Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Aug 27.
Published in final edited form as: Immunity. 2010 Aug 5;33(2):254–265. doi: 10.1016/j.immuni.2010.07.016

Follicular B cell trafficking within the spleen actively restricts humoral immune responses

Kristen L Hoek 1, Laura E Gordy 1, Patrick L Collins 1, Vrajesh V Parekh 1, Thomas M Aune 1,2, Sebastian Joyce 1, James W Thomas 1,2, Luc Van Kaer 1, Eric Sebzda 1,3
PMCID: PMC2929658  NIHMSID: NIHMS226567  PMID: 20691614

Summary

Follicular (FO) and marginal zone (MZ) B cells are maintained in distinct locations within the spleen but the genetic basis for this separation is still enigmatic. We now report that B cell sequestration requires lineage-specific regulation of migratory receptors by the transcription factor, Klf2. Moreover, using gene-targeted mice we show that altered splenic B cell migration confers a significant in vivo gain-of-function phenotype to FO B cells, including the ability to quickly respond to MZ-associated antigens and pathogens in a T cell-dependent manner. This work demonstrates that in wild-type animals, naïve FO B cells are actively removed from the MZ, thus restricting their capacity to respond to blood-borne pathogens.

Introduction

The B cell compartment is comprised of three mature lymphocyte lineages: B1 B cells (Fagarasan et al., 2000), B2 marginal zone (MZ) B cells (Lopes-Carvalho and Kearney, 2004; Martin and Kearney, 2002), and B2 follicular (FO) B cells (Okada and Cyster, 2006). All three lineages are located in distinct anatomical sites that contribute to their unique humoral functions. B1 B cells are found in the pleural and peritoneal cavities and respond to invading bacteria within the gut. Mature MZ B cells reside within the splenic white pulp, directly adjacent to the marginal sinus in the MZ. These cells come in direct contact with slow flowing blood and typically respond to blood-borne pathogens. In adult mice, B1 B cells and MZ B cells act to mediate the initial wave of humoral immunity against invading pathogens by quickly producing antigen-specific antibodies in a thymus-independent (TI) fashion. In sharp contrast, FO B cells circulate between the blood and spleen and comprise the majority of B cells found in peripheral lymph nodes. These cells rely on thymus-dependent (TD) signals to respond to antigen and are located adjacent to T cell-rich areas in secondary lymphoid organs. How these B cell lineages remain compartmentalized is the subject of intense research.

A major challenge is to determine the mechanisms by which B cell migration is transcriptionally controlled. Quiescent B cells express Kruppel-like factor 2 (Klf2), a transcription factor previously implicated in naïve T cell cycling (Buckley et al., 2001; Kuo et al., 1997b) and trafficking (Carlson et al., 2006; Sebzda et al., 2008). To determine if this factor was similarly required within the B cell lineage, Klf2 was excised in a B cell-specific manner. We discovered that Klf2 differentially regulates FO and MZ B cell migratory receptors, and that loss of Klf2 causes a blurring of MZ and FO B cell separation within the spleen. As a result of this novel migratory defect, Klf2-deficient FO B cells gain the ability to respond to MZ-associated antigens and pathogens. This study indicates that Klf2 supports lineage-specific B cell homeostatic trafficking patterns and, in the case of FO B cells, restricts antigen recognition within the spleen.

Results

Klf2-deficient B cells prematurely exit the bone marrow

Klf2 expression is first detected in the B cell compartment following productive pre-B cell receptor signaling in small resting pre-B lymphocytes (Schuh et al., 2008). This transcription factor is preferentially expressed in quiescent B cells (Bhattacharya et al., 2007; Fruman et al., 2002; Glynne et al., 2000), and we found that several factors that induce B cell activation quickly downregulated Klf2 expression (Figure S1A). Although transcription varied between B cell lineages (e.g. naïve FO B cell express 2.5× more Klf2 than MZ B cells, P=0.004), all three cell types efficiently extinguished Klf2 expression following B cell-receptor stimulation (Figure S1B). To better understand the role of Klf2 within the B cell compartment, we crossed loxP-flanked Klf2 mice with gene-targeted animals expressing Cre under the CD19 promoter (Klf2fl/fl; Cd19-Cre+/−). As expected, efficient Klf2 excision was observed exclusively in B cells, both at the transcriptional (Figure S1C) and translational level (Figure S1D). Flow cytometric analysis of bone marrow cells indicated that Klf2-deficient B cell development up to the immature B cell stage was normal, both in terms of surface receptors and absolute cell numbers (Figure 1A). In contrast, fewer transitional or recirculating Klf2-deficient B cells were detected. Both T1 (AA4+IgM+CD23−) and T2 (AA4+IgM+CD23+) transitional B cell numbers were increased in spleens from genetically targeted animals (Figure 1B), suggesting that Klf2 excision did not block late stages of B cell development but instead played a role in immature B cell retention within the bone marrow.

Figure 1.

Figure 1

Open in a new tab

Klf2fl/fl; CD19-cre+/− mice have decreased numbers of mature B cells in the bone marrow but increased numbers of transitional B cells in the spleen. (A) Transitional and mature B cell numbers are reduced in bone marrow of genetically targeted mice. Left panel: B cell differentiation within the bone marrow of Klf2fl/fl; Cd19-Cre+/− (cKO=genetically targeted) and Klf2+/+; Cd19-Cre+/− (control) mice was analyzed by flow cytometry using surface markers that distinguish between Pro-B + Pre-B cells (B220lowIgMlow), immature B cells (B220intIgMint), transitional B cells (B220intIgMhi), and mature + recirculating B cells (B220hiIgMint). Right panel: Transitional (AA4.1+ IgMhiIgDint) and mature + recirculating (AA4.1−IgMintIgDhi) B cells were reanalyzed using an alternative staining technique. Numbers are B cell percentages within each compartment; absolute cell numbers are displayed in the corresponding bar graph. (Pro + Pre = Pro-B and Pre-B cells, Imm. = Immature B cells, Trans. = Transitional B cells, Recirc. = Recirculating B cells) *Note that Pro+Pre B cell numbers are displayed on a different scale (×107). N = 4 animals per group. P>0.05 for Pro + Pre and Imm. B cell stages. Error bars indicate standard deviation. (B) Transitional B cell stages (B220+AA4.1+) within the spleen of cKO and control mice were examined by flow cytometry and corresponding absolute cell numbers and P values are listed in the adjoining bar graph. Percentages of T1 (AA4.1+B220+IgMhiCD23low) and T2 (AA4.1+B220+IgMhiCD23hi) B cells are displayed in the contour plots. N = 8 animals per group. Error bars are standard deviation.

Genetically targeted mice have increased numbers of splenic B cells

The mature splenic B cell compartment is composed of circulating FO B cells and non-circulating MZ B cells. As shown in Figure 2A, genetically targeted mice had an increased proportion of MZ B cells (AA4.1−CD21hiIgMhi) relative to control littermates (Klf2+/+; Cd19-Cre-cre+/− or Klf2fl/+; Cd19-Cre+/−). In fact, both FO and MZ B cell numbers were significantly increased in the spleens of genetically targeted animals (Figure 2B). To ensure that lymphocytes were correctly identified, the B cell compartment was reanalyzed using additional staining techniques. First, circulating FO B cells were identified in mesenteric lymph nodes of control animals, which are known to lack MZ B cells (Allman and Pillai, 2008), using antibodies directed against CD21, CD23, and IgM (Figure S2A). A similar cell population, which expresses slightly higher levels of CD21, was then identified in lymph nodes of genetically targeted mice. These gating parameters were transferred to the splenic B cell compartment to demarcate FO B cells. MZ B cell populations were then gated in relation to the FO B cell compartment (Figure S2B). To ensure that CD23+ MZ B cell precursors were not mistakenly identified as FO B cells, splenocytes were stained with a combination of antibodies to distinguish MZ B cell precursors from MZ and FO B cells (Srivastava et al., 2005). Similar to transitional B cell stages, genetically targeted mice had relatively normal frequencies of MZ B cell precursors (Figure S2C), which translated into significantly increased cell numbers (control=2.8 (± 1.7) ×106, genetically targeted mice=13.1 (± 5.8) ×106, P=0.005). FO-II B cells (AA4.1+ CD19+ IgMhi IgDhi CD21int CD23+), which are speculated to act as a reservoir for MZ precursors (Cariappa et al., 2007), were not affected by the loss of Klf2 (control=3.1 (± 1.4) ×106, genetically targeted mice=3.9 (± 2.2) ×106, P=0.56). Both Klf2+ and Klf2-deficient FO B cells (FO-I cells) displayed similar staining patterns for IgD, CD1d and CD9 (Figure S2D), which were distinct from Klf2+ and Klf2-deficient MZ B cell precursors. These conserved surface markers (Figure S2E) confirmed that FO B cells were distinct from MZ B cell precursors in genetically targeted animals, and that despite elevated surface expression of CD21 in Klf2-deficient B cells, this receptor could be used to properly identify FO B cells (Figure S2F). It should be noted that a small number of AA4.1−CD21hiIgMhi cells were detected in the blood and lymph nodes of Klf2fl/fl; Cd19-Cre+/− mice (2–3% of AA4.1− B cells); however, these cells co-stained for CD23 and IgD but not CD1d or CD9 (Figure S2G), indicating that these were FO B lymphocytes and not aberrantly migrating MZ B cells.

Figure 2.

Figure 2

Open in a new tab

Genetically targeted animals have increased numbers of splenic B cells. (A) Mature splenic B cells (B220+ AA4.1−) from Klf2fl/fl; Cd19-Cre+/− (genetically targeted=cKO) and Klf2fl/+; Cd19-Cre+/− (control) mice are displayed in terms of the lineage-defining markers, CD21, IgD and IgM. The inner quadrant demarcates MZ B cells and their relative frequency. N > 20 animals per group. (B) Absolute AA4.1− B cell numbers from Klf2+/+; Cd19-Cre+/− (black bars) and Klf2fl/fl; Cd19-Cre+/− (red bars) animals are shown along with significant P values. Error bars indicate standard deviation. *Note that blood is measured in terms of volume instead of total tissue and is displayed on an alternative scale (×105 per ml). (MsLN = mesenteric lymph nodes, MZ = splenic MZ B cells, FO = splenic follicular B cells) N = 6 animals per group. P>0.05 for blood and MsLN. (C) Immunohistochemistry of spleens from control and cKO mice, stained for B220+ (red) and MOMA-1+ (green). The MOMA1+ metallophilic macrophages appear yellow in the overlay. A white dashed line highlights the outer edge of the MZ. MZ area was enumerated from 10 separate images and displayed as a bar graph with an arbitrary scale (number of pixels). Error bars are standard deviation. N = 4 animals per group.

Immunohistochemistry confirmed that the MZ area was increased in Klf2fl/fl; Cd19-Cre+/− animals relative to littermate controls (Figure 2C). Using the MOMA1 antibody to identify metallophilic macrophages that border the marginal sinus, increased numbers of cells expressing the pan-B cell marker, B220, were found within the MZ. On the other hand, the follicular area was not significantly altered (control=1.4±0.7 ×105, genetically targeted mice=2.0±0.3 ×105 pixels, P=0.16). Therefore, we conclude that Klf2fl/fl; Cd19-Cre+/− mice had increased numbers of splenic B cells and that this correlated with a significantly larger B cell-filled MZ.

Klf2 differentially regulates chemokine receptor expression on FO and MZ B cells

Premature exit from bone marrow was suggestive of a Klf2-deficient migratory defect. Moreover, it has been reported that Klf2-deficient T cells aberrantly traffic due to inappropriately expressed migratory receptors (Bai et al., 2007; Carlson et al., 2006; Sebzda et al., 2008). When we examined B cell homing receptors, we noted that Klf2-deficient MZ B cells had reduced mRNA expression of C-X-C chemokine receptor 5 (CXCR5) and sphinogosine-1-phosphate receptor 1 (S1P1) (Figure 3A). In contrast, Klf2-deficient FO B cells upregulated expression of these receptors. To determine if Klf2 was directly influencing CXCR5 and S1P1 transcription, chromatin immunoprecipitation (ChIP) assays were conducted. Highly conserved, non-coding sequences that contained the consensus Klf2 binding motif, CACCC (Anderson et al., 1995), proximal to CXCR5 and S1P1 transcriptional initiation sites were chosen as regulatory targets. Klf2 protein directly bound to regulatory regions of CXCR5 and S1P1 in MZ B cells but not FO B cells (Figure 3B), which suggested that Klf2 directly promoted CXCR5 and S1P1 transcription in MZ B cells and indirectly repressed these receptors in FO B cells. To confirm that altered transcription resulted in modified protein expression, we examined receptor intensity by flow cytometry (Figure 3C). Consistent with real-time polymerase chain reaction (PCR) results, Klf2-deficient FO B cells expressed increased amounts of CXCR5, while no changes were detected using antibodies specific for CCR7 or CXCR4. Antibodies that recognize an extracellular portion of S1P1 were not available so this receptor was not examined using this technique. No consistent differences in CXCR5 intensity were detected on Klf2-deficient MZ B cells by flow cytometry, despite significant differences in mRNA expression. To address this apparent discrepancy, ex vivo migration assays were conducted to determine the functional state of chemokine receptors on Klf2-deficient B cells. FO B cells from genetically targeted mice displayed enhanced migration towards the chemokine CXCL13 (Figure 3D). In contrast, Klf2-deficient MZ B cell responses to this chemokine were diminished, indicating that real-time PCR results correctly reflected homing receptor expression. A similar dichotomy occurred with the sphingolipid, S1P; Klf2-deficient FO B cells migrated more robustly than control FO B cells, whereas Klf2-deficient MZ B cells had a decreased response to this ligand relative to control MZ B cells. These data suggest that Klf2 promotes or suppresses chemokine-specific migration in MZ and FO B cells, respectively.

Figure 3.

Figure 3

Open in a new tab

Klf2 regulates MZ and FO B cell homing receptors. (A) MZ and FO B cells from Klf2+/+; Cd19-Cre+/− (control) and Klf2fl/fl; Cd19-Cre+/− (genetically targeted=cKO) mice were analyzed for B cell homing receptor mRNA expression levels by real time PCR. Results are graphed as the fold change relative to control. P>0.05 unless otherwise stated. This experiment was repeated twice. (B) Chromatin immunoprecipitation (ChIP) assays were performed on quiescent MZ (top panel) or FO B cells (lower panel) using primers specific for the regulatory regions of CXCR5 and S1P1. ChIP assays using anti-Klf2 antibody are shown in grey, assays using isotype control antibody are shown in black. Klf2 binding to the regulatory regions of CXCR5 or S1P1 is graphed relative to input amounts of these two sequences, respectively. This experiment was repeated twice. (C) Surface expression of chemokine receptors on B cell populations are displayed as overlaid histograms. Results are representative of three independent experiments. (D) Chemokine or sphingolipid-mediated ex vivo B cell migration. Control (black) and cKO (red) B cells were placed in common transwell chambers and migration towards CXCL12 (CXCR4 ligand), CXCR13 (CXCR5 ligand), or S1P (S1P1 ligand) was measured. Asterisks (*) denote P values < 0.05. Migration assays using CXCL12 were conducted twice; the other assays were done three times. (E) B cell adhesion was measured by culturing unstimulated or pertussis toxin (PTX)-treated B cells in ICAM1-coated plates and analyzing adherent cells by flow cytometry. Error bars are standard deviation. This experiment was performed twice.

Chemokine receptors activate integrins through a Gαi-receptor coupled signaling process (Kinashi, 2005) so B cell adhesion was examined as an indirect measure of chemokine receptor engagement. One of the primary integrins used by both FO and MZ B cells is LFA-1 (αL+β2). Using the LFA-1 ligand, ICAM1, ex vivo adhesion assays demonstrated enhanced binding by Klf2-deficient FO, but not MZ, B cells (Figure 3E). MZ B cells are particularly sensitive to the Gαi inhibitor, pertussis toxin (Guinamard et al., 2000), and pre-treatment with this drug reduced MZ B cell adhesion. Consistent with Gαi-receptor coupled signaling promoting integrin activation, pre-treated Klf2-deficient FO B cells no longer expressed elevated adhesive properties. Together with gene expression data and functional migration studies, these experiments indicate that Klf2 differentially regulates migratory receptors on FO and MZ B cells.

Klf2-deficient FO and MZ B cells are anatomically displaced within the spleen

Differential regulation of chemokine receptors by Klf2 suggested that FO and MZ B cell homing was disrupted in genetically targeted mice. Therefore, splenic architecture was assessed with antibodies that preferentially recognize MZ B cells (IgM) and a subset of FO B cells (IgD). Gross examination showed that Klf2-deficient MZ B cells were present in the MZ (Figure 4A). However, closer inspection revealed that this IgM+ area was discontinuous and often included overlap with MOMA1+ or IgD+ cells. Together with functional migration studies, these results suggest that Klf2 is required for efficient retention of MZ B cells in the MZ. To determine if these cells were utilizing known homing receptors, animals were treated with FTY720, an agonistic peptide that removes surface expression of S1P1(Chiba et al., 2006). Under these conditions, Klf2-deficient MZ B cells completely vacated the MZ (Figure 4A, right panel) yet remained within the spleen (Figure 4B). These data suggested that Klf2-deficient MZ B cells still retained some homeostatic homing receptors, but that these cells were more inclined to enter B cell follicles than Klf2+ MZ B cells.

Figure 4.

Figure 4

Open in a new tab

Klf2-deficient FO and MZ B cells are subtly repositioned within the spleen. (A) Immunohistochemistry of spleens from Klf2+/+; Cd19-Cre+/− (control) and Klf2fl/fl; Cd19-Cre+/− (genetically targeted=cKO) animals that were previously treated ± FTY720. Magnification = 20×. MZ B cells are detected using IgM antibody, FO B cells are detected using IgD antibody, and metallophilic macrophages are highlighted using MOMA-1 antibody. These experiments were conducted twice. (B) Flow cytometric analysis of splenic B cell lineages from control and cKO mice ± FTY720 treatment. Triangles identify MZ B cells and their corresponding frequencies (%). These data are representative of three experiments. (C) FO B cell location relative to the MZ was analyzed by immunohistochemistry using tissue sections from control, cKO, and FTY720-treated cKO mice. Magnification = 40×. FO B cells are IgD+ and metallophilic macrophages are MOMA-1+. This experiment was performed twice. (D) Splenic B cell exposure to blood-borne antigen. Thirty minutes post-intravenous injection of TNP-Ficoll, antigen surface binding was examined by flow cytometry using an anti-TNP specific antibody. Histograms display TNP levels on mature B cell lineages from control (solid grey) and cKO (red line) mice. TNP-binding on Klf2+ MZ B cells (green line) and Klf2+ FO B cells (black line) are shown in the left panel.

Despite subtle defects in MZ B cell migration, B220+ MZ areas were increased in genetically targeted animals, suggesting the presence of alternative B cell lineages within this zone. To test this hypothesis, splenic tissue sections were co-stained for IgD and MOMA1; anti-IgM antibody was excluded from this stain to increase detection of FO B cells. Analysis of Klf2fl/+; Cd19-Cre+/− control spleen showed a distinct separation between FO B cells (green) and MZ specific macrophages (red) (Figure 4C). In contrast, Klf2-deficient FO B cells converged with MZ macrophages, as evidenced by an orange hue in the staining pattern. Treatment with FTY720 led to a clear separation of FO B cells and MZ macrophages, suggesting that Klf2-deficient FO B cells used S1P1 to enter and/or remain within the MZ. To analyze dynamic FO B cell migration, we transferred FO B cells from Klf2+/+; Cd19-Cre+/− or Klf2fl/fl; Cd19-Cre+/− mice into C57Bl/6 recipient animals. As reported previously (van Ewijk and van der Kwast, 1980), newly transferred Klf2+ FO B cells efficiently entered splenic B cell follicles within 24 hours (Figure S3A). In contrast, Klf2-deficient FO B cells were found both within the B cell follicle and the surrounding MZ area. When Klf2+ and Klf2-deficient FO B cells were co-transferred into C57Bl/6 recipients (Figure S3B), these distinct migration patterns became more apparent; Klf2+ FO B cells migrated directly into splenic follicles whereas the majority of transferred Klf2-deficient cells remained within the MZ. In addition, FO B cells from Klf2fl/fl; Cd19-Cre+/− donors were preferentially retained within the spleen following transfer (Figure S3C), indicating that this organ contains distinct anatomical properties that favor Klf2-deficient B cell retention.

To functionally test if Klf2-deficient FO B cells were in the MZ, and thus in direct contact with blood-borne molecules, splenic B cell compartments were examined following a 30-minute exposure to intravenously injected trinitrophenol (TNP) coupled Ficoll. Flow cytometric analysis showed that in control mice, MZ B cells preferentially bound the hapten-carrier conjugate, whereas both FO and MZ B cells quickly bound TNP-Ficoll in genetically targeted animals (Figure 4D). Therefore, we conclude that Klf2-deficient B cell migration was modified within the spleen, allowing FO B cell encroachment into the MZ and access to MZ-associated antigens.

Klf2 is not required for ex vivo humoral immune responses

Such unusual B cell trafficking patterns raised the possibility that humoral immunity was compromised in Klf2fl/fl; Cd19-Cre+/− mice. To address this issue, we first needed to determine if cell-intrinsic effector functions were intact in Klf2-deficient B cells. Neither FO B cells nor MZ B cells harvested from genetically targeted mice displayed variations in activation markers (Figure S4A), suggesting B cell quiescence was not disrupted. No significant differences in cell cycling were detected when MZ and FO B cells were stimulated using various regimens (Figure S4B). Moreover, titration curves of BCR-stimulation demonstrated that Klf2+ and Klf2-deficient B cells had identical activation thresholds (Figure S4C). In terms of ex vivo immunoglobulin (Ig) isotype production, both control and Klf2-deficient B cells responded to the TD antigen, ovalbumin peptide, by class switching to IgG1 in a T cell-dependent manner (Figure S5A). Likewise, type 1 TI (TI-1) antigenic responses, induced either by LPS + IL4 or LPS alone, promoted class switching to IgG1 or IgG3 in both cell populations (Figure S5B). Klf2-deficient B cells also responded normally when stimulated under type 2 (TI-2) antigenic conditions (Figure S5C) by preferentially class switching to the IgG3 isotype. Enzyme-linked immunosorbent assay (ELISA) measurements of Ig production further confirmed that control and Klf2-deficient B cells responded similarly to TI and TD ex vivo stimulation (Figure S5D). These results led us to conclude that Klf2-deficient B cells had normal cell-intrinsic effector functions.

Enhanced in vivo responses to TI-2 antigens in genetically targeted mice

Having established that cell-intrinsic effector functions were intact, experiments were conducted to determine if Klf2-deficient B cell trafficking patterns affected in vivo humoral responses. Total Ig levels were normal; however, sera IgM was significantly increased in genetically targeted animals (Figure 5A), which may reflect increased Klf2-deficient splenic B cells numbers. As well, genetically targeted mice had decreased amounts of serum IgA, an Ig isotype that is primarily produced by B1 B cells under disease-free conditions (Kaminski and Stavnezer, 2006; Kroese et al., 1989; Kunisawa et al., 2007; Macpherson et al., 2000). Genetically targeted animals had very few B1 B cells in the peritoneal cavity (Figure S6A and B), which probably contributed to reduced amounts of serum IgA. Mechanisms responsible for this B1 B cell defect are currently being investigated. In this regard, limited numbers of B1 B cells were found in the blood and spleen of genetically targeted mice (Figure S6C) and Klf2-deficient B1 B cells could be generated from bone marrow precursors using defined ex vivo techniques (Montecino-Rodriguez and Dorshkind, 2006; Montecino-Rodriguez et al., 2006) (Figure S6D), suggesting that the defect was migratory in nature. Cxcl13−/− mice exhibit a similar defect in peritoneal B1 B cells (Ansel et al., 2002), raising the possibility that this lineage is particularly sensitive to trafficking defects. Importantly, all other Ig isotypes were maintained at normal levels, indicating that Klf2-deficient B cells did not undergo excessive antigen-independent in vivo class switching.

Figure 5.

Figure 5

Open in a new tab

Klf2-deficient B cells exhibit enhanced in vivo TI-2 immune responses. Serum immunoglobulin (Ig) levels from Klf2+/+; Cd19-Cre+/− (control) and Klf2fl/fl; Cd19-Cre+/− (genetically targeted=cKO) mice were measured by ELISA. Circles are individual Ig levels per mouse, lines are the mean value for each data set (N=5 per group of mice unless stated otherwise). Data are graphed as a function of optical density (OD 405nm). P values are shown for each Ig isotype. (A) Sera from unimmunized mice were measured for basal levels of Ig isotypes. N=9 mice per group. (B) Mice were challenged with TNP-OVA to determine TD antigenic responses. Two weeks post-injection, Ig isotype levels were measured. Similar results were achieved when this experiment was repeated using the TD antigen, TNP-KLH. (C) TI-1 antigenic responses were examined following a one week challenge with TNP-LPS. This experiment was repeated twice. (D) TI-2 antigenic responses were measured using TNP-Ficoll. One week post-challenge, the various Ig isotype levels were measured. This experiment was repeated four times.

The presence of Klf2-deficient FO B cells within the MZ raised the possibility that TD antigen responses were compromised in genetically targeted mice. However, when animals were challenged with ovalbumin peptide coupled to TNP, similar amounts of total TNP-specific Ig were detected (Figure 5B). Likewise, the preferential Ig isotype utilized during a TD immune response, IgG1, was comparable between control and genetically targeted animals. Statistical differences in IgM and IgA levels were observed, which mirrored the previously noted differences in basal serum antibody concentrations. Thus aberrant Klf2-deficient B cell migration did not adversely affect B-T cell interactions or TD immune reactions.

Since Klf2-deficient MZ B cells exhibited a limited migratory defect, we wanted to determine if this affected TI immune responses in vivo. No differences were detected when mice were challenged with TNP-LPS (Figure 5C), indicating that aberrant Klf2-deficient B cell migration did not inhibit TI-1 antigenic reactions. With regards to TI-2 antigen, mice were challenged with TNP-Ficoll that preferentially activates MZ B cells and induces isotype class switching to IgG3 and to a lesser extent, IgG2a (Guinamard et al., 2000; Oliver et al., 1997). Klf2fl/fl; Cd19-Cre+/− mice responded more robustly to TNP-Ficoll than control littermates, as measured by total TNP-specific Ig levels (Figure 5D). ELISPOT experiments indicated that elevated antibody concentrations were due to increased frequencies of responding B cells (control=58±12 spot forming cells/106 splenocytes, genetically targeted mice=106±21 spot forming cells/106 splenocytes, P=0.004) rather than more Ig production per cell (control=11±2 ×103 mm2, genetically targeted mice=10±1 ×103 mm2 mean spot size, P=0.19). Increased Ig levels resulted from enhanced production of IgM and unexpectedly, IgG1. Both FO and MZ B cells produce IgM during an immune response, however IgG1 is typically restricted to Th cell-mediated reactions. TNP-specific IgG2a and IgG3 levels were comparable between control and genetically targeted mice, indicating that Klf2-deficient MZ B cell responses were intact. Therefore, we conclude that Klf2-deficient B cells had an enhanced ability to respond to TI-2 antigens in vivo, which included class switching to an isotype profile associated with Th cell activity.

Klf2-deficient FO B cells are responsible for gain-of-function phenotypes

Subsequent studies were conducted to identify the B cell compartment responsible for this unique humoral immune response. Enhanced TI-2 reactions were not due to aberrant in vivo proliferation (Figure S7A) or survival (Figure S7B) of either Klf2-deficient B cell lineage, and instead suggested that lineage-specific migration defects contributed to this phenotype. For instance, Klf2-deficient MZ B cells had increased access to B cell follicles, which may have enhanced their antigen-presenting capabilities. Alternatively, MZ-associated Klf2-deficient FO B cells may have reacted to TNP-Ficoll in a T cell-dependent manner. To test this model, in vivo TI-2 reactions were analyzed using intact or T cell-depleted genetically targeted mice. (Percentages of T cell populations in the blood of Klf2fl/fl; CD19-Cre+/− animals were reduced from 41±6 (CD4+) and 22±2 (CD8+) to 0.06±0.04 (CD4+) and 0.01±0.02 (CD8+) following CD90.2 antibody treatment). T cell-depletion significantly reduced Klf2-deficient B cell responses (Figure 6A). Likewise, FTY720 treatment significantly decreased TNP-specific Ig production in genetically targeted mice. We attribute this reduction in Ig production to Klf2-deficient B cell exclusion from the MZ since this drug did not negatively affect ex vivo B cell activation or proliferation (Figure S7C). Therefore, these experiments show that enhanced Klf2-deficient B cell responses towards TI-2 antigen were both T cell-dependent and required access to the MZ, consistent with the phenotypes observed in the FO B cell lineage.

Figure 6.

Figure 6

Open in a new tab

Characterization of enhanced Klf2-deficient B cell responses towards TI-2 antigen. (A) Serum Ig levels from Klf2fl/fl; Cd19-Cre+/− (genetically targeted=cKO) (black), T cell-depleted cKO (red), and FTY720-treated cKO (blue) mice challenged with TNP-Ficoll. This experiment was repeated twice. (B) Germinal center formation in the draining lymph nodes of TNP-Ficoll challenged mice. Mesenteric lymph nodes from control, cKO, T cell-depleted cKO, and FTY720-treated cKO mice were analyzed for germinal center surface markers (GL7+ and CD95+) one week after challenge. Percentage of B220+AA4.1−GL7+CD95+ B cells are shown. This experiment was performed twice in triplicate; representative figures are shown. (C) Humoral responses were measured in day 12 neonates challenged with TNP-Ficoll. The left panels show the relative abundance of MZ B cells (triangles) in control and cKO mice at the time of analysis (day 19). This figure is representative of 6 neonatal spleens, 3 per group. The right bar graph displays the amount of TNP-specific IgM from control and cKO mouse sera. (D) Germinal center formation was examined in day 19 neonates after a 7-day challenge with TNP-Ficoll. Mesenteric lymph nodes were examined for the germinal center surface markers, GL7 and CD95 (percentages shown). Absolute germinal center B cell (B220+AA4.1−GL7+CD95+) numbers are shown in the right bar graph. N=3 per group.

Follicular B cells participate in germinal center (GC) formation during T cell-dependent humoral immune responses. To assess if this occurred in genetically targeted mice challenged with TI-2 antigen, GC formation in draining lymph nodes was examined one week after TNP-Ficoll challenge (Figure 6B). Control mice did not generate noticeable GCs, consistent with a MZ B cell-dominated humoral response towards TI-2 antigens. In contrast, B lymphocytes from genetically targeted animals stained positively for GC markers. Immunohistochemistry confirmed that 7 days after TNP-Ficoll challenge, clusters of proliferating cells could be identified within the follicles of genetically targeted mice (Figure S7D). GC B cells were located interior to the MZ, adjacent to the T cell-rich periarteriolar lymphoid sheath (PALS) (Figure S7E), suggesting that GC formation was anatomically correct in Klf2fl/fl; Cd19-Cre+/− mice. T cell-depleted genetically targeted animals challenged with TNP-Ficoll did not produce GCs (Figure 6B), confirming this process was T cell-dependent. To ensure that Klf2 excision within the B cell compartment did not indirectly affect T cell-intrinsic effector functions, we examined various elements of T cell homeostasis in genetically targeted animals. Normal proportions of CD4+ and CD8+ T cells were found in secondary lymphoid organs (Figure S7F) and splenic T cells correctly homed to PALS in Klf2fl/fl; Cd19-Cre+/− mice (Figure S7G). Relative proportions of regulatory T cells were also intact (Figure S7H), indicating that B cell-specific Klf2-deficiency did not confer an overt hyperresponsive phenotype to the T cell compartment. Instead, GC formation was dependent upon B cell trafficking, as evidenced by the absence of GC B cells in FTY720-treated animals challenged with TNP-Ficoll (Figure 6B). These traits – a requirement for T cell interactions and access to the MZ to generate GCs following TNP-Ficoll challenge – were most consistent with a homing defect in Klf2-deficient FO B cells.

To directly test whether FO B cells underpin the gain-of-function phenotype in genetically targeted mice, TI-2 reactivity was examined in the absence of MZ B cells. Humoral responses were examined in 12 day-old neonates since it takes approximately 3–4 weeks for MZ B cells to populate the spleen (Martin and Kearney, 2002; Pillai et al., 2005). Following a one-week exposure to TNP-Ficoll, both control and genetically targeted mice had very few MZ B cells present in the spleen (Figure 6C); nevertheless, Klf2-deficient FO B cells still displayed significantly enhanced TNP-specific humoral responses. It should be noted that robust class switching did not occur at this early time point in either control or genetically targeted mice (data not shown), which may have reflected the still-developing architecture of the spleen (Pihlgren et al., 2003). However, GC formation was more pronounced in genetically targeted neonates (Figure 6D), suggestive of imminent class switching. To prove that Klf2-deficient FO B cells directly interacted with T cells during a TI-2 antigenic response, we co-transferred Klf2+ and Klf2-deficient FO B cells into adult C57Bl/6 recipient mice and challenged them with TNP-Ficoll 24 hours later. Klf2+ FO B cells did not form T cell conjugates, either spontaneously or after antigen challenge, whereas Klf2-deficient FO B cells formed CD4+ T cell conjugates in a TNP-Ficoll responsive manner (Figure S7I). These data demonstrate that subsequent to TNP-Ficoll exposure in the MZ, Klf2-deficient FO B cells are able to interact with CD4+ T cells in the spleen. Thus a mechanistic link can be made between the homing properties of Klf2-deficient FO B cell and the ability of Klf2fl/fl; Cd19-Cre+/− mice to respond to TI-2 antigens in a TD manner.

Klf2-deficient FO B cells respond to MZ-associated pathogens

The biological importance of this phenotype was examined by challenging genetically targeted mice with Borrelia burgdorferi, an infectious spirochete bacterium responsible for Lyme disease in humans (Barbour and Hayes, 1986; Steere, 1989). Mouse studies have revealed that MZ B cells play a critical role in the initial humoral response to this pathogen (Belperron et al., 2007; McKisic and Barthold, 2000). Seven days post-infection, genetically targeted mice displayed enhanced clearance of B. burgdorferi relative to littermate controls (Figure 7A). Analysis of B. burgdorferi-specific antibody showed increased amounts of IgG1 in experimental sera whereas IgG2a and IgG3 concentrations were comparable between control and genetically targeted mice (Figure 7B). IgA levels were decreased in Klf2fl/fl; Cd19-Cre+/− mice, which we attributed to a lack of B1 B cells. To demonstrate that this gain-of-function was due to increased Klf2-deficient FO B cell recognition of the pathogen, infected splenic B cells from control and genetically targeted animals were incubated ex vivo with B. burgdorferi lysate, then stained with Borrelia-specific antibody (Figure 7C). Both Klf2+ and Klf2-deficient MZ B cells displayed equivalent staining patterns. In contrast, Klf2-deficient FO B cells had an increased frequency of pathogen recognition relative to Klf2+ FO B cells, indicative of privileged access to MZ-associated pathogens. Moreover, analysis of draining lymph nodes from infected animals revealed that genetically targeted mice produced more GC B cells than littermate controls (Figure 7D), suggesting that enhanced pathogen clearance utilized a T cell-dependent mechanism. These results confirmed that in the absence of Klf2, FO B cells have enhanced responsiveness towards MZ-associated pathogens.

Figure 7.

Figure 7

Open in a new tab

Genetically targeted mice have enhanced responsiveness against Borrelia burgdorferi. (A) Bacterial titers in the bladders of Klf2+/+; Cd19-Cre+/− (control) and Klf2fl/fl; Cd19-Cre+/− (cKO=genetically targeted) mice were measured by real-time PCR one week after B. burgdorferi infection. For comparison purposes, the relative pathogen burden was set as 1.0 for the control mice. N=3 mice per group. Similar results were obtained when this experiment was repeated. Error bars are standard deviation. (B) ELISA measurements of Borrelia-specific antibody from the sera of infected control and cKO animals. N=5 mice per group. P>0.05 except where stated. This experiment was repeated once, yielding similar results. Error bars indicate standard deviation. (C) Ex vivo B cell recognition of B. burgdorferi was examined using MZ and FO B cells from the spleens of infected animals. Following a brief incubation with B. burgdorferi lysate, Klf2+ and Klf2-deficient B cells were examined by flow cytometry using anti-B. burgdorferi antibody. Quadrants show the relative frequency of Borrelia-binding B cells. These contour blots are representative of 8 mice, 4 per group. (D) Analysis of germinal center formation in draining lymph nodes of infected control and cKO animals. Germinal center B cells (CD19+AA4.1−GL7+CD95+) are outlined with corresponding frequencies. These figures are representative of 8 mice, 4 per group. This experiment was repeated twice.

Discussion

Klf2 is involved in numerous biological processes including vascular development (Kuo et al., 1997a; Lee et al., 2006; Wani et al., 1998), primitive erythropoiesis (Basu et al., 2007), monocyte activation (Das et al., 2006), and T cell homeostasis (Bai et al., 2007; Carlson et al., 2006; Kuo et al., 1997b; Sebzda et al., 2008). Robust expression of this transcription factor in B lymphocytes has suggested a critical role for Klf2 in B cells as well, however, genetic evidence has been lacking. Here we report Klf2 excision in the B cell compartment leads to defects in homeostasis, cellular trafficking, and humoral immunity. Together, this work furthers our knowledge of chemokine receptor regulation and reveals how B cell migration imposes constraints on pathogen recognition.

Although Klf2 expression is first detected in pre-B cells, it does not appear to be required for early B cell development. Instead, Klf2-deficient B cell phenotypes are consistent with a late-stage defect in retention and recirculation to the bone marrow. Moreover, mature splenic B cell lineages are expanded in genetically targeted mice. Increased Klf2-deficient MZ B cell numbers may result from selective pressure to maintain normal serum antibody levels (Lopes-Carvalho and Kearney, 2004). Severely reduced B1 B cell numbers and the accompanying reduction in natural Abs produced by this lineage (Ansel et al., 2002; Hayakawa et al., 1984) may stimulate additional MZ B cell generation. Alternatively, premature egress from the bone marrow may disproportionately induce a surge in MZ B cell generation (Martin and Kearney, 2002). Unlike MZ B cells, FO B cells circulate throughout secondary lymphoid organs. Despite this, increased FO B cell numbers are limited to the spleen, suggesting tissue-restricted factors normally utilized by Klf2+ MZ B cells are involved in Klf2-deficient FO B cell retention.

Klf2 excision results in differential regulation of homing receptors in closely related lymphocyte lineages. However, Klf2-deficient MZ B cells still responded ex vivo to S1P and in vivo to FTY720, indicating that these cells retain some functional S1P-sensitive homing receptors. Klf2-deficient MZ B cells also express less CXCR5, a chemokine receptor used to shuttle activated MZ B cells into follicles (Cinamon et al., 2008), which may partially negate the effects of decreased S1P1 expression. With regard to FO B cells, a considerable number of Klf2-deficient cells are able to remain within the MZ, possibly due to increased expression of S1P1 and enhanced integrin activation. At the same time, increased CXCR5 levels on Klf2-deficient FO B cells probably allows these cells to eventually recirculate. Therefore, we conclude that dysregulated expression of migratory receptors disrupts the well-defined anatomical separation of MZ and FO B cells in Klf2fl/fl; Cd19-Cre+/− mice.

Hypothetically, merging B cell populations might have impaired humoral activities. Instead, in vivo TI-2 antigenic responses were enhanced in genetically targeted mice. This was not simply a reflection of increased splenic B cell numbers since TI-1 antigenic reactions were unaffected. With regards to TI-2 antigenic reactivity, Klf2-deficient FO B cells were likely causal, as evidenced by: 1) in vivo gain-of-function phenotypes including recognition of MZ-associated antigens; 2) enhanced responsiveness was T cell-dependent and required B cell access to MZs; 3) these events were associated with GC formation, and; 4) GC formation and increased production of TI-2-specific Ig occurred in genetically targeted neonates that lacked MZ B cells. These experiments also suggest that unlike MZ B cells, FO B cells are “hardwired” to require TH signals during a TI-2 response, regardless of anatomical location.

Klf2 excision results in increased surface expression of CD21 on MZ and FO B cells. Since this molecule acts as a coreceptor that can potently lower activation thresholds (Fearon and Carroll, 2000), there is the formal possibility that CD21 contributes to some of the gain-of-function phenotypes seen in genetically targeted mice. However, multiple independent assays indicate that cell-intrinsic properties (excluding homing receptor expression) are normal in Klf2-deficient B cells, including proliferation, isotype class switching, and immunoglobulin production. Moreover, gain-of-function phenotypes are restricted to TI-2 antigens, confined to the FO B cell lineage, and depend upon anatomical location. All of these attributes are best described in terms of aberrant migration patterns exhibited by Klf2-deficient FO B cells.

Klf2fl/fl; Cd19-Cre+/− mice clear B. burgdorferi more efficiently than control littermates, demonstrating the physiological advantage of allowing FO B cell access to the MZ. Since blood-borne bacteria are widely prevalent and in some cases life-threatening, why are Klf2+ FO B cells removed from MZs? FO B cell retention within the MZ may increase the risk of T cell-mediated autoimmunity. Autoreactive BCR-transgenic B cells have been shown to quickly (2–3 days) prime self-reactive T cells following in vivo antigen challenge (Yan et al., 2006), suggesting a role for MZ B cells in breaking peripheral tolerance to blood-borne particles. In this regard, the BCR repertoire of MZ B cells is limited relative to FO B cells (Carey et al., 2008; Dammers et al., 2000). Therefore, it is possible that FO B cell trafficking into the MZ is restricted to reduce self-antigen recognition and autoreactive T cell induction. Since B cell malignancy and autoreactivity are associated with the MZ (Ferreri and Zucca, 2007; Lopes-Carvalho and Kearney, 2005; Viau and Zouali, 2005), studies examining B cell retention within this compartment may offer new clinical insights. This is especially relevant in light of the gain-of-function phenotypes exhibited by MZ-associated FO B cells in genetically targeted animals.

Experimental Procedures

Mice

Klf2fl/fl; Cd19Cre+/− mice were generated by mating Klf2fl/fl mice (Lee et al., 2006) with Cd19-Cre+ mice (The Jackson Laboratory). OTII transgenic mice were obtained from Taconic. Mice were housed in pathogen-free conditions at Vanderbilt University Medical Center according to National Institute of Health guidelines.

Flow cytometry

B cell populations were identified as previously described (Hoek et al., 2009). Additional antibodies used to characterize B cell populations include: CD1d, CD9, CD25, CD44, CD45RB, CD62L, CD69, CD80, CD86, CD95, GL7, α4+β7 integrin, CXCR4, CXCR5 (BD Biosciences) and CCR7 (eBioscience). Intracellular Klf2 was measured using polyclonal rabbit anti-Klf2 (Schuh et al., 2008). Data was acquired on a 5-laser BD Bioscences Life Science Research II flow cytometer, and analyzed using FlowJo software package (TreeStar).

Real-time PCR

RNA was extracted from sorted B cells using an RNeasy Micro Kit (Qiagen). cDNA was generated using a SuperScript VILO cDNA synthesis kit (Invitrogen) and real-time reactions were performed in triplicate using SYBR Green master mix (Applied Biosystems). Data was acquired on an iCycler iQ Real-time PCR Detection System (BioRad). Primers used (forward + reverse): Klf2: CACCAACTGCGGCAAGACCTAC + TCTGTGACCTGTGTGCTTTCGG CXCR4: AGCTAAGGAGCATGACGGACAAGT + AACGTGCTGTAGAGGTTGACAGT CXCR5: AAGCGGAAACTAGAGCCTGGTTCA + ACCATCCCATCACAAGCATCGGTA CCR7: CCAGACCGTGGCAATTTCAACAT + ACAAGAAAGGGTTGACACAGCAGC S1P1: GTGTAGACCCAGAGTCCTGCG + AGCTTTTCCTTGGCTGGAGAG Data is expressed as: 2^[(CT for Klf2-deficient experimental gene – CT for Klf2-deficient Gapdh) – (CT for control experimental gene – CT for control Gapdh)]. Burden levels of B. burgdorferi were measured in a similar manner, using the bacterial recA gene and the eukaryotic tubulin gene.

ChIP assay

MZ and FO B cells (6×106) were sorted from C57Bl/6 mice, and chromatin immunoprecipitation (ChIP) assays were performed using the EZ-ChIP kit (Millipore) according to the manufacturer’s protocol. Immunoprecipitations were performed using anti-Klf2 (Santa Cruz) or rabbit IgG control antibody. The following primer sets amplified DNA from Klf2 pulldowns: CXCR5 5′: GCTTGCCTCTCGACTCATCT, CXCR5 3′: GCACTGAAATGCTTGCGTAG, S1P1 5′: TGAAGAGGCCTTGGTCAGAT, and S1P1 3′: TTGAAACTGCACAGCAGAGG.

Immunofluorescent microscopy

Spleen sections were prepared and analyzed as previously described (Acevedo-Suarez et al., 2005). B cells were identified using B220, IgD, and IgM antibodies (BD Biosciences) and MZ was delineated using MOMA1 antibody (Cedar Lane Labs).

In vitro migration assays

Migration assays were conducted as previous described (Sebzda et al., 2008). Input and migrated cells were identified using IgM, CD21, CD23, AA4.1, and CD19 antibodies. % migration = 100% × ((experimental number − background number)/total input).

In vitro adhesion assay

Splenocytes from control or genetically targeted mice were placed in ICAM1-coated 6-well plates (107/well) and allowed to settle at 37°C for 90 minutes. Wells were filled, sealed, inverted and left at room temperature for 30 minutes. Media was removed, wells rinsed, and remaining cells analyzed by flow cytometry. Alternatively, splenocytes from genetically targeted mice were pre-treated with pertussis toxin (20ng/ml; Sigma) for 1 hour at 37°C. % adhesion = 100% × (ICAM1-coated well − uncoated well)/total input. Wells were performed in triplicate.

Immunizations

For TI immune responses, mice were immunized intraperitoneally (i.p.) with 1 mg/kg TNP-LPS or 10 μg/kg TNP-Ficoll in 100 μl PBS, and bled 7 days post-immunization to measure primary immune responses. In some experiments, mice were treated with FTY720 (Cayman Chemical Company; 2 μg/ml in drinking water), or anti-CD90.2 (BioLegend; 2 doses, 250 μg i.p. on consecutive days) prior to immunization. For TD immune responses, mice were immunized i.p. with 10 mg/kg TNP-Ovalbumin (TNP-Ova) in Alum (1:1, Alum:PBS; 100 μl per mouse) and bled 14 days post-immunization. For B. burgdorferi, mice were intra-dermally inoculated with 1×104 spirochetes from a low-passage clinical isolate and bled 7 days post-immunization to measure primary immune responses.

ELISA

ELISA was performed as previously described (Hoek et al., 2009). For B. burgdorferi-specific ELISA, plates were coated with B. burgdorferi lysate (3 μg in 50μL of 100% ethanol per well), and serum was diluted 1:25–1:1000.

ELISPOT

Millipore Immobilon-P 96 well plates were coated with 10μg/ml TNP-BSA, blocked with 10% FCS, and total splenocytes (1×106 cells per well) from mice immunized for 7 days with TNP-Ficoll were cultured in the absence of additional stimulation. Cells were removed, and bound TNP-specific Ig was quantified using horseradish peroxidase-conjugated goat anti-mouse Ig.

Statistical analysis

Data were analyzed using a two-tailed Student’s T test. Values P ≤ 0.05 were considered statistically significant.

Supplementary Material

01

Acknowledgments

We thank F. Gherardini and E. P. Skaar for supplying B. burgdorferi stocks, H.M. Jäck for supplying rabbit polyclonal Klf2 antibody, and J. Hawiger, M. Boothby, and D. Ballard for helpful comments. The VMC Immunohistochemistry Core Laboratory and the VMC SDRC Molecular Genetics Core provided technical assistance. Flow cytometry and cell sorting was performed in the VMC Flow Cytometry Shared Resource. This research was supported by a postdoctoral fellowship from the National Multiple Sclerosis Society (V.V.P.), NIH training grant HL069765 (L.E.G.), NIH grant AI44924 (T.M.A.), NIH grant AI042284 and AI061721 (S.J.), NIH grant AI051448 (J.W.T), NIH grant HL089667 (L.V.K.), and NIH grant HL094773 and an Edward Mallinckrodt, Jr. Foundation award (E.S.)

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Acevedo-Suarez CA, Hulbert C, Woodward EJ, Thomas JW. Uncoupling of anergy from developmental arrest in anti-insulin B cells supports the development of autoimmune diabetes. J Immunol. 2005;174:827–833. doi: 10.4049/jimmunol.174.2.827. [DOI] [PubMed] [Google Scholar]
  2. Allman D, Pillai S. Peripheral B cell subsets. Curr Opin Immunol. 2008;20:149–157. doi: 10.1016/j.coi.2008.03.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anderson KP, Kern CB, Crable SC, Lingrel JB. Isolation of a gene encoding a functional zinc finger protein homologous to erythroid Kruppel-like factor: identification of a new multigene family. Mol Cell Biol. 1995;15:5957–5965. doi: 10.1128/mcb.15.11.5957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ansel KM, Harris RB, Cyster JG. CXCL13 is required for B1 cell homing, natural antibody production, and body cavity immunity. Immunity. 2002;16:67–76. doi: 10.1016/s1074-7613(01)00257-6. [DOI] [PubMed] [Google Scholar]
  5. Bai A, Hu H, Yeung M, Chen J. Kruppel-like factor 2 controls T cell trafficking by activating L-selectin (CD62L) and sphingosine-1-phosphate receptor 1 transcription. J Immunol. 2007;178:7632–7639. doi: 10.4049/jimmunol.178.12.7632. [DOI] [PubMed] [Google Scholar]
  6. Barbour AG, Hayes SF. Biology of Borrelia species. Microbiol Rev. 1986;50:381–400. doi: 10.1128/mr.50.4.381-400.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Basu P, Lung TK, Lemsaddek W, Sargent TG, Williams DC, Jr, Basu M, Redmond LC, Lingrel JB, Haar JL, Lloyd JA. EKLF and KLF2 have compensatory roles in embryonic beta-globin gene expression and primitive erythropoiesis. Blood. 2007;110:3417–3425. doi: 10.1182/blood-2006-11-057307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Belperron AA, Dailey CM, Booth CJ, Bockenstedt LK. Marginal zone B-cell depletion impairs murine host defense against Borrelia burgdorferi infection. Infect Immun. 2007;75:3354–3360. doi: 10.1128/IAI.00422-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bhattacharya D, Cheah MT, Franco CB, Hosen N, Pin CL, Sha WC, Weissman IL. Transcriptional profiling of antigen-dependent murine B cell differentiation and memory formation. J Immunol. 2007;179:6808–6819. doi: 10.4049/jimmunol.179.10.6808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Buckley AF, Kuo CT, Leiden JM. Transcription factor LKLF is sufficient to program T cell quiescence via a c-Myc--dependent pathway. Nat Immunol. 2001;2:698–704. doi: 10.1038/90633. [DOI] [PubMed] [Google Scholar]
  11. Carey JB, Moffatt-Blue CS, Watson LC, Gavin AL, Feeney AJ. Repertoire-based selection into the marginal zone compartment during B cell development. J Exp Med. 2008;205:2043–2052. doi: 10.1084/jem.20080559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cariappa A, Boboila C, Moran ST, Liu H, Shi HN, Pillai S. The recirculating B cell pool contains two functionally distinct, long-lived, posttransitional, follicular B cell populations. J Immunol. 2007;179:2270–2281. doi: 10.4049/jimmunol.179.4.2270. [DOI] [PubMed] [Google Scholar]
  13. Carlson CM, Endrizzi BT, Wu J, Ding X, Weinreich MA, Walsh ER, Wani MA, Lingrel JB, Hogquist KA, Jameson SC. Kruppel-like factor 2 regulates thymocyte and T-cell migration. Nature. 2006;442:299–302. doi: 10.1038/nature04882. [DOI] [PubMed] [Google Scholar]
  14. Chiba K, Matsuyuki H, Maeda Y, Sugahara K. Role of sphingosine 1-phosphate receptor type 1 in lymphocyte egress from secondary lymphoid tissues and thymus. Cell Mol Immunol. 2006;3:11–19. [PubMed] [Google Scholar]
  15. Cinamon G, Zachariah MA, Lam OM, Foss FW, Jr, Cyster JG. Follicular shuttling of marginal zone B cells facilitates antigen transport. Nat Immunol. 2008;9:54–62. doi: 10.1038/ni1542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dammers PM, Visser A, Popa ER, Nieuwenhuis P, Kroese FG. Most marginal zone B cells in rat express germline encoded Ig VH genes and are ligand selected. J Immunol. 2000;165:6156–6169. doi: 10.4049/jimmunol.165.11.6156. [DOI] [PubMed] [Google Scholar]
  17. Das H, Kumar A, Lin Z, Patino WD, Hwang PM, Feinberg MW, Majumder PK, Jain MK. Kruppel-like factor 2 (KLF2) regulates proinflammatory activation of monocytes. Proc Natl Acad Sci U S A. 2006;103:6653–6658. doi: 10.1073/pnas.0508235103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Fagarasan S, Watanabe N, Honjo T. Generation, expansion, migration and activation of mouse B1 cells. Immunol Rev. 2000;176:205–215. doi: 10.1034/j.1600-065x.2000.00604.x. [DOI] [PubMed] [Google Scholar]
  19. Fearon DT, Carroll MC. Regulation of B lymphocyte responses to foreign and self-antigens by the CD19/CD21 complex. Annu Rev Immunol. 2000;18:393–422. doi: 10.1146/annurev.immunol.18.1.393. [DOI] [PubMed] [Google Scholar]
  20. Ferreri AJ, Zucca E. Marginal-zone lymphoma. Crit Rev Oncol Hematol. 2007;63:245–256. doi: 10.1016/j.critrevonc.2007.04.009. [DOI] [PubMed] [Google Scholar]
  21. Fruman DA, Ferl GZ, An SS, Donahue AC, Satterthwaite AB, Witte ON. Phosphoinositide 3-kinase and Bruton’s tyrosine kinase regulate overlapping sets of genes in B lymphocytes. Proc Natl Acad Sci U S A. 2002;99:359–364. doi: 10.1073/pnas.012605099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Glynne R, Ghandour G, Rayner J, Mack DH, Goodnow CC. B-lymphocyte quiescence, tolerance and activation as viewed by global gene expression profiling on microarrays. Immunol Rev. 2000;176:216–246. doi: 10.1034/j.1600-065x.2000.00614.x. [DOI] [PubMed] [Google Scholar]
  23. Guinamard R, Okigaki M, Schlessinger J, Ravetch JV. Absence of marginal zone B cells in Pyk-2-deficient mice defines their role in the humoral response. Nat Immunol. 2000;1:31–36. doi: 10.1038/76882. [DOI] [PubMed] [Google Scholar]
  24. Hayakawa K, Hardy RR, Honda M, Herzenberg LA, Steinberg AD. Ly-1 B cells: functionally distinct lymphocytes that secrete IgM autoantibodies. Proc Natl Acad Sci U S A. 1984;81:2494–2498. doi: 10.1073/pnas.81.8.2494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hoek KL, Carlesso G, Clark ES, Khan WN. Absence of mature peripheral B cell populations in mice with concomitant defects in B cell receptor and BAFF-R signaling. J Immunol. 2009;183:5630–5643. doi: 10.4049/jimmunol.0901100. [DOI] [PubMed] [Google Scholar]
  26. Kaminski DA, Stavnezer J. Enhanced IgA class switching in marginal zone and B1 B cells relative to follicular/B2 B cells. J Immunol. 2006;177:6025–6029. doi: 10.4049/jimmunol.177.9.6025. [DOI] [PubMed] [Google Scholar]
  27. Kinashi T. Intracellular signalling controlling integrin activation in lymphocytes. 2005;5:546–559. doi: 10.1038/nri1646. [DOI] [PubMed] [Google Scholar]
  28. Kroese FG, Butcher EC, Stall AM, Lalor PA, Adams S, Herzenberg LA. Many of the IgA producing plasma cells in murine gut are derived from self-replenishing precursors in the peritoneal cavity. Int Immunol. 1989;1:75–84. doi: 10.1093/intimm/1.1.75. [DOI] [PubMed] [Google Scholar]
  29. Kunisawa J, Kurashima Y, Gohda M, Higuchi M, Ishikawa I, Miura F, Ogahara I, Kiyono H. Sphingosine 1-phosphate regulates peritoneal B-cell trafficking for subsequent intestinal IgA production. Blood. 2007;109:3749–3756. doi: 10.1182/blood-2006-08-041582. [DOI] [PubMed] [Google Scholar]
  30. Kuo CT, Veselits ML, Barton KP, Lu MM, Clendenin C, Leiden JM. The LKLF transcription factor is required for normal tunica media formation and blood vessel stabilization during murine embryogenesis. Genes Dev. 1997a;11:2996–3006. doi: 10.1101/gad.11.22.2996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kuo CT, Veselits ML, Leiden JM. LKLF: A transcriptional regulator of single-positive T cell quiescence and survival. Science. 1997b;277:1986–1990. doi: 10.1126/science.277.5334.1986. [DOI] [PubMed] [Google Scholar]
  32. Lee JS, Yu Q, Shin JT, Sebzda E, Bertozzi C, Chen M, Mericko P, Stadtfeld M, Zhou D, Cheng L, et al. Klf2 is an essential regulator of vascular hemodynamic forces in vivo. Dev Cell. 2006;11:845–857. doi: 10.1016/j.devcel.2006.09.006. [DOI] [PubMed] [Google Scholar]
  33. Lopes-Carvalho T, Kearney JF. Development and selection of marginal zone B cells. Immunol Rev. 2004;197:192–205. doi: 10.1111/j.0105-2896.2004.0112.x. [DOI] [PubMed] [Google Scholar]
  34. Lopes-Carvalho T, Kearney JF. Marginal zone B cell physiology and disease. Curr Dir Autoimmun. 2005;8:91–123. doi: 10.1159/000082100. [DOI] [PubMed] [Google Scholar]
  35. Macpherson AJ, Gatto D, Sainsbury E, Harriman GR, Hengartner H, Zinkernagel RM. A primitive T cell-independent mechanism of intestinal mucosal IgA responses to commensal bacteria. Science. 2000;288:2222–2226. doi: 10.1126/science.288.5474.2222. [DOI] [PubMed] [Google Scholar]
  36. Martin F, Kearney JF. Marginal-zone B cells. Nat Rev Immunol. 2002;2:323–335. doi: 10.1038/nri799. [DOI] [PubMed] [Google Scholar]
  37. McKisic MD, Barthold SW. T-cell-independent responses to Borrelia burgdorferi are critical for protective immunity and resolution of lyme disease. Infect Immun. 2000;68:5190–5197. doi: 10.1128/iai.68.9.5190-5197.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Montecino-Rodriguez E, Dorshkind K. Stromal cell-dependent growth of B-1 B cell progenitors in the absence of direct contact. Nat Protoc. 2006;1:1140–1144. doi: 10.1038/nprot.2006.163. [DOI] [PubMed] [Google Scholar]
  39. Montecino-Rodriguez E, Leathers H, Dorshkind K. Identification of a B-1 B cell-specified progenitor. Nat Immunol. 2006;7:293–301. doi: 10.1038/ni1301. [DOI] [PubMed] [Google Scholar]
  40. Okada T, Cyster JG. B cell migration and interactions in the early phase of antibody responses. Curr Opin Immunol. 2006;18:278–285. doi: 10.1016/j.coi.2006.02.005. [DOI] [PubMed] [Google Scholar]
  41. Oliver AM, Martin F, Gartland GL, Carter RH, Kearney JF. Marginal zone B cells exhibit unique activation, proliferative and immunoglobulin secretory responses. Eur J Immunol. 1997;27:2366–2374. doi: 10.1002/eji.1830270935. [DOI] [PubMed] [Google Scholar]
  42. Pihlgren M, Tougne C, Bozzotti P, Fulurija A, Duchosal MA, Lambert PH, Siegrist CA. Unresponsiveness to lymphoid-mediated signals at the neonatal follicular dendritic cell precursor level contributes to delayed germinal center induction and limitations of neonatal antibody responses to T-dependent antigens. J Immunol. 2003;170:2824–2832. doi: 10.4049/jimmunol.170.6.2824. [DOI] [PubMed] [Google Scholar]
  43. Pillai S, Cariappa A, Moran ST. Marginal zone B cells. Annu Rev Immunol. 2005;23:161–196. doi: 10.1146/annurev.immunol.23.021704.115728. [DOI] [PubMed] [Google Scholar]
  44. Schuh W, Meister S, Herrmann K, Bradl H, Jack HM. Transcriptome analysis in primary B lymphoid precursors following induction of the pre-B cell receptor. Mol Immunol. 2008;45:362–375. doi: 10.1016/j.molimm.2007.06.154. [DOI] [PubMed] [Google Scholar]
  45. Sebzda E, Zou Z, Lee JS, Wang T, Kahn ML. Transcription factor KLF2 regulates the migration of naive T cells by restricting chemokine receptor expression patterns. Nat Immunol. 2008;9:292–300. doi: 10.1038/ni1565. [DOI] [PubMed] [Google Scholar]
  46. Srivastava B, Quinn WJ, 3rd, Hazard K, Erikson J, Allman D. Characterization of marginal zone B cell precursors. J Exp Med. 2005;202:1225–1234. doi: 10.1084/jem.20051038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Steere AC. Lyme disease. N Engl J Med. 1989;321:586–596. doi: 10.1056/NEJM198908313210906. [DOI] [PubMed] [Google Scholar]
  48. van Ewijk W, van der Kwast TH. Migration of B lymphocytes in lymphoid organs of lethally irradiated, thymocyte-reconstituted mice. Cell Tissue Res. 1980;212:497–508. doi: 10.1007/BF00236513. [DOI] [PubMed] [Google Scholar]
  49. Viau M, Zouali M. B-lymphocytes, innate immunity, and autoimmunity. Clin Immunol. 2005;114:17–26. doi: 10.1016/j.clim.2004.08.019. [DOI] [PubMed] [Google Scholar]
  50. Wani MA, Means RT, Jr, Lingrel JB. Loss of LKLF function results in embryonic lethality in mice. Transgenic Res. 1998;7:229–238. doi: 10.1023/a:1008809809843. [DOI] [PubMed] [Google Scholar]
  51. Yan J, Harvey BP, Gee RJ, Shlomchik MJ, Mamula MJ. B cells drive early T cell autoimmunity in vivo prior to dendritic cell-mediated autoantigen presentation. J Immunol. 2006;177:4481–4487. doi: 10.4049/jimmunol.177.7.4481. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01
NIHMS226567-supplement-01.pdf (6.1MB, pdf)

RESOURCES