Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Sep 10.
Published in final edited form as: Brain Res. 2010 Jun 28;1351:1–12. doi: 10.1016/j.brainres.2010.06.045

Antibody-mediated targeted gene transfer to NMDA NR1-containing neurons in rat neocortex by helper virus-free HSV-1 vector particles containing a chimeric HSV-1 glycoprotein C--Staphylococcus A protein

Haiyan Cao 1, Guo-rong Zhang 1, Alfred I Geller 1,*
PMCID: PMC2929402  NIHMSID: NIHMS225292  PMID: 20599821

Abstract

Because of the heterogeneous cellular composition of the brain, and especially the forebrain, cell type-specific expression will benefit many potential applications of direct gene transfer. The two prevalent approaches for achieving cell type-specific expression are using a cell type-specific promoter or targeting gene transfer to a specific cell type. Targeted gene transfer with Herpes Simplex Virus (HSV-1) vectors modifies glycoprotein C (gC) to replace the heparin binding domain, which binds to many cell types, with a binding activity for a specific cell surface protein. We previously reported targeted gene transfer to nigrostriatal neurons using chimeric gC--glial cell line-derived neurotrophic factor or gC--brain-derived neurotrophic factor protein. Unfortunately, this approach is limited to cells that express the cognate receptor for either neurotrophic factor. Thus, a general strategy for targeting gene transfer to many different types of neurons is desirable. Antibody-mediated targeted gene transfer has been developed for targeting specific virus vectors to specific peripheral cell types; a specific vector particle protein is modified to contain the Staphylococcus A protein ZZ domain, which binds immunoglobulin (Ig) G. Here, we report antibody-mediated targeted gene transfer of HSV-1 vectors to a specific type of forebrain neuron. We constructed a chimeric gC--ZZ protein, and showed this protein is incorporated into vector particles and binds Ig G. Complexes of these vector particles and an antibody to the NMDA receptor NR1 subunit supported targeted gene transfer to NR1-containing neocortical neurons in the rat brain, with long-term (2 months) expression.

Keywords: targeted gene transfer, glycoprotein C, herpes simplex virus vector, Staphylococcus A protein, NMDA receptor, heparin sulfate

1. Introduction

Because of the heterogeneous cellular composition of the brain, and particularly the forebrain, cell type-specific recombinant gene expression is required for many potential applications of direct gene transfer into neurons. The two prevalent approaches for achieving cell type-specific expression are use of a cell type-specific promoter or modifying a virus vector particle protein to target gene transfer to a specific cell type (Kasahara et al., 1994; Muller et al., 2003; Rasmussen et al., 2007; Song et al., 1997; Wang et al., 2005; Wickham et al., 1996a; Wickham, 2003). Importantly, targeted gene transfer supports efficient gene transfer and gene expression by reducing the background of gene transfer to undesirable cell types. Further, targeted gene transfer and cell type-specific promoters are complementary approaches, and a higher level of cell type-specific expression may be achieved by using these two approaches in combination. Thus, a general strategy for targeting gene transfer to many different specific types of neurons would benefit numerous potential uses of direct gene transfer into neurons for either gene therapy or basic neuroscience.

Targeted gene transfer has been developed using classical retrovirus, lentivirus, adeno-associated virus (AAV), adenovirus, and Herpes Simplex Virus (HSV-1) vectors (Buning et al., 2003; Cao et al., 2008; Douglas et al., 1996; Grandi et al., 2004; Kasahara et al., 1994; Laquerre et al., 1998a; Peng and Russell, 1999; Wang et al., 2005; Wickham et al., 1996a; Wickham et al., 1996b; Wickham, 2003). Targeting strategies modify the vector particle surface to add a new cell tropism, reduce the normal cell tropism, and preserve efficient vector particle assembly. The most direct targeting strategy is to modify a vector particle protein to add a specific binding capability; one of the first reports used retrovirus vector particles that contained a chimeric erythropoietin (epo)--virus envelope (env) protein to target gene transfer to cells that contain epo receptors (Kasahara et al., 1994). Because addition of a large polypeptide to a vector particle protein may disrupt vector particle assembly, another strategy has been to add a bridging molecule that binds to both the vector particle and a cell surface ligand (Wickham et al., 1996b; Wickham, 2003). A more general strategy may be to modify a vector particle to bind an antibody. This strategy can theoretically support targeting to any cell surface epitope for which an antibody exists, or can be isolated. Thus, antibody-mediated targeted gene transfer is potentially a general strategy that can support targeting to a large number of specific cell types. Antibody-mediated targeted gene transfer has been developed by modifying a specific vector particle protein to contain the Staphylococcus A protein ZZ domain, an immunoglobulin (Ig) G binding domain. This strategy has been used to target classical retrovirus, lentivirus, AAV, adenovirus, and sindbis virus vectors to specific peripheral cell types (Bergman et al., 2003; Morizono et al., 2001; Morizono and Chen, 2005; Morizono et al., 2005; Ohno et al., 1997; Ried et al., 2002; Tai et al., 2003; Volpers et al., 2003).

Helper virus-free HSV-1 plasmid (amplicon) vectors are attractive because they have a large capacity and can efficiently transduce neurons (Fraefel et al., 1996; Geller and Breakefield, 1988; Geller et al., 1991). The HSV-1 particle is composed of four layers: i) The ~152 kb genome is encapsidated in, ii) an icosahedral protein capsid, which is surrounded by iii) the tegument, a layer of proteins, and enclosed in iv) the envelope, a lipid bilayer containing 10 viral-encoded glycoproteins (Roizman and Sears, 1993). HSV-1 infection occurs in two stages (Spear and Longnecker, 2003): Initial binding to glycosaminoglycans, principally heparin sulfate, on cell surface proteoglycans is mediated by specific domains on glycoprotein C (gC) and gB (Laquerre et al., 1998b; Mardberg et al., 2001; Shukla and Spear, 2001; Tal-Singer et al., 1995). Subsequent entry requires gD binding to a receptor; receptors include the herpesvirus entry mediator (HVEM), nectin-1 or -2, and specific sites in heparin sulfate produced by particular isoforms of 3-O-sulfotransferases (Spear and Longnecker, 2003). Entry occurs by envelope fusion to the cell membrane and requires gB, gD, gH, and gL.

Targeted gene transfer approaches with HSV-1 vectors have modified gC to remove the heparin binding domain and add a ligand for a specific protein on the cell surface. The first study (Laquerre et al., 1998a) isolated a recombinant virus containing a chimeric gC--epo protein, and deleted the heparin sulfate binding domains on both gC and gB. This virus exhibited enhanced binding to epo receptor-containing cells, but targeted infection was not reported. In the another study (Grandi et al., 2004), a HSV-1 plasmid vector expressing a gC--His tag was packaged using a helper virus, and the vector stocks targeted infection to an artificial pseudo-His-tag receptor-containing cell line. Both of these reports (Grandi et al., 2004; Laquerre et al., 1998a) used specific HSV-1 viruses that grow productively and kill infected cells, confounding gene transfer studies. We developed targeted gene transfer to nigrostriatal neurons using modified helper virus-free packaging systems that encode either gC--glial cell line-derived neurotrophic factor (GDNF) or gC--brain-derived neurotrophic factor (BDNF) protein. Injection of either vector stock into the midbrain resulted in 2.2 to 5.0-fold targeted gene transfer to nigrostriatal neurons (Cao et al., 2008; Wang et al., 2005); these neurons contain the cognate receptors for GDNF and BDNF. These studies represent the first targeted gene transfer to a specific type of neuron in the brain, but unfortunately this strategy is applicable only to neurons that contain either cognate receptor.

We now report a general strategy for targeting gene transfer to many different types of neurons, using antibody-mediated targeted gene transfer. We constructed a chimeric gC---Staphylococcus A ZZ domain protein, and showed this protein is incorporated into HSV-1 particles and binds Ig G. Complexes of these vector particles and an antibody to the NMDA receptor NR1 subunit supported targeted gene transfer to NR1-containing neocortical neurons in the rat brain, with long-term expression.

2. Results

3.1. Construction of a helper virus-free HSV-1 packaging system for antibody-mediated targeted gene transfer

We constructed a chimeric gC--ZZ protein by modifying the previously reported gC--bdnf protein (Wang et al., 2005) to replace the bdnf domain with the Staphylococcus A protein ZZ domain. Specifically, using PCR and plasmid cloning, we constructed a chimeric protein that contains the BDNF prepro domains, the ZZ domain, and the gC transmembrane and internal vector particle domains (Fig. 1A). The construct retained the gC promoter and polyadenylation site to enable transcription of the construct to be regulated in the same manner as the wt gC gene. The BDNF prepro domains support proper posttranslational processing (Lin et al., 1993). The ZZ domain has been previously used in targeted gene transfer (Morizono et al., 2001). The gC domain is an N-terminal deletion of gC (aa 153 to C-terminus) lacking the glycosaminoglycan binding domain (Mardberg et al., 2001; Shukla and Spear, 2001; Tal-Singer et al., 1995) and containing the transmembrane and internal vector particle domains to support incorporation into vector particles (Wang et al., 2005). Helper virus-free HSV-1 vector packaging is performed using a set of five cosmids that represent the HSV-1 genome but lack the packaging site (contained in the a sequence) (Fraefel et al., 1996). In vivo homologous recombination cloning (Kong et al., 1999) was used to replace the wt gC gene in HSV-1 cosmid cos56 with this construct; cos56gC--ZZ was isolated using the same strategy as for construction of cos56gC--bdnf and cos56gC--gdnf (Wang et al., 2005). The integrity of the gC--ZZ coding region was confirmed by DNA sequence analysis, in both the initial plasmid and cos56gC--ZZ.

Fig. 1.

Fig. 1

Open in a new tab

Schematic diagrams of the chimeric gC--ZZ construct and helper virus-free packaging to produce vector particles that contain gC--ZZ and gBpK-. (A) The gC--ZZ construct contains the gC promoter, the prepro sequence from BDNF, the Staphylococcus A ZZ domain, a spacer of 5 aa, and a gC deletion from aa 153 to the C-terminus (aa 511) (Wang et al., 2005). This construct retains the gC promoter and the gC polyadenylation site to enable transcription of the construct to be regulated as the wt gC gene. The BDNF prepro domain contains a signal sequence (Lin et al., 1993) to support proper posttranslational processing, and the gC deletion retains the transmembrane and internal vector particle domains to support insertion into the envelope of HSV-1 particles. (B) Helper virus-free packaging using gC--ZZ and gBpK-. The following plasmids and cosmids were cotransfected into 2-2 cells (Smith et al., 1992): A HSV-1 vector; a plasmid expressing gBpK-; and a HSV-1 cosmid set containing the gC--ZZ construct and lacking the gB gene and an a sequence (contains the packaging site). The resulting HSV-1 vector particles should contain the vector, gC--ZZ, gBpK-, and all the other HSV-1 envelope glycoproteins. Thus, these vector particles are designed to support binding to an antibody of choice. The antibody-HSV-1 vector particle complexes should support initial binding to the cognate antigen on the surface of cells, followed by entry using the same mechanisms used by wt HSV-1 virus particles (Spear and Longnecker, 2003).

Both gC and gB contain glycosaminoglycan binding domains that mediate the initial non-specific binding to many cell types, resulting in untargeted gene transfer to multiple cell types. gB has an essential role in the vector particle-cell membrane fusion process and cannot be deleted. However, a small deletion in gB has been isolated (termed gBpK-) which removes amino acids 68 to 76, encoding the glycosaminoglycan binding domain, but does not affect the membrane fusion capabilities of gB (Laquerre et al., 1998b). We introduced the gBpK- mutation into our packaging system: We previously reported (Tang et al., 2001) a HSV-1 cosmid set harboring deletions in gB (cos14ΔgB and cos28ΔgB; the cosmids overlap at their ends, and some genes, including gB, are present in more than one cosmid). Vector packaging using a cosmid set deleted in gB resulted in no detectable vector titer, but addition of a plasmid expressing gB to this packaging system resulted in titers similar to those obtained using standard packaging (Tang et al., 2001). Thus, to develop an analogous packaging system using the gBpK- mutation, we constructed a plasmid that expresses gBpK- from the gB promoter. The gBpK- mutation was verified by DNA sequencing. All the other HSV-1 glycoproteins were not modified.

A vector was packaged into HSV-1 particles that contain both gC--ZZ and gBpK- (Fig. 1B). Packaging was performed in 2-2 cells (Smith et al., 1992), a VERO cell line that expresses the HSV-1 immediate early (IE) 2 gene; we typically use 2-2 cells in standard packaging because 2-2 cells support higher titers than the parent VERO cell line (Fraefel et al., 1996). To perform vector packaging for antibody-mediated targeted gene transfer, the following plasmids and cosmids were cotransfected into 2-2 cells (Fig. 1B): A HSV-1 vector; a plasmid expressing gBpK-; and a HSV-1 cosmid set containing gC--ZZ, and lacking gB and a packaging site (a sequence), specifically cosmids cos6Δa, cos14ΔgB, cos28ΔgB, cos56gC--ZZ, and cos48Δa.

The resulting HSV-1 vector particles should contain the vector, gC--ZZ, gBpK-, and all the other HSV-1 envelope glycoproteins. Thus, these vector particles are designed to support binding to an Ig G of choice. The antibody-HSV-1 vector particle complexes should bind to the cognate antigen on the surface of cells, followed by entry using the same mechanisms as used by wt HSV-1 particles (Spear and Longnecker, 2003). Thus, binding of the antibody-vector particle complexes to the cognate antigen on a specific type of neuron should support targeted gene transfer to that specific type of neuron.

3.2. gC--ZZ protein is incorporated into HSV-1 vector particles and supports binding to Ig G

We established that vector particles prepared using this modified packaging system can support gene transfer. Our first vector, pHSVlac, uses the HSV-1 IE 4/5 promoter to support expression of the Lac Z gene, and the IE 4/5 promoter is active in fibroblast cells. To test gC--ZZ function, pHSVlac was packaged using gC--ZZ and gB--wt to yield pHSVlac/gC--ZZ. For a control, pHSVlac was packaged using standard packaging conditions to yield pHSVlac/gC--wt. Baby Hamster Kidney (BHK) fibroblast cells were transduced with either pHSVlac/gC--ZZ or pHSVlac/gC--wt, and 1 day later the 5-bromo-4-chloro-3-indoyl-β-D-galactopyranoside (X-gal) assay was performed. Using either vector stock, X-gal positive cells were observed (not shown; all vector titers are in the methods, vector packaging section). This result establishes that HSV-1 vector particles prepared in the presence of gC--ZZ support gene transfer, consistent with previous reports that HSV-1 vector particles containing gC--bdnf or gC--gdnf support gene transfer (Cao et al., 2008; Wang et al., 2005). Because no antibody was complexed to pHSVlac/gC--ZZ, this gene transfer shows that a background of untargeted gene transfer remains with this modified vector system; this vector system uses gB--wt, which contains a glycosaminoglycan binding domain that mediates the initial non-specific binding to many cell types. Using a PCR assay for the Lac Z gene, we previously showed that pHSVlac/gC--bdnf and pHSVlac/gC--gdnf were each packaged into vector particles at a similar efficiency as pHSVlac/gC--wt (Wang et al., 2005). We did not repeat the vector genome assay here because gC--ZZ is similar to gC--bdnf; the prepro and gC domains are identical, the ZZ domain replaced the bdnf domain, and these two domains are similar in size.

Next, we established that gC--ZZ was incorporated into vector particles and supports binding of Ig G. At 1 day after gene transfer, BHK cells were fixed and immunofluorescence was performed as described (Wang et al., 2005) using either mouse anti-gC and a secondary antibody, or only the secondary antibody. The results showed that BHK cells transduced with pHSVlac/gC--ZZ contained gC-immunoreactivity (IR) (Fig. 2A). We previously showed that both gC--bdnf and gC--gdnf encode the expected size proteins, which are incorporated into vector particles, using Western blots (Wang et al., 2005). We did not repeat the Western blot assay here because gC--ZZ is similar to gC--bdnf. Further, using BHK cells transduced with pHSVlac/gC--ZZ, incubation with only the secondary antibody resulted in IR (Fig. 2B), showing that gC--ZZ can bind Ig G. The secondary-antibody-only-IR was a lower signal than the gC-IR, likely because the combination of primary and secondary antibodies supported a signal amplification that was not obtained using only the secondary antibody. As a control, using BHK cells transduced with pHSVlac/gC--wt, incubation with only the secondary antibody resulted in no detectable IR (Fig. 2C), establishing that gC--wt does not bind Ig G. Also, this assay serves as a negative control for the gC-IR assay (Fig. 2A). Thus, gC--ZZ is incorporated into HSV-1 particles and can bind Ig G, suggesting that it might support targeted gene transfer.

Fig. 2.

Fig. 2

Open in a new tab

The gC--ZZ protein is incorporated into HSV-1 vector particles and supports binding to Ig G. BHK cells were transduced with either pHSVlac/gC--ZZ or pHSVlac/gC--wt, and 1 day later fixed for immunoflourescence. Immunofluorescence was performed as described (Wang et al., 2005) using either mouse anti-HSV-1 gC and fluorescein isothiocyanate-conjugated goat anti-mouse Ig G or only the secondary antibody. (A and B) pHSVlac/gC--ZZ; gC-IR (A), secondary antibody only-IR (B). (C) pHSVlac/gC--wt; secondary antibody only-IR. Scale bar: 30 μm.

3.4. Antibody-mediated targeted gene transfer to NMDA NR1 subunit-containing neurons in rat neocortex

We developed a procedure to form vector particle-antibody complexes, based on our procedure to purify vector particles (Lim et al., 1996). After packaging, we performed the initial steps of vector purification, and the first of two ultracentrifugations on a sucrose step gradient, as before. Vector particles were dialyzed into PBS, incubated with an antibody, and then the second ultracentrifugation was performed to separate vector particle-antibody complexes from unbound antibody (details in methods). It is likely important to purify the vector particle-antibody complexes away from unbound antibody; unbound antibody could compete with vector particle-antibody complexes for binding to the cognate antigen on the cell surface, thereby reducing targeted gene transfer, particularly in the brain, which allows limited extracellular diffusion.

To explore the possibility of antibody-mediated targeted gene transfer to specific types of neocortical neurons, we used vectors containing a promoter that supports neuron-specific, long-term expression, the INS-TH-NFH promoter (Zhang et al., 2000). This promoter contains the chicken β-globin insulator (INS), an enhancer from the rat tyrosine hydroxylase (TH) promoter, and a mouse neurofilament heavy gene promoter (NFH).

As a test antibody for targeting, we chose an antibody that recognizes an extracellular epitope on the NMDA receptor NR1 subunit. Using the modified vector packaging procedure detailed above (Fig. 1B; gC--ZZ and gBpK-), and the vector particle-antibody complex formation procedure just described, we prepared pINS-TH-NFHlac/gC--ZZ+anti-NR1 (gBpK- is omitted from the vector nomenclature for simplicity). To quantify the numbers of infectious vector particles (IVP/ml), these vector stocks were titered on BHK cells; at 1 day after transduction, positive cells were visualized using X-gal (titers are in the methods, vector packaging section). This titering was performed on BHK cells as the best available assay. These fibroblast cells form a monolayer whereas most neuronal cell lines do not form a monolayer, and the titers obtained on BHK cells are higher than those obtained on PC12 cells (Yang et al., 2001; Zhang et al., 2000). Expression from the INS-TH-NFH promoter in fibroblast cells represents ectopic expression that declines rapidly at longer times after gene transfer (not shown). Further, the gene transfer is due to a remaining low level of untargeted gene transfer, as BHK cells lack significant levels of NMDA receptors. For these reasons, the observed titer may underestimate the titer.

We designed an experiment to detect targeted gene transfer to neocortical cells that contain the NMDA NR1 subunit. Due to the complex and heterogeneous cellular composition of neocortex, specific stereotactic injections of HSV-1 vectors into the neocortex may support gene transfer to differing populations of neurons in different rats, complicating comparisons between rats. To control for any variability in injection sites between rats, we co-injected mixtures of equal titers (IVP/ml) of vector particles designed to support either targeted or untargeted gene transfer, and then compared the types of neurons transduced by each type of vector particle. For the control vector, we used pINS-TH-NFHflag-TH/ires/aadc (Sun et al., 2003), which uses the INS-TH-NFH promoter to express a flag-tagged TH (and aromatic amino acid decarboyxlase (AADC), not assayed in this study); this vector was packaged using standard packaging conditions (gC--wt and gB--wt). Thus, the experimental vector particles were pINS-TH-NFHlac/gC--ZZ+anti-NR1 and the untargeted, control vector particles were pINS-TH-NFHflag-TH/ires/aadc/gC--wt. A mixture of these two vector particles was injected into rat POR cortex, using our established injection coordinates and procedures (Zhang et al., 2005). Using these gene transfer conditions and untargeted gene transfer, the vast majority of the transduced cells are in POR cortex proximal to the injection site, small numbers of transduced cells are detected in specific neocortical areas that project to POR cortex (~1 % of the number of transduced cells as in POR cortex), and no transduced cells are observed in any of the subcortical areas that were examined (Zhang et al., 2005). Further, using these gene transfer conditions, vectors containing the INS-TH-NFH promoter support >90 % neuron-specific expression, with 52 % glutamatergic-specific and 45 % GABAergic-specific expression (Zhang et al., 2005).

pINS-TH-NFHlac/gC--ZZ+anti-NR1 supported targeted gene transfer in rats sacrificed at 8 days after gene transfer. To establish expression in POR cortex, specific sections were assayed with X-gal. Low and medium power views showed an area of X-gal positive cells proximal to the needle track (Fig. 3A and B), and high power showed individual cells with large cell bodies (Fig. 3C), characteristic of neurons. In contrast, specific neocortical areas that did not receive gene transfer and do not project to POR cortex lacked X-gal positive cells, but faintly positive cells were occasionally observed in brain vasculature endothelium (not shown); this background with the X-gal assay is similar to that observed in previous studies (Zhang et al., 2000; Zhang et al., 2005; Zhang et al., 2009). To quantify targeted gene transfer to NR1-containing neurons, alternating sections were assayed for either β-galactosidase (β-gal)-IR and NR1-IR or flag-IR and NR1-IR. Photomicrographs showed that using pINS-TH-NFHlac/gC--ZZ+anti-NR1, the clear majority of the transduced cells contained NR1-IR (Fig. 4A-C). In contrast, using pINS-TH-NFHflag-TH/ires/aadc/gC--wt, numerous transduced cells contained NR1-IR, and many transduced cells lacked NR1-IR (Fig. 4D-F). As a control for the assay, omission of the primary antibodies resulted in no IR (Fig. 4G-I). This assay was performed on 8 hemispheres from 2 independent experiments, with similar results. Cell counts (Table 1) showed that pINS-TH-NFHlac/gC--ZZ+anti-NR1 supported an average of 81 % expression in NR1-IR neurons, and pINS-TH-NFHflag-TH/ires/aadc/gC--wt supported an average of 64 % expression in NR1-IR neurons. Of note, pINS-TH-NFHlac/gC--ZZ+anti-NR1 supported a statistically significant increase in transduction of NR1-containing neurons compared to pINS-TH-NFHflag-TH/ires/aadc/gC--wt (p<0.001 ANOVA).

Fig. 3.

Fig. 3

Open in a new tab

X-gal positive cells in POR cortex from a rat sacrificed at eight days after co-injection of pINS-TH-NFHlac/gC--ZZ+anti-NR1 and pINS-TH-NFHflag-TH/ires/aadc/gC--wt. (A) A low power view of a coronal section showing most of the section and an area of X-gal staining in POR cortex. (B) A medium power view showing a large number of X-gal positive cells proximal to the needle track. (C) A high power view showing X-gal positive cells bodies with neuronal morphology. Scale bars: (A) 300 μm, (B) 100 μm, and (C) 30 μm.

Fig. 4.

Fig. 4

Open in a new tab

Costaining for recombinant gene expression in NMDA NR1-containing neurons in a rat sacrificed at eight days after co-injection of pINS-TH-NFHlac/gC--ZZ+anti-NR1 and pINS-THNFHflag-TH/ires/aadc/gC--wt into POR cortex. Alternating sections were costained using either mouse anti-β-gal or mouse anti-flag (detects flag-TH) and goat anti-NMDA NR1, and these antibodies were visualized using rhodamine- or fluorescein-conjugated secondary antibodies. (A-C) pINS-TH-NFHlac/gC--ZZ+anti-NR1 supported expression of β-gal predominantly in NR1-containing cells; β-gal-IR (A), NR1-IR (B), and merge (C). Arrows, costained cells. (D-F) pINS-TH-NFHflag-TH/ires/aadc/gC--wt supported expression of TH in cells that either contained or lacked NR1-IR; flag-IR (D), NR1-IR (E), and merge (F). Arrowheads, flag-IR only. (G-I) Primary antibodies omitted from the assay; rhodamine--conjugated antibody-IR (G), fluorescein-conjugated antibody-IR (H), and merge (I). Scale bar: 30 μm.

Table 1.

The numbers of expressing cells and the % NR1-IR costaining for rats sacrificed at either 8 days or 2 months after coinjection of pINS-TH-NFHlac/gC--ZZ+anti-NR1 and pINS-TH-NFHflag-TH/ires/aadc/gC--wt into POR cortex.

pINS-TH-NFHlac/gC--ZZ+anti-NR1 pINS-TH-NFHflag-TH/ires/aadc/gC--wt
Survival Time ß-gal-IR Cells % NR1-IR Costaining Flag-IR Cells % NR1-IR Costaining
8 days 337±105 81±3 268±42 64±3
2 months 216±52 87±3 168±55 71±1
Open in a new tab

For rats sacrificed at either 8 days or 2 months after gene transfer, 8 or 3 hemispheres were analyzed, respectively. Values shown are mean±s.e.m.

3.4. Antibody-mediated targeted gene transfer can be followed by long-term expression

The INS-TH-NFH promoter supports long-term expression of multiple gene products in multiple forebrain areas and neuron types, including: Expression of four dopamine biosynthetic and transporter enzymes in striatal neurons for 14 months (Sun et al., 2004); coexpression of two dopamine biosynthetic enzymes in striatal neurons for 7 months (Sun et al., 2003); coexpression of either BDNF or BDNF and β-gal in striatal neurons for 7 months (Sun et al., 2005); expression of β-gal in striatal, hippocampal, perirhinal cortex, or POR cortex neurons for 6, 2, 1, or 1 months, respectively (Zhang et al., 2000); expression of β-gal in striatal or nigrostriatal neurons for 3 or 2 months, respectively (Cao et al., 2008; Liu et al., 2009); and expression of a constitutively active PKC in POR cortex or hippocampal neurons for 1.5 or 1 month, respectively (Zhang et al., 2005; Zhang et al., 2009). These are the longest times examined in each study.

pINS-TH-NFHlac/gC--ZZ+anti-NR1 supported long-term expression after targeted gene transfer. We performed another experiment using the same design as above, but the rats were sacrificed at 2 months after gene transfer. Again, photomicrographs showed that using pINS-TH-NFHlac/gC--ZZ +anti-NR1, most of the transduced cells contained NR1-IR (Fig. 5A-C); but using pINS-TH-NFHflag-TH/ires/aadc/gC--wt, many transduced cells contained NR1-IR, and many transduced cells lacked NR1-IR (Fig. 5D-F). Cell counts (Table 1) showed that pINS-TH-NFHlac/gC--ZZ+anti-NR1 supported 87 % expression in NR1-IR neurons, and pINS-TH-NFHflag-TH/ires/aadc/gC--wt supported 71 % expression in NR1-IR neurons, similar to the results at 8 days. Of note, pINS-TH-NFHlac/gC--ZZ +anti-NR1 supported a statistically significant increase in transduction of NR1-containing neurons compared to pINS-TH-NFHflag-TH/ires/aadc/gC--wt (p<0.005).

Fig. 5.

Fig. 5

Open in a new tab

Costaining for recombinant expression in NMDA NR1-containing neurons in a rat sacrificed at two months after co-injection of pINS-TH-NFHlac/gC--ZZ+anti-NR1 and pINS-TH-NFHflag-TH/ires/aadc/gC--wt into POR cortex. NR1-specific expression was assayed as in Fig. 4. (A-C) pINS-TH-NFHlac/gC--ZZ+anti-NR1 supported expression of β-gal predominantly in NR1-containing cells; β-gal-IR (A), NR1-IR (B), and merge (C). Arrows, costained cells. (D-F) pINS-TH-NFHflag-TH/ires/aadc/gC--wt supported expression of TH in cells that either contained or lacked NR1-IR; flag-IR (D), NR1-IR (E), and merge (F). Arrowheads, flag-IR only. Scale bar: 30 μm.

3. Discussion

We have developed a general strategy for targeting gene transfer to many different types of neurons. A chimeric gC--ZZ protein was isolated that contains both a Staphylococcus A protein ZZ domain and specific gC domains. During helper virus-free HSV-1 vector packaging, this protein is incorporated into HSV-1 particles, and this protein binds Ig G. gC--ZZ-containing vector particle/anti-NR1 complexes supported targeted gene transfer to NR1-containing neurons in rat POR cortex, with long-term expression.

3.1. Targeted gene transfer

Using untargeted gene transfer, 65 to 70 % of the transduced neurons contained NR1, and using targeted gene transfer, ~85 % of the transduced neurons contained NR1. The significant level of transduction of NR1-containing neurons using untargeted gene transfer is likely because many neocortical neurons contain NR1. Targeted gene transfer supported a statistically significant increases to ~85 % transduction of NR1-containing neurons. The remaining ~15 % transduction of neurons that apparently lack NR1 is likely primarily due to two factors. First, although these vector particles lack the major glycosaminoglycan binding domains on gB and gC, which represent the major glycosaminoglycan binding domains on HSV-1 particles, these modified vector particles likely retain some glycosaminoglycan binding capability. Thus, these modified vector particles likely support some nonspecific gene transfer, as reflected in their capability to inefficiently transduce fibroblast cells that lack NR1 (titering assay). Second, the costaining assay for targeted gene transfer required significant levels of NR1 in the cell body to score a neuron as containing NR1. Some neurons likely contain NR1 primarily in processes, and only low levels of NR1 in the cell body, and any such transduced neurons will be incorrectly scored as lacking NR1. In summary, competition between targeted gene transfer and the remaining untargeted gene transfer likely determines the percentage of targeted gene transfer.

Larger differences between targeted and untargeted gene transfer may be obtained by targeting to ligands that are present on a lower percentage of neurons than NR1. We recently found that antibody-mediated targeting to the NMDA receptor NR2B subunit supports an ~25 % increase in transduction of NR2B-containing neurons (Cao et al., in preparation); NR2B, although rarer than NR1, is found on many neocortical neurons, and higher levels of targeting may be achieved by targeting to rarer ligands. Targeting to receptors for BDNF or GDNF on nigrostriatal neurons, using gC--bdnf or gC--gdnf, respectively, supports ≥40 % increases in transduction of these neurons (Cao et al., 2008; Wang et al., 2005). Because antibody-mediated targeted and neurotrophic factor-mediated targeting are both dependent on modifying gC, and because the binding affinities of specific antigen-antibody complexes and specific neurotrophic factor-neurotrophic factor receptor complexes can be similar, antibody-mediated targeted is likely to support at least a similar level of targeting as neurotrophic factor-mediated targeting. However, because of the limited diffusion of large HSV-1 particles through the extracellular space in the brain, and because of the remaining background of untargeted gene transfer, targeted gene transfer to very rare ligands, that are present on only a small percentage of neurons, may be problematic. Nonetheless, results to date suggest that targeting can be achieved to a useful number of specific types of neurons.

Targeted gene transfer to NR1 was followed by long-term expression, for 2 months. Similarly, targeted gene transfer to receptors for BDNF or GDNF on nigrostriatal neurons, using gC--bdnf or gC--gdnf, respectively, can be followed by long-term (2 months) expression (Cao et al., 2008). Targeted gene transfer is achieved by changing the ligand used for the initial binding of HSV-1 vector particles to cells. The remaining steps in entry, including vector particle-cell membrane fusion and delivery of vector DNA to the nucleus, are unchanged. Thus, targeted gene transfer to many different ligands is likely to be compatible with long-term expression.

3.2. Implications for physiological studies

The antibody-mediated targeted gene transfer developed here represents a potentially general strategy for targeting gene transfer to many different types of neurons. In theory, targeted gene transfer could be achieved to any specific cell surface protein for which an antibody exists, or can be isolated. In practice, targeting to rare ligands may be problematic, as just discussed. The antibody-mediated targeting we have achieved to date; to NR1 (this study) and NR2B (Cao et al., in preparation); suggests it may be possible to target gene transfer to a number of different ligands, supporting targeted gene transfer to a number of different types of neurons. Nonetheless, the utility of antibody-mediated targeted gene transfer will be clarified as more ligands and antibodies are examined.

Further specificity in the type of neuron supporting recombinant gene expression may be achieved by combining targeted gene transfer with cell-type specific promoters. Specific promoters have been identified that support long-term expression from HSV-1 vectors in all neurons, or catecholaminergic, enkephalinergic, glutamatergic, or GABAergic neurons (Jin et al., 1996; Kaplitt et al., 1994; Rasmussen et al., 2007; Song et al., 1997; Zhang et al., 2000). Neuron-specific or catecholaminergic-specific promoters support long-term expression after targeted gene transfer (this study and (Cao et al., 2008)). The specificity supported by combining targeted transfer and neuron type-specific promoters may be particularly beneficial in the forebrain, which contains a large number of different types of neurons. Thus, targeted gene transfer, combined with neuron type-specific promoters, may support a wide range of neural gene therapy applications and basic neuroscience studies.

4. Experimental procedures

4.1. Materials

Restriction endonucleases and T4 DNA ligase were obtained from New England Biolabs, except SanD I was from Stratagene. Dulbecco s modified minimal essential medium, fetal bovine serum, G418, lipofectamine, and OPTI-MEM I were from Invitrogen. Male Long-Evans rats (initially ~6 weeks old) were from Charles River. X-Gal was from Sigma. pEZZ 18 (M74186) was from Amersham Biosciences. Mouse monoclonal anti-HSV-1 gC, rabbit anti-NMDA NR1 (sc9058, for targeted gene transfer), and goat anti-NMDA NR1 (sc1467, for immunohistochemistry) were from Santa Cruz Biotechnology. Mouse anti-E. coli β-gal and mouse monoclonal anti-flag were from Sigma. Fluorescein isothiocyanate-conjugated goat anti-mouse Ig G was from Sigma; and rhodamine isothiocyanate-conjugated bovine anti-mouse Ig G and fluorescein isothiocyanateconjugated bovine anti-goat Ig G were from Santa Cruz Biotechnology.

4.2. Cells

The growth of BHK21 fibroblast cells (Sun et al., 1999) and 2-2 cells (Smith et al., 1992) have been described.

4.3. Plasmids

A plasmid that contains the gC promoter, the prepro sequences from BDNF, and the Staph A ZZ domain fused to gC deleted in the N-terminus was constructed in three steps.

First, PCR was used to isolate a plasmid that contains the human BDNF prepro domain (aa 1-128) (Lin et al., 1993): The template was pINS-TH-NFHbdnf/ires/lac (Sun et al., 2005). The primers were 5 GGGAAGCTTACCATGACCATCCTTTTCCTTACTATGG 3 (contains the ATG and a Hind III site); and 5 GCGCTCGAGAGGGTCAGAGTGGCGCCGGACCCTC 3 (antisense strand, 128 is the last aa complementary to this primer, contains a Xho I site). The PCR products were inserted into the TOPO vector to yield pTOPOprepro.

Second, a plasmid was isolated that contains the Staph A ZZ domain. The template for the PCR was pEZZ 18. The primers were 5 GGGCTCGAGGCGCAACACGATGAAGCCGTAGACA 3 (contains aXho I site) and 5 GCCGGATCCTGCTCCTCCCGCGTCTACTTTCGGCGCCTGAGCA 3 (contains aBamH I site). The PCR products encode 116 aa from pEZZ 18 and a 5 aa spacer (GGAGS) that we previously used in the gC--bdnf construct to link the BDNF and gC domains (Wang et al., 2005). The PCR products were inserted into the TOPO vector to yield pTOPOzz.

Third, pBR-prepro-ZZ-gC was assembled. pBRgC--BDNF contains an EcoR I site, the gC promoter, a Hind III site, the entire preproBDNF coding sequence, the 5 aa spacer, a Bam H I site, a C-terminal gC fragment from aa 153 through the poly A site, and a Sal I site (Wang et al., 2005). pBRgC--BDNF was digested with Hind III and BamH I and the 6 kb fragment containing the vector backbone, gC promoter, and C-terminal gC fragment was isolated. pTOPOprepro was digested with Hind III and Xho I and the 384 bp fragment containing the BDNF prepro domain was isolated. pTOPOzz was digested with Xho I and a BamH I and the 348 bp fragment containing the ZZ domain was isolated. These three fragments were ligated together to yield pBR-prepro-ZZ-gC (Fig. 1A).

To construct a plasmid containing gBpK- (Laquerre et al., 1998b), we began with two plasmids, pUC18gB and ΔgB (Tang et al., 2001). pUC19gB contains the gB gene as a 5.2 kb BamH I and Nde I fragment (HSV-1 nucleotides 52,588 to 57,747 (McGeoch et al., 1988)). ΔgB contains a Hind III site, nucleotides 54,185 to 55,486, an EcoR I site, nucleotides 55,576 to 56,996, and a BamH I site. pUC18gB was digested with Nco I and SanD I, and the 1 kb fragment was isolated; ΔgB was digested with the same enzymes, and the 6 kb vector fragment was isolated; and these two fragments were ligated together to yield ΔgBrepaired. ΔgBrepaired was digested with Hind III and BamH I, and the 2.8 kb fragment was inserted into pUC19 digested with the same enzymes to yield pUC19gBpart. The gBpK- mutation replaces 27 bp, encoding amino acids 68 to 76 (KPKKNKKPK), with a BamH I site (Laquerre et al., 1998b). To insert this mutation, pUC19gBpart was digested with NgoM IV and SanD I, the 5.5 kb fragment was isolated, and two oligos (5 GACCCAGGATCCCCACCAAAACCACCACGACCAG 3 and 5 CCGGCTGGTCGTGGTGGTTTTGGTGGGGATCCTGG 3 )were inserted to yield pUC19gBpartpK-. To isolate a full length gBpK-, pUC19gBpartpK- was digested with SanD I, and SnaB I, and the 1.3 kb fragment was isolated; pUC18gB was digested with the same enzymes, and the 6.3 kb fragment was isolated; and these two fragments were ligated together to yield pUC18gBpK-.

4.4. Cosmids

Cosmid set C (cos6, cos14, cos28, cos48, cos56) represents the HSV-1 genome (Cunningham and Davison, 1993). The a sequence, which contains the packaging site, was deleted from the two cosmids that contained it, to yield cos6Δa and cos48Δa (Fraefel et al., 1996). cos14ΔgB and cos28ΔgB contain deletions of the gB gene, and were previously reported (Tang et al., 2001).

The gC--ZZ gene was introduced into cos56 by homologous recombination cloning in E. coli. Recombination cloning in E. coli BJ5183 has been used to manipulate 35 kb adenovirus vectors (Chartier et al., 1996), and we modified this method to support use of up to 6 DNA fragments to reconstruct a HSV-1 cosmid (Kong et al., 1999; Tang et al., 2001; Wang et al., 2005; Yang et al., 2001). The strategy we used to isolate cos56gC--ZZ followed the strategy previously used to isolate cos56gC--bdnf and cos56gC--gdnf (Wang et al., 2005). Each transformation contained 30 µl E. coli BJ5183, 3 ng vector, and the two other fragments (1:1 molar ratio relative to vector). The vector fragment was the 26.8 kb Spe I and Xba I fragment from cos56 (nucleotides 79,442 to 80,722 and 97,669 to 115,152, also contains SuperCos 1), and the insert fragments were the 17.3 kb EcoR I fragment from cos56 (nucleotides 79,442 to 96,751) and the chimeric gC--ZZ gene (3.1 kb EcoR I and Sal I fragment from pBR-prepro-ZZ-gC). Candidates were analyzed by digestion with specific restriction enzymes. Correct cosmids were transferred into DH5α cells. DNA sequencing confirmed the gC--ZZ region in the cosmid.

4.5. Vectors

pHSVlac expresses β-gal from the HSV-1 IE 4/5 promoter (Geller and Breakefield, 1988). pINS-TH-NFHlac expresses β-gal from the INS-TH-NFH promoter (Zhang et al., 2000). pINS-TH-NFHflag-TH/ires/aadc expresses a flag-tagged human TH (and AADC) from the INS-TH-NFH promoter (Sun et al., 2003).

4.6. Vector packaging, vector particle-antibody complex formation, and titering

Helper virus-free packaging (Fraefel et al., 1996) was performed using 2-2 cells and a modified protocol (Sun et al., 1999) that improves the efficiency. For cell culture experiments, pHSVlac was contransfected with cos6Δa, cos14, cos28, cos48Δa, and cos56gC--ZZ. For targeted gene transfer in the brain, pINS-TH-NFHlac was cotransfected with cos6Δa, cos14ΔgB, cos28ΔgB, cos48Δa, cos56gC--ZZ, and pUC18gBpK- (same amount as each cosmid) (Fig. 1B). For untargeted gene transfer in the brain, pINS-TH-NFHflag-TH/ires/aadc was cotransfected with cos6Δa, cos14, cos28, cos48Δa, cos56gC--wt. Vector stocks for untargeted gene transfer were purified using established procedures (Lim et al., 1996).

For vector particle-antibody complex formation, vector stocks were purified through the first of the two ultracentrifugations (sucrose gradient) as for untargeted gene transfer (Lim et al., 1996). To remove the sucrose, the vector solution was dialyzed against PBS at 4 oC for 3 hours (3 buffer changes). Four 10 cm plates yielded ~ 10 ml of vector solution after the dialysis. One volume of vector solution (typically 4 ml) was incubated with 1 volume OPTI-MEM I and 1/20 volume 0.2 μg/μl rabbit anti-NMDA NR1, for 1 hour on ice. PBS was added to a total volume of 15 ml and the second ultracentrifugation was performed as described (Lim et al., 1996).

Vector stocks were titered by counting the numbers of positive cells at 1 day after transduction of BHK cells. pHSVlac/gC--wt, pHSVlac/gC--ZZ, and pINS-TH-NFHlac/gC--ZZ+anti-NR1 stocks were titered by staining with X-gal, and pINS-TH-NFHflag-TH/ires/aadc/gC--wt stocks were titered using an anti-flag antibody (Song et al., 1998). The titers of the vector stocks used in this study were pHSVlac/gC--ZZ, 3 × 105 IVP/ ml; pHSVlac/gC--wt, 1 × 106 IVP/ ml; pINS-TH-NFHlac/gC--ZZ+anti-NR1, 1 × 106 IVP/ ml; and pINS-TH-NFHflag-TH/ires/aadc/gC--wt, 6 × 107 IVP/ml. No wt HSV-1 was detected in these vector stocks (<10 plaque forming units (pfu)/ml).

4.7. Immunofluorescence staining for either gC or Ig G binding

BHK cells were transduced with pHSVlac/gC--ZZ or pHSVlac/gC--wt, 1 day later fixed with 4 % pararformaldehyde, and immunofluorescence was performed as described (Wang et al., 2005) using mouse monoclonal anti-gC (1:50 dilution) and fluorescein isothiocyanate-conjugated goat anti-mouse Ig G, only the secondary antibody, or no primary or secondary antibodies.

4.8. Gene transfer experiments in the brain

These studies were approved by the West Roxbury VA Hospital IACUC. Male Long-Evans rats (initially ~6 weeks old) were used for these experiments. Appropriate volumes of pINS-THNFHlac/gC--ZZ+anti-NR1 and pINS-TH-NFHflag-TH/ires/aadc/gC--wt were mixed together to yield the same IVP/ml for the two vectors. This mixture of vector stocks was delivered by stereotactic injection (2 sites, 1/hemisphere, 3 μl/site) into POR cortex (anterior-posterior (AP) -8.0, medial-lateral (ML) ±6.0, dorsal-ventral (DV) -5.2) (Zhang et al., 2005). AP is relative to bregma, ML is relative to the sagittal suture, and DV is relative to the bregma-lambda plane (Paxinos and Watson, 1986). A micropump (Model 100, KD Scientific) was used for all injections. Vector stocks were injected over five minutes, and after five additional minutes, the 33 gauge needle was slowly retracted.

Rats were perfused, brains were sectioned, and X-gal or immunofluorescent costaining was performed as described (Zhang et al., 2000). Alternating sections were costained with either mouse anti-β-gal (1:200 dilution) or mouse monoclonal anti-flag (1:400 dilution) and goat anti-NMDA NR1 (1:50 dilution). Primary antibodies were visualized using rhodamine isothiocyanate-conjugated bovine anti-mouse Ig G and fluorescein isothiocyanate-conjugated bovine anti-goat Ig G.

4.9. Cell counts

Twenty-five μm coronal sections that contained POR cortex were prepared, and recombinant gene products were detected in ~20 of these sections per hemisphere. Alternating sections were analyzed for costaining of either β-gal-IR or TH (flag-IR) and NR1-IR. Photomicrographs were taken under 60x magnification using a video camera. The positive cells (β-gal-IR or flag-IR) in each section were scored for costaining with NR1-IR, and all the positive cells in each section were scored. Each section was counted at least two times, on different days, and the two values differed by <10 % for each section.

4.10. Statistical analyses

Statistical comparisons were performed using AVOVAs (Excel).

Acknowledgments

We gratefully thank Dr. A. Davison for HSV-1 cosmid set C, Dr. R. Sandri-Goldin for 2-2 cells, Dr. K. O Malley for the TH promoter, Dr. W. Schlaepfer for the NFH promoter, Dr. G. Felsenfeld for β-globin insulator, and Dr. K O Malley for the TH gene. This work was supported by AG025894 (G.Z.) and AG021193, NS043107, NS045855, and NS057558 (A.I.G.).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Theme: Cellular and molecular biology

Topic: Gene structure and function: general

References

  1. Bergman I, Whitaker-Dowling P, Gao Y, Griffin JA, Watkins SC. Vesicular stomatitis virus expressing a chimeric Sindbis glycoprotein containing an Fc antibody binding domain targets to Her2/neu overexpressing breast cancer cells. Virology. 2003;316:337–47. doi: 10.1016/j.virol.2003.07.010. [DOI] [PubMed] [Google Scholar]
  2. Buning H, Ried MU, Perabo L, Gerner FM, Huttner NA, Enssle J, Hallek M. Receptor targeting of adeno-associated virus vectors. Gene Ther. 2003;10:1142–51. doi: 10.1038/sj.gt.3301976. [DOI] [PubMed] [Google Scholar]
  3. Cao H, Zhang GR, Wang X, Kong L, Geller AI. Enhanced nigrostriatal neuron-specific, long-term expression by using neural-specific promoters in combination with targeted gene transfer by modified helper virus-free HSV-1 vector particles. BMC Neurosci. 2008;9:37. doi: 10.1186/1471-2202-9-37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chartier C, Degryse E, Gantzer M, Dieterle A, Pavirani A, Mehtali M. Efficient generation of recombinant adenovirus vectors by homologous recombination in Escherichia coli. J. Virol. 1996;70:4805–10. doi: 10.1128/jvi.70.7.4805-4810.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cunningham C, Davison AJ. A cosmid-based system for constructing mutants of herpes simplex virus type 1. Virology. 1993;197:116–24. doi: 10.1006/viro.1993.1572. [DOI] [PubMed] [Google Scholar]
  6. Douglas JT, Rogers BE, Rosenfeld ME, Michael SI, Feng M, Curiel DT. Targeted gene delivery by tropism-modified adenoviral vectors. Nat. Biotechnol. 1996;14:1574–8. doi: 10.1038/nbt1196-1574. [DOI] [PubMed] [Google Scholar]
  7. Fraefel C, Song S, Lim F, Lang P, Yu L, Wang Y, Wild P, Geller AI. Helper virus-free transfer of herpes simplex virus type 1 plasmid vectors into neural cells. J. Virol. 1996;70:7190–7. doi: 10.1128/jvi.70.10.7190-7197.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Geller AI, Breakefield XO. A defective HSV-1 vector expresses Escherichia coli beta-galactosidase in cultured peripheral neurons. Science. 1988;241:1667–9. doi: 10.1126/science.241.4873.1667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Geller AI, During MJ, Neve RL. Molecular analysis of neuronal physiology by gene transfer into neurons with herpes simplex virus vectors. Trends Neurosci. 1991;14:428–32. doi: 10.1016/0166-2236(91)90040-2. [DOI] [PubMed] [Google Scholar]
  10. Grandi P, Wang S, Schuback D, Krasnykh V, Spear M, Curiel DT, Manservigi R, Breakefield XO. HSV-1 virions engineered for specific binding to cell surface receptors. Mol. Ther. 2004;9:419–27. doi: 10.1016/j.ymthe.2003.12.010. [DOI] [PubMed] [Google Scholar]
  11. Jin BK, Belloni M, Conti B, Federoff HJ, Starr R, Son JH, Baker H, Joh TH. Prolonged in vivo gene expression driven by a tyrosine hydroxylase promoter in a defective herpes simplex virus amplicon vector. Hum. Gene Ther. 1996;7:2015–24. doi: 10.1089/hum.1996.7.16-2015. [DOI] [PubMed] [Google Scholar]
  12. Kaplitt MG, Kwong AD, Kleopoulos SP, Mobbs CV, Rabkin SD, Pfaff DW. Preproenkephalin promoter yields region-specific and long-term expression in adult brain after direct in vivo gene transfer via a defective herpes simplex viral vector. Proc. Natl. Acad. Sci. U.S.A. 1994;91:8979–83. doi: 10.1073/pnas.91.19.8979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kasahara N, Dozy AM, Kan YW. Tissue-specific targeting of retroviral vectors through ligand-receptor interactions. Science. 1994;266:1373–6. doi: 10.1126/science.7973726. [DOI] [PubMed] [Google Scholar]
  14. Kong Y, Yang T, Geller AI. An efficient in vivo recombination cloning procedure for modifying and combining HSV-1 cosmids. J. Virol. Methods. 1999;80:129–36. doi: 10.1016/s0166-0934(99)00033-6. [DOI] [PubMed] [Google Scholar]
  15. Laquerre S, Anderson DB, Stolz DB, Glorioso JC. Recombinant herpes simplex virus type 1 engineered for targeted binding to erythropoietin receptor-bearing cells. J. Virol. 1998a;72:9683–97. doi: 10.1128/jvi.72.12.9683-9697.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Laquerre S, Argnani R, Anderson DB, Zucchini S, Manservigi R, Glorioso JC. Heparan sulfate proteoglycan binding by herpes simplex virus type 1 glycoproteins B and C, which differ in their contributions to virus attachment, penetration, and cell-to-cell spread. J. Virol. 1998b;72:6119–30. doi: 10.1128/jvi.72.7.6119-6130.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Lim F, Hartley D, Starr P, Lang P, Song S, Yu L, Wang Y, Geller AI. Generation of high-titer defective HSV-1 vectors using an IE 2 deletion mutant and quantitative study of expression in cultured cortical cells. Biotechniques. 1996;20:460–9. doi: 10.2144/19962003460. [DOI] [PubMed] [Google Scholar]
  18. Lin LF, Doherty DH, Lile JD, Bektesh S, Collins F. GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons. Science. 1993;260:1130–2. doi: 10.1126/science.8493557. [DOI] [PubMed] [Google Scholar]
  19. Liu M, Wang X, Geller AI. Helper virus-free HSV-1 vectors packaged in the presence of combinations of mutations in the protein kinase UL13 and the VP16 transcriptional complex enhance long-term expression. BMC Molecular Biology. 2009;10:58. doi: 10.1186/1471-2199-10-58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Mardberg K, Trybala E, Glorioso JC, Bergstrom T. Mutational analysis of the major heparan sulfate-binding domain of herpes simplex virus type 1 glycoprotein C. J. Gen. Virol. 2001;82:1941–50. doi: 10.1099/0022-1317-82-8-1941. [DOI] [PubMed] [Google Scholar]
  21. McGeoch DJ, Dalrymple MA, Davison AJ, Dolan A, Frame MC, McNab D, Perry LJ, Scott JE, Taylor P. The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 1988;69:1531–74. doi: 10.1099/0022-1317-69-7-1531. [DOI] [PubMed] [Google Scholar]
  22. Morizono K, Bristol G, Xie YM, Kung SK, Chen IS. Antibody-directed targeting of retroviral vectors via cell surface antigens. J. Virol. 2001;75:8016–20. doi: 10.1128/JVI.75.17.8016-8020.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Morizono K, Chen IS. Targeted gene delivery by intravenous injection of retroviral vectors. Cell Cycle. 2005;4:854–6. doi: 10.4161/cc.4.7.1789. [DOI] [PubMed] [Google Scholar]
  24. Morizono K, Xie Y, Ringpis GE, Johnson M, Nassanian H, Lee B, Wu L, Chen IS. Lentiviral vector retargeting to P-glycoprotein on metastatic melanoma through intravenous injection. Nat Med. 2005;11:346–52. doi: 10.1038/nm1192. [DOI] [PubMed] [Google Scholar]
  25. Muller OJ, Kaul F, Weitzman MD, Pasqualini R, Arap W, Kleinschmidt JA, Trepel M. Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors. Nat. Biotechnol. 2003;21:1040–6. doi: 10.1038/nbt856. [DOI] [PubMed] [Google Scholar]
  26. Ohno K, Sawai K, Iijima Y, Levin B, Meruelo D. Cell-specific targeting of Sindbis virus vectors displaying IgG-binding domains of protein A. Nat Biotechnol. 1997;15:763–7. doi: 10.1038/nbt0897-763. [DOI] [PubMed] [Google Scholar]
  27. Paxinos G, Watson C. The rat brain in stereotaxic coordinates. Academic Press; Sidney: 1986. [DOI] [PubMed] [Google Scholar]
  28. Peng KW, Russell SJ. Viral vector targeting. Curr. Opin. Biotechnol. 1999;10:454–7. doi: 10.1016/s0958-1669(99)00009-9. [DOI] [PubMed] [Google Scholar]
  29. Rasmussen M, Kong L, Zhang G, Liu M, Wang X, Szabo G, Curthoys NP, Geller AI. Glutamatergic or GABAergic neuron-specific, long-term expression in neocortical neurons from helper virus-free HSV-1 vectors containing the phosphate-activated glutaminase, vesicular glutamate transporter-1, or glutamic acid decarboxylase promoter. Brain Res. 2007;1144:19–32. doi: 10.1016/j.brainres.2007.01.125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Ried MU, Girod A, Leike K, Buning H, Hallek M. Adeno-associated virus capsids displaying immunoglobulin-binding domains permit antibody-mediated vector retargeting to specific cell surface receptors. J. Virol. 2002;76:4559–66. doi: 10.1128/JVI.76.9.4559-4566.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Roizman B, Sears AE. Herpes simplex viruses and their replication. In: Roizman B, Whitley RJ, Lopez C, editors. The human herpesviruses. Raven Press; New York: 1993. pp. 11–68. [Google Scholar]
  32. Shukla D, Spear PG. Herpesviruses and heparan sulfate: an intimate relationship in aid of viral entry. J. Clin. Invest. 2001;108:503–10. doi: 10.1172/JCI13799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Smith IL, Hardwicke MA, Sandri-Goldin RM. Evidence that the herpes simplex virus immediate early protein ICP27 acts post-transcriptionally during infection to regulate gene expression. Virology. 1992;186:74–86. doi: 10.1016/0042-6822(92)90062-t. [DOI] [PubMed] [Google Scholar]
  34. Song S, Wang Y, Bak SY, Lang P, Ullrey D, Neve RL, O'Malley KL, Geller AI. An HSV-1 vector containing the rat tyrosine hydroxylase promoter enhances both long-term and cell type-specific expression in the midbrain. J. Neurochem. 1997;68:1792–803. doi: 10.1046/j.1471-4159.1997.68051792.x. [DOI] [PubMed] [Google Scholar]
  35. Song S, Wang Y, Bak SY, During MJ, Bryan J, Ashe O, Ullrey DB, Trask LE, Grant FD, O'Malley KL, Riedel H, Goldstein DS, Neve KA, LaHoste GJ, Marshall JF, Haycock JW, Neve RL, Geller AI. Modulation of rat rotational behavior by direct gene transfer of constitutively active protein kinase C into nigrostriatal neurons. J Neurosci. 1998;18:4119–32. doi: 10.1523/JNEUROSCI.18-11-04119.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Spear PG, Longnecker R. Herpesvirus entry: an update. J. Virol. 2003;77:10179–85. doi: 10.1128/JVI.77.19.10179-10185.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sun M, Zhang GR, Yang T, Yu L, Geller AI. Improved titers for helper virus-free herpes simplex virus type 1 plasmid vectors by optimization of the packaging protocol and addition of noninfectious herpes simplex virus-related particles (previral DNA replication enveloped particles) to the packaging procedure. Hum. Gene Ther. 1999;10:2005–11. doi: 10.1089/10430349950017365. [DOI] [PubMed] [Google Scholar]
  38. Sun M, Zhang G, Kong L, Holmes C, Wang X, Zhang W, Goldstein DS, Geller AI. Correction of a rat model of Parkinson s disease by coexpression of tyrosine hydroxylase and aromatic amino acid decarboxylase from a helper virus-free herpes simplex virus type 1 vector. Hum. Gene Ther. 2003;14:415–24. doi: 10.1089/104303403321467180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sun M, Kong L, Wang X, Holmes C, Gao Q, Zhang W, Pfeilschifter J, Goldstein DS, Geller AI. Coexpression of Tyrosine Hydroxylase, GTP Cyclohydrolase I, Aromatic Amino Acid Decarboxylase, and Vesicular Monoamine Transporter-2 from a Helper Virus-Free HSV-1 Vector Supports High-Level, Long-Term Biochemical and Behavioral Correction of a Rat Model of Parkinson s Disease. Hum. Gene Ther. 2004;15:1177–1196. doi: 10.1089/hum.2004.15.1177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sun M, Kong L, Wang X, Lu X, Gao Q, Geller AI. Comparison of protection of nigrostriatal neurons by expression of GDNF, BDNF, or both neurotrophic factors. Brain Res. 2005;1052:119–29. doi: 10.1016/j.brainres.2005.05.072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tai CK, Logg CR, Park JM, Anderson WF, Press MF, Kasahara N. Antibody-mediated targeting of replication-competent retroviral vectors. Hum Gene Ther. 2003;14:789–802. doi: 10.1089/104303403765255174. [DOI] [PubMed] [Google Scholar]
  42. Tal-Singer R, Peng C, Ponce De Leon M, Abrams WR, Banfield BW, Tufaro F, Cohen GH, Eisenberg RJ. Interaction of herpes simplex virus glycoprotein gC with mammalian cell surface molecules. J. Virol. 1995;69:4471–83. doi: 10.1128/jvi.69.7.4471-4483.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tang J, Yang T, Ghosh HP, Geller AI. Helper Virus-Free HSV-1 Vectors Packaged Both in the Presence of VSV G Protein and in the Absence of HSV-1 Glycoprotein B Support Gene Transfer into Neurons in the Rat Striatum. J. NeuroVirol. 2001;7:548–55. doi: 10.1080/135502801753248132. [DOI] [PubMed] [Google Scholar]
  44. Volpers C, Thirion C, Biermann V, Hussmann S, Kewes H, Dunant P, von der Mark H, Herrmann A, Kochanek S, Lochmuller H. Antibody-mediated targeting of an adenovirus vector modified to contain a synthetic immunoglobulin g-binding domain in the capsid. J. Virol. 2003;77:2093–104. doi: 10.1128/JVI.77.3.2093-2104.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wang X, Kong L, Zhang G, Sun M, Geller AI. Targeted gene transfer to nigrostriatal neurons in the rat brain by helper virus-free HSV-1 vector particles that contain either a chimeric HSV-1 glycoprotein C--GDNF or a gC--BDNF protein. Molec. Brain Res. 2005;139:88–102. doi: 10.1016/j.molbrainres.2005.05.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wickham TJ, Roelvink PW, Brough DE, Kovesdi I. Adenovirus targeted to heparan-containing receptors increases its gene delivery efficiency to multiple cell types. Nat. Biotechnol. 1996a;14:1570–3. doi: 10.1038/nbt1196-1570. [DOI] [PubMed] [Google Scholar]
  47. Wickham TJ, Segal DM, Roelvink PW, Carrion ME, Lizonova A, Lee GM, Kovesdi I. Targeted adenovirus gene transfer to endothelial and smooth muscle cells by using bispecific antibodies. J. Virol. 1996b;70:6831–8. doi: 10.1128/jvi.70.10.6831-6838.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wickham TJ. Ligand-directed targeting of genes to the site of disease. Nat. Med. 2003;9:135–9. doi: 10.1038/nm0103-135. [DOI] [PubMed] [Google Scholar]
  49. Yang T, Zhang G, Zhang W, Sun M, Wang X, Geller AI. Enhanced reporter gene expression in the rat brain from helper virus-free HSV-1 vectors packaged in the presence of specific mutated HSV-1 proteins that affect the virion. Molec. Brain. Res. 2001;90:1–16. doi: 10.1016/s0169-328x(01)00059-6. [DOI] [PubMed] [Google Scholar]
  50. Zhang G, Wang X, Yang T, Sun M, Zhang W, Wang Y, Geller AI. A tyrosine hydroxylase--neurofilament chimeric promoter enhances long-term expression in rat forebrain neurons from helper virus-free HSV-1 vectors. Molec. Brain. Res. 2000;84:17–31. doi: 10.1016/s0169-328x(00)00197-2. [DOI] [PubMed] [Google Scholar]
  51. Zhang G, Wang X, Kong L, Lu X, Lee B, Liu M, Sun M, Franklin C, Cook RG, Geller AI. Genetic enhancement of visual learning by activation of protein kinase C pathways in small groups of rat cortical neurons. J Neurosci. 2005;25:8468–81. doi: 10.1523/JNEUROSCI.2271-05.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zhang G, Liu M, Cao H, Kong L, Wang X, Cook RG, Geller AI. Improved spatial learning in aged rats by genetic activation of protein kinase C in small groups of rat hippocampal neurons. Hippocampus. 2009;19:413–23. doi: 10.1002/hipo.20506. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES