evoked catecholamine secretion from AMC involves inhibition of various types of K+ channels, leading to depolarization (10, 15, 17, 20, 38) and ensuing Ca2+ influx via high- (1, 20, 40) and low-voltage-gated (18) Ca2+ channels. Chronic sustained hypoxia (SH) alters K+ and Ca2+ channel expressions (7, 8) and facilitates hypoxia-evoked catecholamine secretion (36) in PC12 cells, which are of adrenal medullary origin. Moreover, Carabelli et al. (3) reported upregulation of T-type Ca2+ channels in AMC, and they mediate the enhanced catecholamine secretion in chronic hypoxia-treated adult rats. We recently examined the effects of chronic SH and intermittent hypoxia (IH) on low-O2-evoked catecholamine secretion from AMC in neonatal rats and found that chronic SH attenuates, whereas IH enhances, hypoxia-evoked catecholamine secretion (35). The faciltatory effects of IH were associated with modulation of Ca2+ signaling by reactive oxygen species (ROS) (35). Whether IH also facilitates AMC responses to other excitatory stimuli, however, was not examined.

Acetylcholine released from the splanchnic nerve activates neuronal nicotinic acetylcholine receptors (nAChRs) on AMC and evokes catecholamine secretion. Although sympathetic innervation to target organs is incomplete in neonates (10, 34), previous studies reported nAChR expression in neonatal AMC (19, 32). Given that nicotine is a potent excitatory stimulus to AMC (32), in the present study, we tested the hypothesis that exposing neonatal rats to IH enhances the AMC response to nicotine in a manner similar to that reported for hypoxia.

MATERIALS AND METHODS

Experimental protocols were approved by the Institutional Animal Care and Use Committee of the University of Chicago. Experiments were performed on neonatal Sprague-Dawley rats between ages postnatal day 0 (P0) and P35.

Exposure to IH.

Rat pups (P0), along with their mothers, were exposed to IH (15-s 10% O2 followed by 5-min 21% O2; 8 h/day) for 5 days (P0–P5; between 9:00 AM and 5:00 PM), as described previously (27, 35). Briefly, rat pups, along with their mother, were housed in feeding cages and placed in a chamber designed for exposure to IH. The animals were unrestrained, freely mobile, and fed ad libitum. The chamber was flushed with alternating cycles of nitrogen gas and room air. Ambient O2 and CO2 levels in the chamber were continuously monitored, and CO2 levels were maintained between 0.2 and 0.5%. Control experiments were performed on age-matched rat pups exposed to room air. In the protocols involving antioxidant treatment, rat pups were given manganese (III) tetrakis (1-methyl-4-pyridyl) porphyrin pentachloride (MnTMPyP; ALEXIS Biochemicals; 5 mg·kg−1·day−1 ip), a membrane-permeable antioxidant, every day before the rats were placed in the IH chamber. Rat pups treated with vehicle (saline) served as controls. Acute experiments were performed 6–10 h following the termination of IH.

Preparation of AMC and cell culture.

AMC cells were isolated, as described previously (35). Briefly, adrenal glands were harvested from anesthetized rats (urethane; 1.2 g/kg ip). After the adrenal cortex was removed, chromaffin cells were enzymatically dissociated using a mixture of collagenase P (2 mg/ml; Roche), DNase (25 μg/ml; Sigma), and bovine serum albumin (3 mg/ml; Sigma) at 37°C for 30 min, followed by a 15-min digestion in 0.03% trypsin/EDTA (Invitrogen) and DNase 50 μg/ml (Sigma). Cells were centrifuged at 200 g for 15 min at 4°C, plated on collagen-coated (type VII; Sigma) coverslips, and maintained at 37°C in a 5% CO2 balanced with 21% O2 incubator for 12–24 h. The growth medium consisted of F-12 K medium (Invitrogen), supplemented with 10% horse serum, 5% fetal bovine serum, and 1% penicillin-streptomycin-glutamine cocktail (Invitrogen).

Amperometry.

Catecholamine secretion from AMC was monitored by amperometry using carbon fiber electrodes, as described previously (35). Briefly, the carbon fiber electrode was held at +700 mV vs. a ground electrode using an NPI VA-10 amplifier to oxidize catecholamine transmitter. The amperometric signal was low-pass filtered at 2 kHz (eight-pole Bessel; Warner Instruments, Hamden, CT) and sampled into a computer at 10 kHz using a 16-bit A/D converter (National Instruments, Austin, TX). Records with root-mean-square noise >2 pA were not analyzed. Amperometric spike features, quantal size, and kinetic parameters were analyzed using a series of macros written in Igor Pro (Wavemetrics, Lake Oswego, OR; kindly supplied by Dr. Eugene Mosharov). The detection threshold for an event was set four to five times the root-mean-square noise, and the spikes were automatically detected. The area under individual amperometric spikes is equal to the charge (pC) per release event, referred to as Q. The number of oxidized neurotransmitter molecules (N) was calculated using the Faraday equation, N = Q/ne, with n = 2 electrons per oxidized molecule of transmitter, and e is the elemental charge (1.603 × 10−19 C).

Recording solutions and stimulation protocols.

Amperometric recordings were made from adherent cells that were superfused with Hanks' balanced salt solution at a flow rate of ∼1.0 ml/min (chamber volume ∼80 μl), having the following composition (in mM): 1.26 CaCl2, 0.49 MgCl2·6H2O, 0.4 MgSO4·7H2O, 5.33 KCl, 0.441 KH2PO4, 137.93 NaCl, 0.34 Na2HPO4·7H2O, 5.56 dextrose, and 20 HEPES at pH 7.35 and 300 mosM. All experiments were performed at ambient temperature (23 ± 2°C). Nicotine bitartarate (Sigma Chemical, St. Louis, MO) was added to the perfusate to obtain final concentrations of 1, 3, 10, and 30 μM.

Measurements of intracellular Ca2+ concentration.

Intracellular Ca2+ concentration ([Ca2+]i) was monitored in AMC, as described previously (39). Briefly, AMC were incubated in Hanks' balanced salt solution containing 2 μM fura 2-AM and 1 mg/ml albumin for 30 min and then washed in a fura 2-free solution for 30 min at 37°C. The coverslip was transferred to an experimental chamber for recording. On each coverslip, four to eight chromaffin cells were selected and individually imaged. Image pairs (one at 340 nm and the other at 380 nm) were obtained every 2 s by averaging 16 frames at each wavelength, and background fluorescence was subtracted from the individual wavelengths. The 340-nm image divided by the 380-nm image provided a ratiometric image. Ratios were converted to free [Ca2+]i by comparing data to fura 2 calibration curves made in vitro by adding fura 2 (50 μM free acid) to solutions that contained known concentrations of calcium (0–2,000 nM). The recording chamber was continually perfused with fresh solution from reservoirs.

Adrenal medullary slice preparation.

Adrenal tissue slices from P35 rats were prepared as per the protocols described previously in mouse (4). Briefly, animals were deeply anesthetized by isoflurane inhalation (Abbott Laboratories, Abbott Park, IL) and killed by decapitation. Adrenal glands were removed and placed in ice-cold, low-calcium bicarbonate-buffered saline (BBS) containing, in mM: 140 NaCl, 2 KCl, 0.1 CaCl2, 5 MgCl2, 26 NaHCO3−, and 10 glucose that was bubbled with 95% O2-5% CO2. Osmolarity of the BBS was 320 mosM. All chemicals were acquired from Fischer Scientific (Hanover Park, IL), unless otherwise noted. The adrenal glands were trimmed and embedded in 3% low gelling point agarose (Sigma, St Louis, MO) that was prepared by melting agar in low-calcium BBS at 110°C, followed by equilibration to 35°C. The agarose block containing the adrenal glands was trimmed into 7-mm cubes and glued to a tissue stand of a vibratome (WPI, Sarasota, FL). The adrenal glands were sectioned into 200-μm slices in ice-cold BBS. Sections were cut along the major axis and parallel to the maximum width to preserve splanchnic innervation for in situ stimulation (12).

Measurements of neurogenic catecholamine secretion from adrenal medullary slice preparation.

The splanchnic nerve was stimulated by a parallel bipolar stimulator, as previously described (16). Briefly, the bipolar stimulator fitted with two platinum electrodes (250-μm spacing) (FHC, Bowdoin, ME) was connected to an ISO-Stim 01-D stimulator (ALA Scientific Instruments, Westbury, NY) and controlled by transistor-transistor logic triggers generated by the EPC-9 through the Pulse software (HEKA, Bellmore, NY). The adrenal gland slice was placed between the two electrodes and visualized using an upright microscope (Olympus, Center Valley, PA), equipped with a ×40 water-immersion objective. The splanchnic nerve was stimulated with 10 pulses at a frequency of 0.2 Hz. All stimuli were delivered at constant voltage (35 V) with 10-μs duration. Data recorded for total amperometric current were measured 60 s after the conclusion of the stimulation protocol.

Measurements of nAChR subunit mRNA expression.

Real-time RT-PCR was carried out using a MiniOpticon system (Bio-Rad Laboratories, Hercules, CA) with SYBR GreenER two-step qRT-PCR kit (no. 11764-100, Invitrogen), as previously described (28). Briefly, RNA was extracted from adrenal medullae using TRIZOL and was reverse transcribed using superscript III reverse transcriptase. Primer sequences for real-time RT-PCR amplification were as follows: 18s: [forward (fw)] GTAACCCGTTGAACCCCATT and [reverse (rev)] CCATCCAATCGGTAGTAGCG (size 151, Gene Bank no. X_01117); α2: (fw) CCACCAATGTCTGGCTA AAGCA and (rev) AAGAAGAGGTGAGCC TTGGTCA (size 162, Gene Bank no. nm1334); α3: (fw) CGCCTGTTCCAGTACCTGTT and (rev) GCTTCAGCCACAGGTTGGTTT (size 155, Gene Bank no. X03440); α4: (fw) CGG CAT CTT GAG TGA CAT CTG C and (rev) GCTTTGATGAGCATTGGAGCCC (size 198, Gene Bank no. L31620); α5: (fw) CAT CCT GGC AAA CCC TAC CAA T and (rev) C CCA GCT ACT CAG GAG GTT T TG (size 182, Gene Bank no. J05231); α6: (fw) GGT GTT AAG GAC CCC AAA ACC C and (rev) ATT CTC TGT TAC CCA CTG TGC G (size 188, Gene Bank no. L08227); α7: (fw) GCATCTGGGCATTGCCAGTATC and (rev) TCCCATGAGATCCCATTCTCCG (size 198, Gene Bank no. L31619); β2: (fw) ATGCTGACGGCATGTACGAAGT and (rev) GCC ACA TCA CTT TTG AGC ACC A (size 188, Gene Bank no. L31622); β4 (fw) TT GTGAAGTCCA GTG GAACCG T and (rev) cc cctttgcgtt gagtatctcc (size 203, Gene Bank no. AY574259) (1, 14). Relative mRNA quantification was calculated using the comparative threshold (CT) method using the formula 2−ΔCT, where ΔCT is the difference between the threshold cycle of the given target cDNA between normoxia and IH. The CT value was taken as a fractional cycle number at which the emitted fluorescence of the sample passes a fixed threshold above the baseline. Values were compared with an internal standard gene 18S. Purity and specificity of all products were confirmed by omitting the template and by performing a standard melting curve analysis.

Western blot assay.

Immunoblot assays were performed as described previously (23). Briefly, adrenal medullae were homogenized and fractionated by 4–15% polyacrylamide-SDS gradient gel electrophoresis and transferred to a polyvinylpyrrolidone difluoride membrane (Immobilon-P, Millipore). The membrane was blocked with Tris-buffered saline-Tween 20 (TBS-T) containing 5% nonfat milk at 4°C overnight. Membranes were incubated with anti-nAChR-α3 antibody (1:500; Novus) or α-tubulin (1:400; Santa Cruz) in TBS-T containing 3% nonfat milk. Membranes were treated with goat anti-rabbit secondary antibody conjugated with horseradish peroxidase (Santa Cruz; 1:2,000) in TBS-T containing 3% nonfat milk. Immune complexes on the membrane were visualized using an enhanced chemiluminescence detection system (Amersham). The membranes were exposed to Kodak XAR films.

Data analysis.

Statistical analyses between experimental groups are presented as means ± SE, and Student's t-test was used for statistical comparisons between two groups. P values <0.05 were considered significant.

RESULTS

Effect of IH on nAChRs expression in AMC.

Adrenal medullae from P5 rats expressed mRNAs encoding α3-, α5-, α7-, and β2- and β4-nAChR subunits (Fig. 1A). The relative abundance of α3- and β4-mRNAs was significantly larger than those of the other subunits (P < 0.001). In IH-treated adrenal medullae, mRNA levels of all nAChR subunits were significantly reduced compared with controls (Fig. 1, A and B). Since α3-mRNA expression was the most abundant, we decided to monitor its protein levels using Western blot assay in control and IH-treated adrenal medullae. Representative immunoblot and average densitometric data are presented in Fig. 1, C and D. nAChR α3-protein was reduced by ∼60% in IH-treated compared with control adrenal medullae (P < 0.001). Thus neonatal IH exposure reduced both α3-mRNA and proteins levels to a similar extent.

Fig. 1.

Fig. 1.

Effect of neonatal intermittent hypoxia (IH) on adrenomedullary nicotinic acetylcholine receptor (nAChR) subunit mRNA expressions. A and B: quantitative RT-PCR analysis of mRNAs encoding nAChR subunits in adrenal medullae from postnatal day 5 (P5) rats reared under normoxia (control) or IH. Results (means ± SE) were expressed as ratio of nAChR subunit mRNAs to 18S mRNA (A) and response to IH presented as percentage of controls (B). C: representative immunoblot of nAChR-α3 protein expression in control (N) and IH-treated adrenal medullae from P5 rat. α-Tubulin expression was analyzed as a housekeeping protein. D: averaged densitometric data of nAChR-α3 protein expression in control and IH-treated adrenal medullae from P5 rats. Values are means ± SE from three individual experiments. **P < 0.01.

Effect of IH on [Ca2+]i response to nicotine.

Nicotine-evoked changes in [Ca2+]i are commonly used to assess nAChR function (12, 24). Analysis of [Ca2+]i response to 10 μM nicotine showed significant and reproducible elevations in [Ca2+]i (Fig. 2A). A combination of nAChR subunit blockers [1 μM methyllycaconitine, 20 μM mecamylamine, and 20 μM dihydro-β-erythroidine (11)] completely prevented the nicotine-evoked increase in [Ca2+]i (Fig. 2, A and B). Further analysis with selective blockers of nAChR subunits revealed that α-conotoxin AulB (10 μM; conotoxin), an inhibitor of α3 containing nAChRs, (14, 22), reduced the nicotine-evoked increase in [Ca2+]i by ∼60% (P < 0.001), whereas methyllcaconitine (50 nM), a selective inhibitor of α7-nAChRs (30), caused a modest (24%) but significant attenuation of the [Ca2+]i response to nicotine (P < 0.05; Fig. 2, A and B). In IH-treated AMC, basal [Ca2+]i levels were significantly higher compared with controls (P < 0.01), and nicotine-evoked [Ca2+]i responses were significantly attenuated (Fig. 2, C and D).

Fig. 2.

Fig. 2.

Effect of neonatal IH on intracellular Ca2+ concentration ([Ca2+]i) responses of adrenal medullary chromaffin cells (AMC) to nicotine (Nic). A: examples illustrating [Ca2+]i responses to Nic (10 μM) determined every 2 s in individual AMC from P5 rats reared under normoxia. Nic + anatagonists = nicotine + 1 μM methyllycaconitine, 20 μM mecamylamine, and 20 μM dihydro-β-erythroidine; Nic + Conotoxin = nicotine + 10 μM α-conotoxin AulB; Nic + MLA = nicotine + 50 nM methyllycaconitine. Horizontal solid bars represent the duration of Nic application. B: plots averaged [Ca2+]i response to Nic in control AMC from P5 rats presented as means ± SE of change in [Ca2+]i from baseline levels (Nic-basal); N = 17 cells for Nic + Nic, 16 cells for Nic + antagonists, 17 cells for Nic + Conotoxin, and 18 cells for Nic + MLA. In each group, cells derived from three different litters were used. C: examples of [Ca2+]i responses to 10 μM Nic in control and IH-treated AMC. D: averaged data (means ± SE) of change in [Ca2+]i observed after Nic application (Nic-basal) from control (n = 30 cells) and IH (n = 34 cells), respectively. ***P < 0.001, **P < 0.01, and *P < 0.05.

Effect of IH on nicotine-evoked catecholamine secretion.

Figure 3 compares nicotine-evoked catecholamine secretion from control and IH-treated AMC. Representative amperometric tracings and averaged data are presented. Nicotine evoked robust catecholamine secretion from control AMC in a dose-dependent manner (Fig. 3). In IH-treated AMC, nicotine-evoked catecholamine secretion was markedly attenuated due to a reduced number of secretory events, as well as a reduction in the amount of catecholamine released per secretory event. This finding was consistent for all concentrations of nicotine tested (Fig. 3, C and D).

Fig. 3.

Fig. 3.

Effect of neonatal IH on Nic-evoked catecholamine (CA) secretion from AMC. A and B: examples of Nic-evoked CA secretion from control and neonatal IH-treated AMC, respectively. Bottom: amperometric signals on expanded time scale. The horizontal solid bars represent the duration of the Nic application. C and D: averaged dose-response plots of the number of secretory events per minute and averaged CA molecules released per event, respectively, as a function of Nic concentration. Values are means ± SE from 17 control and 18 IH-treated cells. Chromaffin cells were obtained from three different litters in each group. Smooth curves represent fitted dose-response functions.

Antioxidant treatment prevents IH-induced changes in nAChR expression and function.

Our previous results showed that the effects of IH on AMC were mediated by the increased generation of ROS (35). To determine whether ROS played a similar role in IH-evoked changes in nAChR function and expression, rat pups were treated with MnTMPyP (a cell-permeable antioxidant) every day from P0 to P5 before they were subjected to IH. Vehicle-treated rat pups served as controls. MnTMPyP treatment prevented the attenuated nicotine-evoked elevation of [Ca2+]i, and catecholamine release in IH-treated AMC (Fig. 4). Furthermore, MnTMPyP treatment prevented the downregulation of α3-, α7-, β2-, and β4-mRNAs, but not that of α5-mRNA in IH-treated adrenal medullae (Fig. 5).

Fig. 4.

Fig. 4.

Effect of antioxidant treatment in IH-treated rats. Rats were treated with manganese (III) tetrakis (1-methyl-4-pyridyl) porphyrin pentachloride (MnTMPyP; 5 mg·kg−1·day−1 ip), a membrane-permeable antioxidant, every day from P0 to P5 before IH treatment. Control rats were treated with vehicle. A: examples of [Ca2+]i responses to Nic in control, IH, and IH + MnTMPyP-treated AMC. The solid bar represents application of 10 μM Nic. B: averaged change in [Ca2+]i observed in response to Nic application (means ± SE; Nic-basal) in IH and IH + MnTMPyP-treated AMC presented as percentage of controls. N = 30 cells for control, 34 cells for IH, and 24 cells for IH + MnTMPyP. In each group, cells were derived from three different litters. C: examples of Nic-evoked CA secretion from control, IH, and IH + MnTMPyP-treated AMC. D and E: plots averaged number of secretory events per minute and the averaged amount of CA released per secretory event, respectively. Data shown are means ± SE; N = 17, 18, and 10 cells for control, IH, and IH + MnTMPyP groups, respectively. In each group, cells were derived from three different litters. **P < 0.01.

Fig. 5.

Fig. 5.

Effect of antioxidant treatment on IH-evoked changes in nAChR subunit mRNA expression in P5 rat adrenal medullae. Results are expressed as changes in mRNA relative to 18S mRNA and presented as means ± SE from three independent experiments in each group. **P < 0.001 compared with controls.

Neonatal IH impairs AMC responses to nicotine and neurogenic catecholamine secretion in juvenile rats.

To determine whether the effects of IH on AMC can be reversed after reexposure to normoxia, rat pups were treated with IH from P0–P5 and then were reared under normoxia for an additional 30 days. Control experiments were performed on age-matched rats reared in normoxia from P0 to P35. AMC responses to nicotine (10 μM) were examined in both groups of rats. The results are summarized in Fig. 6. The magnitudes of nicotine-evoked elevations in [Ca2+]i, as well as catecholamine secretion, were significantly less in AMC from P35 rats treated with neonatal IH compared with age-matched controls (Fig. 6).

Fig. 6.

Fig. 6.

AMC responses to Nic in P35 rats treated neonatally with IH. A: examples of [Ca2+]i responses of AMC to 10 μM Nic (at solid bar) in P35 rats reared either under normoxia (Control) or treated with IH from ages P0 to P5 and then reared under normoxia for an additional 30 days. Tracings represent [Ca2+]i responses determined every 2 s in individual AMC. B: averaged [Ca2+]i responses of AMC to Nic from control and neonatal IH-treated P35 rats. Data presented are means ± SE; N = 22 and 28 cells for control and IH groups, respectively, derived from three different litters. C and D: examples of Nic-evoked CA secretion (10 μM Nic at solid bar) from AMC harvested from control and P35 rats treated with IH neonatally, respectively. E and F: averaged number of secretory events per minute and average CA molecules per event, respectively. Data in E and F represent means ± SE from 12 cells each in control and IH groups derived from three different litters. **P < 0.01 compared with controls.

nAChR mediate neurogenic catecholamine secretion (34). Splanchnic cholinergic innervation to adrenal medullae matures in the first 2 wk of postnatal life (26). We examined whether neonatal IH impacts neurogenic catecholamine secretion from adrenal medullae in P35 rats. The effect of electrical stimulation of the splanchnic nerve on catecholamine secretion was monitored in adrenal medullary slices from control and neonatal IH-treated rats as an index of neurogenic catecholamine secretion. Examples of catecholamine secretion and average data are summarized in Fig. 7. Stimulation of the splanchnic nerve evoked catecholamine secretion from control slices, and this response was significantly attenuated in adrenal medullary slices from juvenile rats treated with neonatal IH (Fig. 7).

Fig. 7.

Fig. 7.

Neurogenic CA secretion from AMC in P35 rats treated neonatally with IH. A: effect of bipolar splanchnic nerve stimulation on CA secretion from chromaffin cells in adrenal medullary slice preparation. Sample traces are for total CA release (integrated amperometric current) from AMC from P35 rats reared under normoxia (control) or treated with neonatal IH. B: average data of total CA secretion in response to splanchnic nerve stimulation (total pC) from control and neonatal IH-treated medullary slices. The data presented are means ± SE; N = 7 Control and 6 IH cells from medullary slices derived from 4–5 rats in each group. *P < 0.05 compared with controls.

Adrenomedullary nAChR expression is downregulated in juvenile rats treated with neonatal IH.

In control P35 adrenal medullae, mRNA levels of α3, α5, α7, β2, and β4 were higher compared with P5 tissues. Moreover, P35 adrenal medullae expressed α4-mRNA, which was not detected in P5 tissues (Fig. 8A).

Fig. 8.

Fig. 8.

Adrenomedullary nAChR expressions in P35 rats treated neonatally with IH. A: nAChR subunit mRNA levels in adrenal medullae from P5 and P35 rats. mRNA levels were normalized to changes in 18S mRNA (means ± SE; n = 3). B: nAChR subunit mRNA levels in adrenal medullae from P35 rats reared under normoxia (control) or treated with IH neonatally. mRNA levels are presented as percentage of control P35 rats (means ± SE; n = 3). *P < 0.05 and **P < 0.01.

In P35 adrenal medullae treated with neonatal IH, the expression of α3-, α5-, α7-, β2-, and β4-mRNAs was significantly reduced compared with age-matched controls (Fig. 8B). However, the decrease in mRNA caused by IH was less pronounced in P35 compared with P5 adrenal medullae. Thus, in P35 rats treated with neonatal IH, α3 and β4 expressions were 30 and 50% less, respectively, compared with expression levels seen in age-matched controls (Fig. 8B), as opposed to ∼50 and 70% reductions, respectively, seen in IH-treated P5 adrenal medullae (see Fig. 1B).

DISCUSSION

Our results showed that neonatal adrenal medullae express mRNAs encoding multiple nAChR subunits, a finding consistent with an earlier study (19) and further demonstrate that nAChRs are functional, as evidenced by increases in [Ca2+]i and catecholamine secretion in response to nicotine application. The α3β4-subtype appears to be the predominant nAChR subtype in neonatal AMC, because its mRNA was expressed at high levels, and α-conotoxin AulB, a blocker of α3-containing nAChR, markedly attenuated the [Ca2+]i response to nicotine.

We had previously shown a large augmentation in catecholamine release when IH-treated neonatal AMC were stimulated with acute hypoxia (35), which prompted us to test that neonatal IH also enhances AMC responses to nicotine in a manner. Contrary to our expectation, neonatal IH markedly attenuated the AMC response to nicotine. The reduced secretory responses to nicotine does not reflect decreased tissue catecholamine levels, because IH treatment increases catecholamine levels in neonatal adrenal medullae (35). The decreased catecholamine secretion was reflected in markedly reduced amperometric events. The size of the amperometric events, which represent the quantal size of secretion, depends on Ca2+ entry into the cell (9). Weak stimuli, which does not elevate [Ca2+]i all that much, produce small amperometric events, while stronger stimuli empty the vesicles more completely and produce much larger amperometric events (9). Because nicotine-evoked [Ca2+]i elevation was decreased in IH-treated AMC, we attribute the reduced secretory response to the attenuated elevation of [Ca2+]i.

The reduced Ca2+ entry by nicotine might, in part, be due to calcium-induced inactivation of voltage-dependent calcium channels, because basal [Ca2+]i was elevated in IH-treated cells. However, this possibility seems unlikely, because IH treatment results in augmented [Ca2+]i response when AMC were stimulated with hypoxia (35). Alternatively, nAChR sensitivity to nicotine might have been altered in IH-treated cells as the dose-response relationship to nicotine was shifted to right. Moreover, mRNA and protein expressions of major nAChR subunits (i.e., α3β4) were reduced, suggesting that impaired nAChR expression in IH-treated cells would account for the attenuated nicotine response.

Our previous study showed high levels of oxidative stress in IH-treated neonatal adrenal medullae, as evidenced by elevated oxidized lipids and protein products (35). The finding that antioxidant treatment completely prevented the reduced nAChR expression and restored chromaffin cell responses to nicotine suggests that ROS signaling mediates the effects of IH on nAChR expression and function. The IH-evoked downregulation of nAChR mRNA expression is conceivably due to the effects of ROS on the transcription of nAChRs, as reported for other receptors (25), and/or due to effects of ROS on mRNA stability. It should, however, be noted that antioxidant was ineffective in restoring α5-mRNA expression in IH-treated cells, indicating that the response of α5 to IH involves signaling mechanism(s) other than ROS.

Remarkably, even 1 mo after terminating the IH stimulus, AMC still displayed attenuated responses to nicotine, indicating the long-lasting impact of neonatal IH. Similar effects of neonatal IH were also reported on carotid body (27) and AMC (35) responses to hypoxia. More importantly, catecholamine secretion by splanchnic nerve stimulation, which requires nAChRs, was attenuated in P35 rats treated with neonatal IH, suggesting that exposure to IH in early neonatal life impacts neurogenic secretion from adrenal medulla in adults. nAChR subunit mRNAs were increased in P35 compared with P5 adrenals, reflecting developmental changes. Yet the expressions of all subunit mRNAs were significantly lower in P35 rats treated with IH neonatally compared with corresponding controls (Fig. 8). Interestingly, α4-mRNA, which was only seen in P35 adrenals, was not affected by neonatal IH, indicating that IH affected the expression of those nAChR mRNAs that were expressed in neonates. We attribute the attenuated neurogenic secretion to the reduced nAChR subunit expressions in P35 rats treated with neonatal IH. Alternatively, neonatal IH might have affected developmental regulation of splanchnic innervation to AMC, a possibility that remains to be investigated.

In summary, we have shown that neonatal IH downregulates nAChR expression and function in AMC, and the effects of neonatal IH persist at least into juvenile life, leading to impaired neurogenic catecholamine secretion. nAChRs are expressed widely throughout the central and peripheral nervous systems, including the areas of the central nervous system that regulate autonomic functions (5, 6). Furthermore, preganglionic to postganglionic transmission in the sympathetic nervous system employs nAChRs. Given that neonatal IH affects autonomic functions (13, 29), future studies examining the long-term consequences of neonatal IH on nAChR expression and function in the central and peripheral nervous systems will be of considerable interest.

GRANTS

The research is supported by grants from the National Institutes of Health (HL-76537, HL-90554, and HL-86493 for N. R. Prabhakar; HL-089616 for G. K. Kumar; GM-081809 and a Philip Morris International grant for A. P. Fox).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

REFERENCES

  • 1.Adams MB, Simonetta G, McMillen IC. The non-neurogenic catecholamine response of the fetal adrenal to hypoxia is dependent on activation of voltage sensitive Ca2+ channels. Brain Res Dev Brain Res 94: 182–189, 1996 [DOI] [PubMed] [Google Scholar]
  • 2.Bournaud R, Hidalgo J, Yu H, Girard E, Shimahara T. Catecholamine secretion from rat foetal adrenal chromaffin cells and hypoxia sensitivity. Pflügers Arch 454: 83–92, 2007 [DOI] [PubMed] [Google Scholar]
  • 3.Carabelli V, Marcantoni A, Comunanza V, de Luca A, Diaz J, Borges R, Carbone E. Chronic hypoxia up-regulates alpha 1H T-type channels and low-threshold catecholamine secretion in rat chromaffin cells. J Physiol 584: 149–165, 2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chan SA, Smith C. Low frequency stimulation of mouse adrenal slices reveals a clathrin-independent, protein kinase C-mediated endocytic mechanism. J Physiol 553: 707–717, 2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cohen G, Han ZY, Grailhe R, Gallego J, Gaultier C, Changeux JP, Lagercrantz H. Beta 2 nicotinic acetylcholine receptor subunit modulates protective responses to stress: a receptor basis for sleep-disordered breathing after nicotine exposure. Proc Natl Acad Sci USA 99: 13272–13277, 2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cohen G, Roux JC, Grailhe R, Malcolm G, Changeux JP, Lagercrantz H. Perinatal exposure to nicotine causes deficits associated with a loss of nicotinic receptor function. Proc Natl Acad Sci USA 102: 3817–3821, 2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Conforti L, Kobayashi S, Beitner-Johnson D, Conrad PW, Freeman T, Millhorn DE. Regulation of gene expression and secretory functions in oxygen-sensing pheochromocytoma cells. Respir Physiol 115: 249–260, 1999 [DOI] [PubMed] [Google Scholar]
  • 8.Del Toro R, Levitsky KL, López-Barneo J, Chiara MD. Induction of T-type calcium channel gene expression by chronic hypoxia. J Biol Chem 278: 22316–22324, 2003 [DOI] [PubMed] [Google Scholar]
  • 9.Elhamdani A, Palfrey HC, Artalejo CR. Quantal size is dependent on stimulation frequency and calcium entry in calf chromaffin cells. Neuron 31: 819–830, 2001 [DOI] [PubMed] [Google Scholar]
  • 10.Garcia-Fernandez M, Mejias R, Lopez-Barneo J. Developmental changes of chromaffin cell secretory response to hypoxia studied in thin adrenal slices. Pflügers Arch 454: 93–100, 2007 [DOI] [PubMed] [Google Scholar]
  • 11.Harkins AB, Fox AP. Activation of nicotinic acetylcholine receptors augments calcium channel-mediated exocytosis in rat pheochromocytoma (PC12) cells. J Gen Physiol 111: 257–269, 1998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hruska M, Nishi R. Cell-autonomous inhibition of alpha 7-containing nicotinic acetylcholine receptors prevents death of parasympathetic neurons during development. J Neurosci 27: 11501–11509, 2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Julien C, Bairam A, Joseph V. Chronic intermittent hypoxia reduces ventilatory long-term facilitation and enhances apnea frequency in newborn rats. Am J Physiol Regul Integr Comp Physiol 294: R1356–R1366, 2008 [DOI] [PubMed] [Google Scholar]
  • 14.Kamendi H, Stephens C, Dergacheva O, Wang X, Huang ZG, Bouairi E, Gorini C, McIntosh JM, Mendelowitz D. Prenatal nicotine exposure alters the nicotinic receptor subtypes that modulate excitation of parasympathetic cardiac neurons in the nucleus ambiguus from primarily alpha3 beta2 and/or alpha6 betaX to alpha3 beta4. Neuropharmacology 51: 60–66, 2006 [DOI] [PubMed] [Google Scholar]
  • 15.Keating DJ, Rychkov GY, Roberts ML. Oxygen sensitivity in the sheep adrenal medulla: role of SK channels. Am J Physiol Cell Physiol 281: C1434–C1441, 2001 [DOI] [PubMed] [Google Scholar]
  • 16.Kuri BA, Chan SA, Smith CB. PACAP regulates immediate catecholamine release from adrenal chromaffin cells in an activity-dependent manner through a protein kinase C-dependent pathway. J Neurochem 110: 1214–1225, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lee J, Lim W, Eun SY, Kim SJ, Kim J. Inhibition of apamin-sensitive K+ current by hypoxia in adult rat adrenal chromaffin cells. Pflügers Arch 439: 700–704, 2000 [DOI] [PubMed] [Google Scholar]
  • 18.Levitsky KL, López-Barneo J. Developmental change of T-type Ca2+ channel expression and its role in rat chromaffin cell responsiveness to acute hypoxia. J Physiol 587: 1917–1929, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mousavi M, Hellstrom-Lindahl E, Guan ZZ, Bednar I, Nordberg A. Expression of nicotinic acetylcholine receptors in human and rat adrenal medulla. Life Sci 70: 577–590, 2001 [DOI] [PubMed] [Google Scholar]
  • 20.Mochizuki-Oda N, Takeuchi Y, Matsumura K, Oosawa Y, Watanabe Y. Hypoxia-induced catecholamine release and intracellular Ca2+ increase via suppression of K+ channels in cultured rat adrenal chromaffin cells. J Neurochem 69: 377–387, 1997 [DOI] [PubMed] [Google Scholar]
  • 21.Mojet MH, Mills E, Duchen MR. Hypoxia-induced catecholamine secretion in isolated newborn rat adrenal chromaffin cells is mimicked by inhibition of mitochondrial respiration. J Physiol 504: 175–189, 1997 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Nai Q, McIntosh JM, Margiotta JF. Relating neuronal nicotinic acetylcholine receptor subtypes defined by subunit composition and channel function. Mol Pharmacol 63: 311–324, 2003 [DOI] [PubMed] [Google Scholar]
  • 23.Nanduri J, Wang N, Yuan G, Khan SA, Souvannakitti D, Peng YJ, Kumar GK, Garcia JA, Prabhakar NR. Intermittent hypoxia degrades HIF-2 alpha via calpains resulting in oxidative stress: implications for recurrent apnea-induced morbidities. Proc Natl Acad Sci USA 106: 1199–11204, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Nashmi R, Lester H. Cell autonomy, receptor autonomy, and thermodynamics in nicotine receptor up-regulation. Biochem Pharmacol 74: 1145–1154, 2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Nickenig G, Strehlow K, Baumer AT, Baudler S, Wassmann S, Sauer H, Bohm M. Negative feedback regulation of reactive oxygen species on AT1 receptor gene expression. Br J Pharmacol 131: 795–803, 2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Nurse CA, Buttigieg J, Brown S, Holloway AC. Regulation of oxygen sensitivity in adrenal chromaffin cells. Ann N Y Acad Sci USA 1177: 132–139, 2009 [DOI] [PubMed] [Google Scholar]
  • 27.Pawar A, Peng YJ, Jacono FJ, Prabhakar NR. Comparative analysis of neonatal and adult rat carotid body responses to chronic intermittent hypoxia. J Appl Physiol 104: 1287–1294, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Peng YJ, Nanduri J, Yuan G, Wang N, Deneris E, Pendyala S, Natarajan V, Kumar GK, Prabhakar NR. NADPH oxidase is required for the sensory plasticity of the carotid body by chronic intermittent hypoxia. J Neurosci 29: 4903–4910, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Peng YJ, Prabhakar NR. Effect of two paradigms of chronic intermittent hypoxia on carotid body sensory activity. J Appl Physiol 96: 1236–1242, 2004 [DOI] [PubMed] [Google Scholar]
  • 30.Ren K, King MA, Liu J, Siemann J, Altman M, Meyers C, Hughes JA, Meyer EM. The alpha 7 nicotinic receptor agonist 4OH-GTS-21 protects axotomized septohippocampal cholinergic neurons in wild type but not amyloid-overexpressing transgenic mice. Neuroscience 148: 230–237, 2007. [DOI] [PubMed] [Google Scholar]
  • 31.Rico AJ, Prieto-Lloret J, Gonzalez C, Rigual R. Hypoxia and acidosis increase the secretion of catecholamines in the neonatal rat adrenal medulla: an in vitro study. Am J Physiol Cell Physiol 289: C1417–C1425, 2005 [DOI] [PubMed] [Google Scholar]
  • 32.Rosenthal RN, Slotkin TA. Development of nicotinic responses in the rat adrenal medulla and long-term effects of neonatal nicotine administration. Br J Pharmacol 60: 59–64, 1977 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Seidler FJ, Slotkin TA. Adrenomedullary function in the neonatal rat: responses to acute hypoxia. J Physiol 358: 1–16, 1985 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Seidler FJ, Slotkin TA. Ontogeny of adrenomedullary responses to hypoxia and hypoglycemia: role of splanchnic innervation. Brain Res Bull 16: 11–14, 1986 [DOI] [PubMed] [Google Scholar]
  • 35.Souvannakitti D, Kumar GK, Fox A, Prabhakar NR. Neonatal intermittent hypoxia leads to long-lasting facilitation of acute hypoxia-evoked catecholamine secretion from rat chromaffin cells. J Neurophysiol 101: 2837–2846, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Taylor SC, Peers C. Chronic hypoxia enhances the secretory response of rat phaeochromocytoma cells to acute hypoxia. J Physiol 514: 483–491, 1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Thompson RJ, Jackson A, Nurse CA. Developmental loss of hypoxic chemosensitivity in rat adrenomedullary chromaffin cells. J Physiol 498: 503–510, 1997 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Thompson RJ, Nurse CA. Anoxia differentially modulates multiple K+ currents and depolarizes neonatal rat adrenal chromaffin cells. J Physiol 512: 421–434, 1998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Xie Z, Currie KP, Fox AP. Etomidate elevates intracellular calcium levels and promotes catecholamine secretion in bovine chromaffin cells. J Physiol 560: 677–690, 2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yokotani K, Okada S, Nakamura K. Characterization of functional nicotinic acetylcholine receptors involved in catecholamine release from the isolated rat adrenal gland. Eur J Pharmacol 446: 83–87, 2002 [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Cell Physiology are provided here courtesy of American Physiological Society

RESOURCES