Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2010 Jun 18;285(35):26976–26986. doi: 10.1074/jbc.M110.147785

Na/H Exchanger Regulatory Factors Control Parathyroid Hormone Receptor Signaling by Facilitating Differential Activation of Gα Protein Subunits*

Bin Wang ‡, Juan A Ardura ‡, Guillermo Romero ‡, Yanmei Yang ‡, Randy A Hall §, Peter A Friedman ‡,1
PMCID: PMC2930697  PMID: 20562104

Abstract

The Na/H exchanger regulatory factors, NHERF1 and NHERF2, are adapter proteins involved in targeting and assembly of protein complexes. The parathyroid hormone receptor (PTHR) interacts with both NHERF1 and NHERF2. The NHERF proteins toggle PTHR signaling from predominantly activation of adenylyl cyclase in the absence of NHERF to principally stimulation of phospholipase C when the NHERF proteins are expressed. We hypothesized that this signaling switch occurs at the level of the G protein. We measured G protein activation by [35S]GTPγS binding and Gα subtype-specific immunoprecipitation using three different cellular models of PTHR signaling. These studies revealed that PTHR interactions with NHERF1 enhance receptor-mediated stimulation of Gαq but have no effect on stimulation of Gαi or Gαs. In contrast, PTHR associations with NHERF2 enhance receptor-mediated stimulation of both Gαq and Gαi but decrease stimulation of Gαs. Consistent with these functional data, NHERF2 formed cellular complexes with both Gαq and Gαi, whereas NHERF1 was found to interact only with Gαq. These findings demonstrate that NHERF interactions regulate PTHR signaling at the level of G proteins and that NHERF1 and NHERF2 exhibit isotype-specific effects on G protein activation.

Keywords: Adaptor Proteins, Adenylate Cyclase (Adenylyl Cyclase), G Protein-coupled Receptors (GPCR), G Proteins, Phospholipase C, Signal Transduction, NHERF Proteins, PTH receptor

Introduction

The parathyroid hormone receptor (PTHR)2 is a Family B G protein-coupled receptor (GPCR) that regulates extracellular mineral ion homeostasis and bone growth and turnover. Interaction with its cognate ligands, PTH or the PTH-related peptide (PTHrP), stimulates adenylyl cyclase and phosphatidylinositol-specific phospholipase C (PLC) (1, 2). In some cases, occupancy of the PTHR activates only one signaling pathway. For example, in vascular smooth muscle cells, PTH stimulates adenylyl cyclase but not PLC (3, 4), whereas in keratinocytes (5, 6), cardiac myocytes (7, 8), and lymphocytes (9–11), the PTHR activates PLC but not adenylyl cyclase. In osteoblasts and kidney tubule cells, PTH activates both adenylyl cyclase and PLC (12–14). Occupancy of the PTHR activates multiple Gα proteins, and the physiologic responses to PTH may result from contributions of both α and βγ subunits. However, the particular G protein subunit to which the receptor couples varies in a cell-specific manner. Moreover, PTHR stimulation of PLC may arise through activation of Gq (4) or Gi/o (15, 16).

The Na/H exchanger regulatory factor (NHERF) family consists of four related proteins as follows: NHERF1 and NHERF2 that contain two tandem PSD-95/Discs large/ZO-1 (PDZ) domains and an ezrin-binding domain, and NHERF3 and NHERF4 that possess four PDZ domains but no ezrin-binding domain (17). NHERF1 (also known as ezrin-binding phosphoprotein 50, EBP50) shares 52% amino acid identity with NHERF2, also called NHE3 kinase A regulatory protein (E3KARP) (18). NHERF1 and NHERF2 are implicated in protein targeting and in the assembly of protein complexes. They recruit various GPCRs, ion transporters, and other proteins to the plasma membrane of epithelia and other cells (19–22).

Despite the similarity between their PDZ domains, NHERF proteins exhibit different affinities for PDZ-binding partners. Some NHERF targets, like Taz (23), the PMCA2b Ca2+-ATPase (24), and the LPA5 receptor (25) preferentially bind NHERF2. Furthermore, NHERF2 may display distinct binding specificity and physiologic function that is not shared by NHERF1. NHERF2 but not NHERF1, for instance, specifically interacts with PLC-β3 and plays a key role in PLC-β3 activation by the PDZ domain-mediated interaction (26). Ca2+-dependent inhibition of NHE3 requires an NHE3-NHERF2-α-actinin-4 complex for oligomerization and endocytosis (27). NHERF2 specifically interacts with the LPA2 receptor and defines the specificity and efficiency of receptor-mediated PLC-β3 activation (28).

Mahon et al. (21) reported that NHERF2 inhibited adenylyl cyclase by stimulating inhibitory Gαi and increased PLC in PS120 cells transfected with the PTHR. In contrast, NHERF1 increased PTH-stimulated cAMP accumulation in ROS 17/2.8 cells (29). Adding to the variability of effects, both NHERF1 and NHERF2 increased PTH-stimulated PLC activity or intracellular calcium in PS120 cells, opossum kidney cells, and ROS 17/2.8 cells (21, 29–31), although no differences in PTH-stimulated cAMP formation were found in wild-type and NHERF1-null proximal tubule cells (32, 33) or in CHO-N10-R3 cells in the presence or absence of NHERF1 (34).

The molecular mechanism by which NHERF association with PTHR promotes switching of receptor signaling between adenylyl cyclase and phospholipase C is not known. It has been speculated that the NHERF proteins may promote Gq-mediated signaling by tethering Gαq effectors such as PLC (26, 35), PKC (36), and PKD (37) in the vicinity of receptors. However, it is also possible that NHERF-GPCR interactions might directly modulate the G protein-coupling preferences of the receptors. The most direct and unambiguous way to determine the influence of NHERF1/2 on PTHR signaling is to measure effects on G protein activation. We show here that NHERF1 increases PTH-stimulated PTHR coupling to Gαq but not to Gαs or Gαi. In contrast, NHERF2 decreases PTH-induced Gαs and increases Gαq and Gαi activation. These data reveal that NHERF-PTHR interactions can directly influence receptor coupling to G proteins.

EXPERIMENTAL PROCEDURES

HA.11 and His6 monoclonal antibodies were obtained from Covance (Berkeley, CA). NHERF1 rabbit polyclonal antibody was purchased from Affinity Bioreagents (Golden, CO). NHERF2 rabbit polyclonal antibody was kindly provided by Dr. R. A. Frizzell (University of Pittsburgh). Polyclonal Gαs antibody was obtained from Millipore (Billerica, MA). Gαq monoclonal antibody was provided by BD Transduction Laboratories. Gαi polyclonal antibody was from NewEast Biosciences (Malvern, PA). Ni-NTA-agarose was provided by Qiagen (Valencia, CA). Horseradish peroxidase-conjugated goat anti-rabbit secondary antibody was from Pierce. Horseradish peroxidase-conjugated sheep anti-mouse antibody was from GE Healthcare. Lipofectamine 2000 and geneticin, protein A-Sepharose 4B conjugate, and rec-protein G-Sepharose 4B conjugate were obtained from Invitrogen. Protease inhibitor mixture Set I and pertussis toxin were from Calbiochem. Human PTH(1–34) was purchased from Bachem (Torrance, CA). [35S]GTPγS (1,250 Ci/mmol) was purchased from PerkinElmer Life Sciences. FuGENE 6 was purchased from Roche Applied Science. All other reagents were from Sigma.

Cell Culture

PS120 cells were stably transfected with PTHR (PS120-R) or stably transfected with both PTHR and NHERF2 (PS120-R-N2) and were obtained from Dr. M. J. Mahon (Harvard Medical School). PS120-R cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, 1 μg/ml puromycin. PS120-R-N2 cells were cultured in the above medium with additional 0.1 mg/ml hygromycin B. CHO cells were stably transfected with PTHR (CHO-R) (34) and cultured in Ham's F-12 medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, and 0.75 mg/ml geneticin. HEK-293 cells were stably transfected with PTHR (HEK-293R) (34) and cultured in Dulbecco's modified Eagle's medium/F-12 medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, and 0.75 mg/ml geneticin. All cells were maintained at 37 °C in a humidified atmosphere of 5% CO2, 95% air.

Transient Transfection

Cells were transiently transfected with empty vector, plasmids of His-NHERF1 (34), His-NHERF2 (provided by Dr. R. A. Frizzell, University of Pittsburgh), wild-type PTH receptor (PTHR-ETVM), mutant PTHR (PTHR-ETVA) (34), YFPGαi (provided by Dr. J.-P. Vilardaga, University of Pittsburgh), bimolecular fluorescence complementation β1γ2 complexes (provided by Dr. C.H. Berlot) (38), as indicated, using FuGENE 6 or Lipofectamine 2000 as described previously (39). Cells were used 48 h after transfection.

Membrane Preparation

Plasma membranes were isolated by differential centrifugation at 4 °C as described previously (1, 39, 40). Briefly, after cells achieved confluence, they were rinsed with cold PBS and then incubated with hypotonic buffer (10 mm Hepes, 0.5 mm EDTA, pH 7.4) for 15 min. Swollen cells were harvested, collected by centrifugation (1000 × g for 10 min), and resuspended in ∼9 volumes of 10 mm Tris, 1 mm EDTA, pH 7.4, with proteinase inhibitor mixture set I. Cells were disrupted with 20–40 strokes in a “loose” Dounce homogenizer on ice. The lysates were centrifuged at 1000 × g for 10 min to remove unbroken cells, large cell debris, and some nuclei. The supernatant was further centrifuged at 30,000 × g for 20 min. The membrane pellet was resuspended in freezing buffer (10 mm Hepes, 0.1 mm EDTA, pH 7.4) at a protein concentration of 5–10 μg/μl and rapidly frozen in liquid nitrogen. Membranes were then stored at −80 °C until used.

GTPγS Binding and Immunoprecipitation of GTPγS-bound Gα Subunits

The comparative changes in Gα-[35S]GTPγS binding immunoprecipitated by specific Gα subtype-specific antisera were used to delineate PTHR coupling to distinct Gα protein subunits. [35S]GTPγS binding to G proteins was performed with a modification of previously described methodologies (1, 40). Frozen membrane aliquots (150 μg) were incubated with 100 μl of assay buffer (10 mm Hepes, 100 mm NaCl, 5 mm MgCl2, pH 7.4) containing 5 μm GDP, 5 nm [35S]GTPγS, and 100 nm PTH(1–34) at 30 °C for 5 min (unless otherwise stated). Incubations were terminated by the addition of 800 μl of ice-cold assay buffer and immediate transfer to an ice bath. Cell membranes were recovered from the reaction mixture by centrifugation at 20,000 × g for 10 min, and the resulting supernatant was removed. Membrane pellets were solubilized, and immunoprecipitation of [35S]GTPγS bound to Gα subunits was measured as described below under “Coimmunoprecipitation and Immunoblot Analysis.” After Sepharose beads were washed three times, the beads were resuspended with 100 μl of 0.5% SDS and incubated at 85–90 °C for 2–3 min. The entire contents of each tube were transferred to a vial containing 5 ml of scintillation mixture, and radioactivity was measured by β-emission spectrometry. Nonspecific binding was determined in the presence of 100 μm GTPγS.

Coimmunoprecipitation and Immunoblot Analysis

Interaction of G proteins with NHERF1 or NHERF2 was analyzed as described previously (41). In brief, 6-well plates of CHO-R3 cells were transiently transfected with His-NHERF1, His-NHERF2, or empty vector. Forty eight hours later, the cells were lysed with 1% Lubrol, 0.5% sodium deoxycholate, 0.1% SDS, 50 mm Tris, pH 7.4, and 150 mm NaCl. Solubilized materials were incubated overnight at 4 °C with Ni-NTA-agarose or incubated with anti-Gαs polyclonal antibody, Gαq monoclonal antibodies, or Gαi polyclonal antibody for 1 h at 4 °C and then protein A or protein G-Sepharose 4B conjugate was added to each sample and incubated overnight at 4 °C. Total lysates and immunoprecipitated protein, eluted by the addition of SDS sample buffer, were analyzed by SDS-polyacrylamide gels and transferred to Immobilon-P membranes (Millipore) using the semi-dry method (Bio-Rad). Membranes were blocked overnight at 4 °C with 5% nonfat dried milk in Tris-buffered saline plus Tween 20 and incubated with different antibodies (anti-His antibody (1:1000); anti-Gαs (1:500); anti-Gαq (1:250); anti-Gαi (1:500); anti-HA (1:1000); anti-NHERF1 (1:1000); anti-NHERF2 (1:4000); or anti-actin (1:2000)) for 2 h at room temperature. The membranes were then washed and incubated with goat anti-rabbit IgG conjugated to horseradish peroxidase or anti-sheep mouse IgG conjugated to horseradish peroxidase (1:5000) for 1 h at room temperature. Protein bands were revealed with a luminol-based enhanced chemiluminescence substrate.

Overlay Assay

His/S-tagged PDZ1 and PDZ2 domain proteins (1 μg/lane) were spotted on nylon membrane as described previously (42). The membranes were blocked with blot buffer for 30 min at room temperature and then overlaid with 100 nm GST-tagged C-terminal 22-amino acid fragments of wild-type PTHR (PTHR-ctETVM) or its mutant form PTHR-ctETVA in blot buffer for 1 h at room temperature. The blots were washed and incubated with horseradish peroxidase-conjugated anti-GST antibody (1:3000). Interactions of the GST fusion proteins with the PDZ domains were visualized by chemiluminescence.

NHERF Knockdown

Constitutive NHERF1 or NHERF2 expression in HEK-293R cells was silenced using RNA interference. Short hairpin RNA (shRNA) constructs against human NHERF1 (GGAAACTGACGAGTTCTTCAAGAAATGCA) and NHERF2 (AACAGGAAGCGTGAAATCTTCAGCAACTT) were purchased from OriGene (Rockville, MD). HEK-293R cells were transfected with NHERF1 shRNA, NHERF2 shRNA, or scrambled shRNA. Transfections were established and described previously (34). Transfected cells were cultured for 72 h and then used for G protein binding or immunoblot.

Rescue forms of human NHERF1 and NHERF2 (resNHERF1 and resNHERF2, respectively) resistant to their respective shRNA were generated by introducing three silent mutations in the NHERF1 and NHERF2 sequences using primers listed in Table 1. The mutations were constructed by PCR using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. The fidelity of plasmids was confirmed by sequencing (ABI PRISM 377, Applied Biosystems, Foster City, CA). Rescue shRNA scrambled constructs containing the 29-mer scrambled cassette were purchased from OriGene.

TABLE 1.

Primers used to generate rescue forms of human NHERF1 and NHERF2

Three silent mutations (underlined) were introduced in the shRNAs targeting NHERF1 or NHERF2.

Gene sequences
NHERF1 sense 5′-CTGGTGGTGGACAGGGAGACCGATGAGTTCTTCAAGAAATGC
NHERF1 antisense 5′-GCATTTCTTGAAGAACTCATCGGTCTCCCTGTCCACCACCAG
NHERF2 sense 5′-CAGATGGACTGGAACAGAAAACGCGAAATCTTCAGCAAC
NHERF2 antisense 5′-GTTGCTGAAGATTTCGCGTTTTCTGTTCCAGTCCATCTG
FRET

Gαi activation was measured in real time in live cells by fluorescence resonance energy transfer (FRET) as described previously (43, 44). Briefly, HEK-293 cells plated on MatTek (Ashland, MA) dishes were maintained in Hepes buffer with 0.1% (w/v) bovine serum albumin at 22 °C. Cells were observed using a 40 × 1.30 NA oil immersion objective on a Nikon A1s confocal microscope attached to a Ti-E inverted base. Subunit rearrangement of Gαi and Gβγ was measured by FRET between YFP-tagged Gαi and cerulean-tagged Gβ1γ2 bimolecular fluorescence complementation. FRET signal was measured as the normalized FRET ratio (nFRET) of the YFP and cyan fluorescent protein emission (FYFP/FCFP) (45).

Receptor Binding

Receptor binding was performed as described previously (34) using HPLC-purified 125I-[Nle8,18,Tyr34]PTH(1–34)-NH2. In brief, PS120-R cells, PS120-R-N2, or CHO-R3 cells were seeded on 24-well plates and grown to confluence. Cells were put on ice for 15 min and incubated with PTH(1–34) (10−11–10−6 m) and ∼100,000 cpm of 125I-[Nle8,18,Tyr34]PTH(1–34)-NH2 in 250 μl of fresh media on ice for an additional 2.5 h. After incubation, cells were rinsed twice with ice-cold PBS and then solubilized in 0.2 n NaOH. Nonspecific binding was measured in parallel experiments carried out in the presence of 1 μm unlabeled PTH(1–34). Cell surface-bound 125I-PTH(1–34) was assessed by γ-spectrometry. PTHR number was analyzed by Scatchard analysis.

Adenylyl Cyclase

Adenylyl cyclase activity was determined by assay of cAMP accumulation as described previously (34). Briefly, HEK-293R cells transfected with scrambled shRNA, NHERF1 shRNA, or NHERF2 shRNA in 24-well plates were labeled with 0.5 μCi of [3H]adenine for 2 h. The cells were then treated with vehicle or 100 nm PTH(1–34) in the presence of phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (1 mm) for 15 min. The reaction was terminated by addition of 1 m TCA. cAMP was isolated by the two-column method.

Intracellular Calcium

Intracellular calcium concentrations ([Ca2+]i) were measured with the calcium-sensitive dye Fluo-4/AM (Invitrogen) following the manufacturer's protocol. Briefly, HEK-293R cells were cultured on MatTek dishes with 2 μm Fluo-4/AM in Hanks' balanced salt solution (Invitrogen) at 22 °C for 45 min. Cells were washed three times with Hanks' balanced salt solution and incubated with Hanks' balanced salt solution at 22 °C for another 30 min. The calcium measurements were performed with a Nikon A1s inverted fluorescent microscope. Fluorescence was recorded at 1-s intervals for up to 20 min. At least 30–40 cells were counted under each condition. Intracellular calcium concentrations were calculated using the following equation: [Ca2+]i = Kd × (F − Fmin)/(Fmax − F), where F is the measured fluorescence intensity; Fmax is the fluorescence measured after addition of 10 μm ionomycin; Fmin is the fluorescence measured after addition of 10 mm EGTA, and Kd is the dissociation constant of the dye-Ca2+ complex (520 nm) (46).

Statistics

Data are presented as the mean ± S.E., where n indicates the number of independent experiments. Multiple comparisons were evaluated by analysis of variance with post-test repeated measures analyzed by the Duncan procedure using Prism (GraphPad Software, Inc., San Diego). Differences of p < 0.05 were assumed to be significant.

RESULTS

Specificity of PTH-induced Gα Subunit Activation

We first determined the constitutive expression of Gα protein subunits in membranes of PS120-R cells. Fig. 1A shows that PS120-R cells express Gαs, Gαq, and Gαi proteins in cell membranes. We then measured PTH-stimulated [35S]GTPγS binding to Gαs, Gαq, and Gαi. PTH increased [35S]GTPγS binding to Gαs protein by 3.6-fold (Fig. 1B). Unlabeled GTPγS (100 μm) virtually abolished PTH-induced [35S]GTPγS binding. The nonhydrolyzable ATP analogue AMP-PCP (1 mm) had no effect on PTH-induced [35S]GTPγS binding. Similar results obtained with PTH-stimulated [35S]GTPγS binding to Gαq and Gαi (data not shown). These data provide strong evidence for specificity of PTH-induced [35S]GTPγS binding to Gαs, Gαq, and Gαi proteins.

FIGURE 1.

FIGURE 1.

Specificity of PTH-induced [35S]GTPγS binding to G protein subunit. A, cell membrane protein (20 μg) prepared from PS120-R or PS120-R-N2 cells was resolved on 10% SDS-polyacrylamide gels as described under “Experimental Procedures” for immunoblot analysis. Cell membrane PTHR expression was used as a loading control (55). B, membrane aliquots from PS120-R cells were incubated with [35S]GTPγS and 100 nm PTH(1–34) in the presence or absence of 1 mm AMP-PCP or 100 μm unlabeled GTPγS for 5 min at 30 °C. Immunoprecipitation of [35S]GTPγS bound to Gαs subunit was measured as described under “Experimental Procedures.” Data are summarized as the mean ± S.E. of three independent experiments.

PTH activated Gαs in a time- and concentration-dependent manner. Ligand-stimulated [35S]GTPγS binding to Gαs occurred within 1 min (Fig. 2A). Because Gα-[35S]GTPγS is resistant to hydrolysis by the intrinsic GTPase activity of Gα, [35S]GTPγS-labeled Gα subunits accumulated over time under both basal and PTH-stimulated conditions. The net change of PTH-stimulated [35S]GTPγS binding peaked at 5 min. Therefore, we used this time point to determine the concentration dependence of PTH action. Half-maximal PTH-induced [35S]GTPγS binding was 6.2 nm; maximal stimulation occurred at 100 nm (Fig. 2B). Similar results were observed for PTH-stimulated [35S]GTPγS binding to Gαq and Gαi (data not shown). Therefore, 5 min stimulations with 100 nm PTH were used for subsequent experiments.

FIGURE 2.

FIGURE 2.

Time- and concentration-dependent PTH induction of [35S]GTPγS binding to Gαs protein subunit. Cell membranes were prepared from PS120-R cells. Data are summarized as the mean ± S.E. of three independent experiments. A, time course of PTH-stimulated [35S]GTPγs binding to Gαs subunit was measured in the presence or absence of 100 nm PTH(1–34). B, concentration-dependent curve of PTH-stimulated [35S]GTPγs binding to Gαs subunit was measured in the presence of PTH for 5 min. Data are summarized as the mean ± S.E. of three independent experiments.

NHERF2 Inhibits PTH-stimulated Gαs and Increases Gαq and Gαi Activation

Mahon et al. (21) reported that NHERF2 switched PTHR signaling from adenylyl cyclase to PLC in PS120-R cells stably transfected with NHERF2 (PS120-R-N2). Pertussis toxin pretreatment of PS120-R-N2 cells markedly inhibited PTH activation of PLC and enhanced activation of adenylyl cyclase, implying that PTH stimulates Gi/o proteins when the PTHR is bound to NHERF2. We tested the effects of NHERF2 on resting and PTH-stimulated Gαs, Gαq, and Gαi exchange. PS120-R cells express small amounts of NHERF1 (47) but not NHERF2 (Fig. 3A), whereas PS120-R-N2 cells express NHERF2 mostly at cell membranes (Fig. 3A). NHERF2 did not affect basal Gαs, Gαq, or Gαi activity but significantly blunted PTH-stimulated Gαs activation (Fig. 3B). Conversely, NHERF2 augmented Gαq and Gαi activation (Fig. 3B). These effects occurred without a detectable change in cell membrane PTH receptor abundance (Fig. 3C), suggesting that the action of NHERF2 on Gα GTP exchange is not due to altered abundance of the PTHR or of ligand binding to the PTHR.

FIGURE 3.

FIGURE 3.

NHERF2 inhibits PTH-stimulated Gαs binding and increases both Gαq and Gαi binding in PS120-R cell membranes. A, equal amounts of membrane (Mem) and cytosolic (Cyt) proteins (20 μg) from PS120-R cells or PS120-R-N2 cells were immunoblotted with NHERF2 antibody. B, PTH-stimulated [35S]GTPγs binding to Gαs, Gαq, or Gαi protein was measured in PS120-R or PS120-R-N2 cell membranes. Data are summarized as the mean ± S.E. of four independent experiments. **, p < 0.01; ***, p < 0.001, compared with PS120-R plus PTH group. C, cell surface binding of 125I-PTH(1–34) in PS120-R cells or PS120-R-N2 cells was measured as described under “Experimental Procedures.” Data are summarized as the mean ± S.E. of triplicate determinations.

NHERF1 and NHERF2 Differentially Regulate PTH-stimulated Gα Activation

The ability of PTH to increase the coupling of the receptor to Gαs and Gαq correlates with ligand-induced, receptor-dependent sensitivity of adenylyl cyclase and PLC signaling (1). Based on the described differences of NHERF1 and NHERF2 regulation of PTHR signaling (21, 29, 34), we hypothesized that NHERF1 and NHERF2 might differentially regulate PTH-stimulated Gα protein activation. To compare the effects of NHERF1 and NHERF2 on Gs activation, we used CHO cells stably transfected with PTHR (CHO-R), which lack detectable expression of NHERF1 (34) or NHERF2 (data not shown) but express similar levels of Gαs, Gαq, and Gαi proteins (40). We transiently transfected CHO-R cells with His-NHERF1 or His-NHERF2, resulting in similar levels of cell membrane expression (Fig. 4A). In the absence of NHERF1 or NHERF2, PTH activation of Gαs was greater than that of Gαq, but no effects on Gαi activation were detected (Fig. 4B). Neither NHERF1 nor NHERF2 affected basal Gα activity (data not shown). In the presence of NHERF1, PTH significantly enhanced Gαq activity without an effect on Gαs or Gαi (Fig. 4B). Thus, NHERF1 selectively promotes receptor coupling to Gαq. In contrast, NHERF2 significantly inhibited PTH-stimulated Gαs but enhanced PTH-induced activation of Gαq and Gαi (Fig. 4B). NHERF2 therefore influences receptor coupling to all three Gα proteins, promoting opposite effects on Gαs and Gαi, but like NHERF1 increasing PTH-dependent Gαq activity. NHERF1 and NHERF2 did not affect receptor number as evidenced by comparable PTH binding to the PTHR (Fig. 4C), consistent with previous reports on CHO and ROS 17/2.8 cells (29, 34).

FIGURE 4.

FIGURE 4.

Effects of NHERF1 and NHERF2 on PTH-stimulated [35S]GTPγS binding to Gα protein subunits in CHO-R cell membranes. A, equal amounts of membrane proteins (20 μg) from CHO-R cells transiently transfected with vector, His-NHERF1, or His-NHERF2 were immunoblotted (IB) with His antibody. Cell membrane PTHR expression was used as a loading control. B, PTH-stimulated [35S]GTPγs binding to Gαs, Gαq, or Gαi protein was measured in the cell membranes of CHO-R cells transiently transfected with vector, His-NHERF1, or His-NHERF2. Data are summarized as the mean ± S.E. of four independent experiments. **, p < 0.01; ***, p < 0.001 compared with vector plus PTH group. C, cell surface binding of 125I-PTH(1–34) in CHO-R cells transiently transfected with vector, His-NHERF1, or His-NHERF2 was measured. Data are summarized as the mean ± S.E. of triplicate determinations.

The PTHR, through its C-terminal ETVM PDZ recognition sequence, interacts with NHERF1 by binding to PDZ1 and PDZ2 (34, 48). PTHR interactions with NHERF2 PDZ domains have not been described. Here, we simultaneously compared the interactions of GST-tagged C-terminal 22 amino acid peptide fragments of the wild-type PTHR (PTHR-ctETVM) and a mutant form PTHR-ctETVA, which cannot bind NHERF1, with PDZ1 and PDZ2 domains of NHERF1 and NHERF2 (Fig. 5A). The results show that the PTHR preferentially interacts with the PDZ1 domain of NHERF1 and PDZ2 of NHERF2. These associations were abolished with the PTHR harboring the mutated PDZ interaction motif.

FIGURE 5.

FIGURE 5.

Effects of NHERF1 and NHERF2 on PTH-stimulated [35S]GTPγS binding to Gα protein subunits in HEK-293R cell membranes. A, GST-tagged C-terminal 22 amino acids of PTH1R (PTHR-ctETVM) and its mutant of PTHR-ctETVA were overlaid with His-tagged PDZ domain of NHERF1 or NHERF2 on nylon membranes as described under “Experimental Procedures.” A representative overlay assay shows that PTH1R interacts with both PDZ domains of NHERF1 or NHERF2. B, equal amounts of membrane proteins (20 μg) from HEK-293R cells transiently transfected with HA-PTHR-ETVM or HA-PTHR-ETVA were immunoblotted (IB) with HA antibody. C, PTH-stimulated [35S]GTPγs binding to Gαs, Gαq, or Gαi protein was measured in the cell membranes of HEK-293R cells transiently transfected with HA-PTHR-ETVM or HA-PTHR-ETVA. Data are summarized as the mean ± S.E. of four independent experiments. *, p < 0.05; **, p < 0.01 compared with PTHR-ETVM group. D, equal amounts of membrane proteins (20 μg) from HEK-293R cells transiently transfected with scrambled shRNA, NHERF1 shRNA (shNHERF1), or NHERF2 shRNA (shNHERF2) were immunoblotted with either NHERF1 or NHERF2 antibody. E, PTH-stimulated [35S]GTPγs binding to Gαs, Gαq, or Gαi protein was measured in the cell membranes of HEK-293R cells transiently transfected with scrambled shRNA, shNHERF1 or shNHERF2. Data are summarized as the mean ± S.E. of four independent experiments. *, p < 0.05; **, p < 0.01, compared with scrambled plus PTH group. F, rescue experiments were performed by cotransfection with shNHERF1, shNHERF2, and plasmid constructs of WT-NHERF1, WT-NHERF2, or mutated NHERF1 and NHERF2 (resNHERF1 and resNHERF2) that are refractory to cleavage by their respective shRNA as described under “Experimental Procedures.” PTH-stimulated [35S]GTPγs binding to Gαs, Gαq, or Gαi protein was measured. Data are summarized as the mean ± S.E. of four independent experiments. **, p < 0.01, versus respective scrambled plus vector group. G, Gαi activation measured by real time FRET. FRET was performed on HEK-293 cells cotransfected with shNHERF1 or shNHERF2 and plasmid constructs of PTHR-ETVM, PTHR-ETVA, YFPGαi and bimolecular fluorescence complementation β1γ2 complexes as described under “Experimental Procedures.” Data are summarized as the normalized FRET mean ± S.E. of three independent experiments.

Additional examination of the NHERF-mediated switch of G protein activation was undertaken in HEK-293 cells, which constitutively express NHERF1 and NHERF2. In HEK-293 cells, transfected with wild-type PTHR-ETVM (Fig. 5B), PTH significantly activated Gαs, Gαq, and Gαi (Fig. 5C), consistent with a previous report that PTH promoted activation of Gαs, Gαq/11, and Gαi in HEK-293 cells (1). The PTHR-ETVA, which does not bind NHERF (49), showed decreased PTH-stimulated Gαq activation and increased PTH-stimulated activation of Gαs (Fig. 5C), although Gαi activation was absent. To delineate the individual effects of NHERF1 and NHERF2 on G protein activation, endogenous NHERF1 or NHERF2 expression was silenced by RNA interference. A scrambled shRNA was used as a control. NHERF1 or NHERF2 shRNA reduced endogenous NHERF1 or NHERF2 levels by 78 and 82%, respectively, compared with a scrambled control (Fig. 5D). NHERF1 shRNA did not interfere with NHERF2 expression, and conversely, NHERF2 shRNA did not affect NHERF1 expression, demonstrating the specificity of the knockdown of endogenous NHERF1 and NHERF2 by their respective shRNAs. Neither shRNA affected basal [35S]GTPγS binding to Gα subunits (data not shown). Knockdown of NHERF1 expression selectively inhibited PTH-stimulated activation of Gαq (Fig. 5E). Silencing NHERF2 expression, in contrast, significantly increased PTH-stimulated Gαs and inhibited Gαi activation. To rule out off-target effects of shRNA, we generated NHERF1 and NHERF2 rescue constructs (resNHERF1 and resNHERF2) harboring silent mutations to their respective shRNA and then conducted rescue experiments in HEK-293R cells. Expression of resNHERF1 blocked shNHERF1 inhibition of PTH-stimulated activation of Gαq (Fig. 5F). resNHERF2 abolished shNHERF2 increases of PTH-stimulated Gαs and inhibition of Gαi activation.

Further and independent characterization of the dynamic interactions of NHERF1 and NHERF2 with Gαi was conducted using real time FRET in living cells. PTH activated Gαi in HEK-293 cells transfected with PTHR-ETVM compared with the cells transfected with PTHR-ETVA (Fig. 5G). NHERF1 shRNA did not affect PTH-induced Gαi, whereas the FRET signal was abolished with shNHERF2. These data further confirm that NHERF2 specifically increases PTH-induced Gαi activation. Taken together, these results provide a mirror image of the effects of individual NHERF1 and NHERF2 actions on CHO-R cells and show that NHERF1 augments receptor-mediated stimulation of Gαq but has no effect on stimulation of Gαi or Gαs, whereas NHERF2 enhances receptor-mediated stimulation of both Gαq and Gαi but decreases stimulation of Gαs.

NHERF2 but Not NHERF1 Binds Gαi and Regulates Second Messenger Signaling Pathways

NHERF1 interacts directly with Gαq (35). We analyzed NHERF1 and NHERF2 binding to Gαs, Gαq, and Gαi. CHO-R cells were transiently transfected with His-NHERF1 or His-NHERF2. Neither NHERF1 nor NHERF2 interacted with Gαs (data not shown). However, both NHERF1 and NHERF2 bound Gαq, and the interactions were enhanced in the presence of PTH (Fig. 6A). These data are consistent with the report that NHERF1 interacts with Gαq and to a greater extent with Gαq-R183C,. a constitutively active Gαq mutant (35). We next investigated the interaction of NHERF1 and NHERF2 with Gαi. NHERF2 but not NHERF1 coimmunoprecipitated with Gαi by using Ni-NTA-agarose followed by immunodetection with a Gαi antibody (Fig. 6B). Likewise, the interaction could be detected by using a Gαi antibody for immunoprecipitation and immunodetection of NHERF2 with a His antibody. The association was also enhanced in the presence of PTH (Fig. 6B). Importantly, NHERF2 interacted with endogenous Gαi in native CHO cells not expressing the PTHR (Fig. 6C), indicating that the interaction between NHERF2 and Gαi is receptor-independent.

FIGURE 6.

FIGURE 6.

NHERF2 but not NHERF1 binds Gαi. A, PTH increased the interaction of Gαq protein with NHERF1 or NHERF2. CHO-R cells were transfected with His-NHERF1 or His-NHERF2. His-tagged proteins were precipitated with Ni-NTA-agarose. The precipitated protein was then immunoblotted (IB) with Gαq antibody. B, PTH increased the interaction of Gαi proteins with NHERF2. CHO-R cells were transfected with His-NHERF1 or His-NHERF2. His-tagged proteins were precipitated with Ni-NTA-agarose or endogenous Gαi protein was precipitated with Gαi antibody. The precipitated proteins were immunoblotted with either Gαi or His antibody. C, interaction of Gαq or Gαi subunits with NHERF1 or NHERF2 in CHO cells was measured and described as above. Data are representative of three independent experiments. IP, immunoprecipitated.

Since NHERF1 and NHERF2 differentially regulate PTH-stimulated Gαi activation, their effects on PTH-induced second messenger signaling pathways in the presence or absence of pertussis toxin should differ. Therefore, we examined the effect of NHERF1 or NHERF2 on PTH-stimulated cAMP formation and [Ca2+]i, as an index of PLC activity, in HEK-293R cells. Pertussis toxin (100 ng/ml) pretreatment for 16 h markedly increased PTH activation of adenylyl cyclase (Fig. 7A), without affecting the magnitude of PTH-induced [Ca2+]i (Fig. 7B, top), consistent with a previous report regarding pertussis toxin effects on PTH-stimulated cAMP formation and [Ca2+]i (15). Silencing NHERF1 did not affect PTH-stimulated cAMP formation or maximal [Ca2+]i. Pertussis toxin increased PTH-stimulated cAMP accumulation and decreased [Ca2+]i in the presence of shNHERF1 (Fig. 7, A and B, middle). As expected, pertussis toxin had no further action on PTH-stimulated cAMP production or [Ca2+]i after knockdown of NHERF2 (Fig. 7, A and B, bottom). Taken together, these results show that NHERF1 and NHERF2 differentially regulate PTH-stimulated G protein activation and second messenger signaling pathways.

FIGURE 7.

FIGURE 7.

Effects of NHERF1 and NHERF2 on PTH-stimulated adenylyl cyclase activity and [Ca2+]i. A, effects of NHERF1 and NHERF2 on PTH-stimulated adenylyl cyclase activity. HEK-293R cells were transfected with scrambled shRNA, shNHERF1, or shNHERF2. Pertussis toxin (PTX) (100 ng/ml) was added for 16 h as indicated. Cells were treated with 100 nm PTH for 15 min, and cAMP accumulation was measured as described under “Experimental Procedures.” Data are summarized as the mean ± S.E. of four independent experiments. **, p < 0.01 compared with scrambled shRNA plus PTH group. B, effects of NHERF1 and NHERF2 on PTH-induced [Ca2+]i. HEK-293R cells were treated as the same as A. PTH (100 nm)-stimulated [Ca2+]i was measured as described under “Experimental Procedures.” Data are summarized as the mean ± S.E. of three independent experiments. The effects of scrambled shRNA, shNHERF1, and shNHERF2 on [Ca2+]i in the presence or absence of pertussis toxin were shown in top, middle, or bottom panel, respectively.

DISCUSSION

PTH activates multiple second messenger signaling pathways that are reportedly coupled by distinct G proteins to the PTHR. Indirect approaches suggest that the PTHR is capable of coupling to Gαs and to multiple Gαq family members (2) and Gβγ subunits (50). However, to the best of our knowledge, only a single report analyzed PTHR activation of G proteins (1). Schwindinger et al. (1) measured PTHR coupling to Gα proteins in HEK-293 cell lines heterologously expressing the PTHR at low (C20; 40,000 receptors/cell) or high (C21; 400,000 receptors/cell) and in ROS 17/2.8 osteosarcoma cells, which constitutively express 72,000 receptors/cell (51). The ability of PTH(1–34) to activate Gαs and Gαq, measured by [α-32P]GTP-γ-azidoanilide binding followed by immunospecific Gα subunit detection, correlated with the magnitude of ligand-induced receptor-dependent sensitivity of adenylyl cyclase and PLC signaling pathways. PTH promoted activation of Gαs, Gαq/11, and Gαi, albeit to a lesser extent, in C21 but not in C20 cells. In ROS 17/2.8 cells, PTH activated Gαs to a greater degree than in C21 cells but had no effect on Gαq/11 or Gαi. NHERF proteins had not been discovered that at the time those studies were performed. Our data now permit some comparison of the results and show that the expression of NHERF1 and NHERF2 are, at least in part, responsible for the heterogeneity of the cellular responses to PTH. NHERF1 permits selective activation of Gαq, whereas NHERF2 attenuates PTH-stimulated Gαs, while enhancing PTH-induced activation of Gαq and Gαi. These findings explain why PTH stimulated Gαq and Gαi in C21 cells, which express both NHERF1 and NHERF2, but not in ROS 17/2.8 cells, which express neither. Consistent with this interpretation, PTH does not stimulate [Ca2+]i in native ROS 17/2.8 cells (29). Upon transfection of NHERF1, however, PTH significantly increased [Ca2+]i. Notably, relatively high PTHR density is required for efficient activation of PLC, in contrast to receptor activation of adenylyl cyclase that occurs at physiologic receptor concentrations (52). This may contribute to the limited PLC activation in ROS 17/2.8 cells.

To demonstrate the generality of the effects of NHERF1 and NHERF2, we studied the PTH-dependent activation of heterotrimeric G proteins in several cell lines that have been used as models to analyze the heterogeneity of the responses to PTH. We chose PS120 fibroblasts, CHO-derived cell lines, and HEK-293 cells, all of which were transfected with either the WT-PTHR or a mutated form with an impaired PDZ-binding motif. Our results are summarized in Table 2. Several conclusions can be drawn from these results. For instance, the data clearly indicate that coupling of the PTHR to Gαi absolutely requires the expression of NHERF2. Furthermore, in the absence of NHERF1 and NHERF2, the receptor couples primarily to Gαs. Finally, Gαq coupling is significantly increased by either NHERF1 or NHERF2.

TABLE 2.

Summary of results with different cell lines

Cell line NHERF expression Treatment Coupling
PS120-R Neither None Gs > Gq; no Gi activation
NHERF2 Gq > Gi > Gs
CHO-R Neither None Gs > Gq; no Gi activation
NHERF1 Gq ≅ Gs; no Gi activation
NHERF2 Gq > Gi ≅ Gs
HEK-293-ETVM (WT-PTHR) Both None Gq > Gi ≅ Gs
NHERF1 shRNA Gs ≅ Gq ≅ Gi
NHERF2 shRNA Gs > Gq; no Gi activation
HEK-293-ETVA (PTHR with impaired PDZ binding) Both None Gs > Gq; no Gi activation

These results are consistent with previous reports examining the downstream effects of PTH in various cell lines and now provide a mechanism to reconcile apparent discrepancies between different cells or cell lines. Furthermore, our findings provide a solid experimental framework to explain the complex spectrum of cellular responses to PTH. For example, in PS120 cells stably transfected with the PTHR, the expression of NHERF2 decreased cAMP responses and increased PLC-dependent effects (21). Our data show that this effect is due to increased Gαi and decreased Gαs activation in the presence of NHERF2. Likewise, HEK-293R robustly activate cAMP and Ca2+-dependent responses. The present findings support the conclusion that this is due to NHERF1/NHERF2-dependent modulation of the pattern of G protein activation downstream of the PTHR in these cells.

Despite the similarity of their PDZ domains and C-terminal ezrin-binding domain, NHERF1 and NHERF2 exhibit different affinities for PDZ-binding partners and GPCR signaling (20, 25, 53, 54). These results show that the PTHR binds preferentially to PDZ1 of NHERF1 and PDZ2 of NHERF2. Because binding to both NHERF proteins is mediated by the same C-terminal sequence, the PTH1R cannot simultaneously interact with NHERF1 and NHERF2. Thus, the relative levels of expression of NHERF1 and NHERF2 may influence the differential coupling of the PTHR to different downstream signaling pathways. Importantly, although it is clear that the expression of NHERF1 and NHERF2 influences PTHR signaling, some variations among cell lines have been reported, indicating the influence of additional factors in PTHR signaling. For instance, NHERF1 increases PTH-stimulated cAMP accumulation in ROS 17/2.8 cells (29) but decreases cAMP responses in OKH cells (30). Furthermore, PTH-stimulated cAMP production in wild-type and NHERF1-null proximal tubule cells was comparable (32, 33), as it is in CHO-N10-R3 cells in the presence or absence of NHERF1 (34). Our results indicate that NHERF1 has no effects on PTH-induced Gαs or Gαi activation; therefore, the different effects of NHERF1 on the production of cAMP by these cell lines are probably due to other factors that remain unidentified.

The effects of NHERF2 on adenylyl cyclase activation are somewhat less diverse. NHERF2 expression markedly inhibited adenylyl cyclase in PS120 cells transfected with the PTHR, a result that is consistent with the differential activation of Gαs and Gαi induced by NHERF2 expression (21). Both NHERF1 and NHERF2 increase PTH-stimulated PLC activity and intercellular calcium in PS120 cells, opossum kidney cells, or ROS 17/2.8 cells (21, 29–31). These findings are consistent with the model presented here. Both NHERF1 and NHERF2 increase the activation of PLCβ and the generation of intracellular Ca2+ transients. However, despite the similarities between NHERF1 and NHERF2, the coupling of the PTHR to calcium signaling is mediated by distinct mechanisms. In HEK-293R cells (which express both NHERF1 and NHERF2), the PTHR stimulates Ca2+ release by a mechanism that is insensitive to pertussis toxin. Thus, in the presence of both NHERF1 and NHERF2, a Gαq-driven mechanism predominates. Knockdown of NHERF1 has no effect on the magnitude or duration of the Ca2+ transients but reveals significant sensitivity to pertussis toxin. This suggests that Gαi activation is important for Ca2+ release when only NHERF2 is present. Finally, knockdown of NHERF2 significantly reduces the magnitude of the Ca2+ release response, which in this case remains insensitive to pertussis toxin. A comparison of the magnitude of these responses suggests that NHERF2 is more efficient in the coupling of Ca2+ responses, which are mediated by the engagement of both Gq and Gi, whereas NHERF1 only supports Gq-mediated responses.

Because NHERF2 was reported to inhibit adenylyl cyclase by stimulating Gαi proteins in PS120 cells stably transfected with the PTHR or stably transfected with both the receptor and NHERF2 (21), we employed these cell models to investigate NHERF2 coupling of the PTHR to different Gα protein subunits. The results show that NHERF2 significantly inhibited PTH-stimulated Gαs activation but activated both Gαq and Gi, consistent with the reported NHERF2 regulation of PTHR second messenger signaling pathways (21). We further detailed the effect of NHERF1 on PTHR activation of Gα subunits by using CHO cells stably transfected with PTHR (CHO-R cells), which do not constitutively express detectable NHERF1 or NHERF2. Consistent with the results with PS120-R-N2 cells, transient expression of NHERF1 did not affect PTH-induced activation of Gαs or Gαi. However, expression of NHERF2 significantly inhibited PTH-induced Gαs but increased coupling of the PTHR to Gαq and Gαi proteins. Nonetheless, some inconsistencies regarding NHERF1 regulation of PTH-stimulated adenylyl cyclase activity have been reported (29, 30, 32–34). These differences may be ascribed to NHERF1 regulation of PTHR trafficking, cell specificity, or as yet unrecognized factors.

The precise mechanistic basis of the differential regulation of the G protein coupling of the PTHR by NHERF1 and NHERF2 remains to be explained. One plausible explanation is suggested by the data shown in Fig. 6. Both NHERF1 and NHERF2 coimmunoprecipitated with Gαq, but only NHERF2 was able to pull down Gαi. The specific regions of NHERF1 and NHERF2 that mediate these putative interactions remain unknown. The next question is as follows. How do the interactions with NHERF1 and NHERF2 with G proteins influence PTHR signaling? The simplest model involves the pre-formation of a multimeric complex involving the PTHR, NHERF1/NHERF2, and a heterotrimeric G protein. We propose that the formation of this complex, by bringing the receptor and the G protein into close proximity, facilitates G protein activation. Thus, NHERF1, which binds Gαq, will promote Gq activation, and NHERF2, which binds Gαq and Gαi, will enhance the activation of these two G proteins. The differential effects of NHERF1 and NHERF2 on Gs activation may be due to the different topology of the interactions of the two PDZ proteins with the PTHR. It is conceivable that NHERF1 binding to PTHR, which is mediated by the N-terminal PDZ1 domain, does not interfere with Gs binding. Conversely, NHERF2-PTHR interactions, which involve the central PDZ2 of NHERF2, may induce conformational changes that result in reduced affinity for Gαs.

In summary, NHERF1 interacts with Gαq and increases PTH-stimulated PTHR coupling to Gαq but has no effect on Gαs or Gαi. In contrast, NHERF2 interacts with both Gαq and Gαi. Therefore, NHERF1 and NHERF2 control PTHR signaling by differential coupling of Gα proteins to the PTHR. These novel findings explain the differences between NHERF1 and NHERF2 on downstream regulation of PTHR signaling.

Acknowledgment

We thank David Wheeler for constructive suggestions during the course of this study.

*

This work was supported, in whole or in part, by National Institutes of Health Grants R01DK69998 (to P. A. F.) and R01NS055179 (to R. A. H.).

2
The abbreviations used are:
PTHR
type 1 PTH receptor
PTH
parathyroid hormone
GPCR
G protein-coupled receptor
NHERF
Na/H exchange regulatory factor
PDZ
postsynaptic density 95/discs large/zona occludens
ROS
rat osteosarcoma
shRNA
short hairpin RNA
wtPTHR
wild-type PTHR
PLC
phospholipase C
PKC
protein kinase C
GTPγS
guanosine 5′[γ-thio]-triphosphate
Ni-NTA
nickel-nitrilotriacetic acid
AMP-PCP
β,γ-methyleneadenosine 5′-triphosphate
res
rescue.

REFERENCES

  • 1.Schwindinger W. F., Fredericks J., Watkins L., Robinson H., Bathon J. M., Pines M., Suva L. J., Levine M. A. (1998) Endocrine 8, 201–209 [DOI] [PubMed] [Google Scholar]
  • 2.Offermanns S., Iida-Klein A., Segre G. V., Simon M. I. (1996) Mol. Endocrinol. 10, 566–574 [DOI] [PubMed] [Google Scholar]
  • 3.Wu S., Pirola C. J., Green J., Yamaguchi D. T., Okano K., Jueppner H., Forrester J. S., Fagin J. A., Clemens T. L. (1993) Endocrinology 133, 2437–2444 [DOI] [PubMed] [Google Scholar]
  • 4.Maeda S., Wu S., Jüppner H., Green J., Aragay A. M., Fagin J. A., Clemens T. L. (1996) Endocrinology 137, 3154–3162 [DOI] [PubMed] [Google Scholar]
  • 5.Orloff J. J., Kats Y., Urena P., Schipani E., Vasavada R. C., Philbrick W. M., Behal A., Abou-Samra A. B., Segre G. V., Jüppner H. (1995) Endocrinology 136, 3016–3023 [DOI] [PubMed] [Google Scholar]
  • 6.Whitfield J. F., Chakravarthy B. R., Durkin J. P., Isaacs R. J., Jouishomme H., Sikorska M., Williams R. E., Rixon R. H. (1992) J. Cell. Physiol. 150, 299–303 [DOI] [PubMed] [Google Scholar]
  • 7.Rampe D., Lacerda A. E., Dage R. C., Brown A. M. (1991) Am. J. Physiol. 261, H1945–H1950 [DOI] [PubMed] [Google Scholar]
  • 8.Schlüter K. D., Weber M., Piper H. M. (1995) Biochem. J. 310, 439–444 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Atkinson M. J., Hesch R. D., Cade C., Wadwah M., Perris A. D. (1987) J. Bone Miner. Res. 2, 303–309 [DOI] [PubMed] [Google Scholar]
  • 10.Klinger M., Alexiewicz J. M., Linker-Israeli M., Pitts T. O., Gaciong Z., Fadda G. Z., Massry S. G. (1990) Kidney Int. 37, 1543–1551 [DOI] [PubMed] [Google Scholar]
  • 11.Whitfield J. F., MacManus J. P., Youdale T., Franks D. J. (1971) J. Cell. Physiol. 78, 355–368 [DOI] [PubMed] [Google Scholar]
  • 12.Abou-Samra A. B., Jüppner H., Force T., Freeman M. W., Kong X. F., Schipani E., Urena P., Richards J., Bonventre J. V., Potts J. T., Jr., Kronenberg H. M., Segre G. V. (1992) Proc. Natl. Acad. Sci. U.S.A. 89, 2732–2736 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hruska K. A., Moskowitz D., Esbrit P., Civitelli R., Westbrook S., Huskey M. (1987) J. Clin. Invest. 79, 230–239 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Friedman P. A., Coutermarsh B. A., Kennedy S. M., Gesek F. A. (1996) Endocrinology 137, 13–20 [DOI] [PubMed] [Google Scholar]
  • 15.Pines M., Fukayama S., Costas K., Meurer E., Goldsmith P. K., Xu X., Muallem S., Behar V., Chorev M., Rosenblatt M., Tashjian A. H., Jr., Suva L. J. (1996) Bone 18, 381–389 [DOI] [PubMed] [Google Scholar]
  • 16.Iida-Klein A., Guo J., Xie L. Y., Jüppner H., Potts J. T., Jr., Kronenberg H. M., Bringhurst F. R., Abou-Samra A. B., Segre G. V. (1995) J. Biol. Chem. 270, 8458–8465 [DOI] [PubMed] [Google Scholar]
  • 17.Donowitz M., Cha B., Zachos N. C., Brett C. L., Sharma A., Tse C. M., Li X. (2005) J. Physiol. 567, 3–11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Shenolikar S., Voltz J. W., Minkoff C. M., Wade J. B., Weinman E. J. (2002) Proc. Natl. Acad. Sci. U.S.A. 99, 11470–11475 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Bretscher A., Edwards K., Fehon R. G. (2002) Nat. Rev. Mol. Cell Biol. 3, 586–599 [DOI] [PubMed] [Google Scholar]
  • 20.Shenolikar S., Voltz J. W., Cunningham R., Weinman E. J. (2004) Physiology 19, 362–369 [DOI] [PubMed] [Google Scholar]
  • 21.Mahon M. J., Donowitz M., Yun C. C., Segre G. V. (2002) Nature 417, 858–861 [DOI] [PubMed] [Google Scholar]
  • 22.Paquet M., Asay M. J., Fam S. R., Inuzuka H., Castleberry A. M., Oller H., Smith Y., Yun C. C., Traynelis S. F., Hall R. A. (2006) J. Biol. Chem. 281, 29949–29961 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kanai F., Marignani P. A., Sarbassova D., Yagi R., Hall R. A., Donowitz M., Hisaminato A., Fujiwara T., Ito Y., Cantley L. C., Yaffe M. B. (2000) EMBO J. 19, 6778–6791 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.DeMarco S. J., Chicka M. C., Strehler E. E. (2002) J. Biol. Chem. 277, 10506–10511 [DOI] [PubMed] [Google Scholar]
  • 25.Lin S., Yeruva S., He P., Singh A. K., Zhang H., Chen M., Lamprecht G., de Jonge H. R., Tse M., Donowitz M., Hogema B. M., Chun J., Seidler U., Yun C. C. (2010) Gastroenterology 138, 649–658 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hwang J. I., Heo K., Shin K. J., Kim E., Yun C., Ryu S. H., Shin H. S., Suh P. G. (2000) J. Biol. Chem. 275, 16632–16637 [DOI] [PubMed] [Google Scholar]
  • 27.Kim J. H., Lee-Kwon W., Park J. B., Ryu S. H., Yun C. H., Donowitz M. (2002) J. Biol. Chem. 277, 23714–23724 [DOI] [PubMed] [Google Scholar]
  • 28.Oh Y. S., Jo N. W., Choi J. W., Kim H. S., Seo S. W., Kang K. O., Hwang J. I., Heo K., Kim S. H., Kim Y. H., Kim I. H., Kim J. H., Banno Y., Ryu S. H., Suh P. G. (2004) Mol. Cell. Biol. 24, 5069–5079 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wheeler D., Garrido J. L., Bisello A., Kim Y. K., Friedman P. A., Romero G. (2008) Mol. Endocrinol. 22, 1163–1170 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mahon M. J., Cole J. A., Lederer E. D., Segre G. V. (2003) Mol. Endocrinol. 17, 2355–2364 [DOI] [PubMed] [Google Scholar]
  • 31.Mahon M. J., Segre G. V. (2004) J. Biol. Chem. 279, 23550–23558 [DOI] [PubMed] [Google Scholar]
  • 32.Cunningham R., Steplock D., Wang F., Huang H., E X., Shenolikar S., Weinman E. J. (2004) J. Biol. Chem. 279, 37815–37821 [DOI] [PubMed] [Google Scholar]
  • 33.Cunningham R., E X., Steplock D., Shenolikar S., Weinman E. J. (2005) Am. J. Physiol. Renal Physiol 289, F933–F938 [DOI] [PubMed] [Google Scholar]
  • 34.Wang B., Bisello A., Yang Y., Romero G. G., Friedman P. A. (2007) J. Biol. Chem. 282, 36214–36222 [DOI] [PubMed] [Google Scholar]
  • 35.Rochdi M. D., Watier V., La Madeleine C., Nakata H., Kozasa T., Parent J. L. (2002) J. Biol. Chem. 277, 40751–40759 [DOI] [PubMed] [Google Scholar]
  • 36.Lee-Kwon W., Kim J. H., Choi J. W., Kawano K., Cha B., Dartt D. A., Zoukhri D., Donowitz M. (2003) Am. J. Physiol. Cell. Physiol 285, C1527–C1536 [DOI] [PubMed] [Google Scholar]
  • 37.Kunkel M. T., Garcia E. L., Kajimoto T., Hall R. A., Newton A. C. (2009) J. Biol. Chem. 284, 24653–24661 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hynes T. R., Tang L., Mervine S. M., Sabo J. L., Yost E. A., Devreotes P. N., Berlot C. H. (2004) J. Biol. Chem. 279, 30279–30286 [DOI] [PubMed] [Google Scholar]
  • 39.Wang B., Yang Y., Friedman P. A. (2008) Mol. Biol. Cell 19, 1637–1645 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Akam E. C., Challiss R. A., Nahorski S. R. (2001) Br J. Pharmacol. 132, 950–958 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Wang B., Yang Y., Abou-Samra A. B., Friedman P. A. (2009) Mol. Pharmacol. 75, 1189–1197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.He J., Bellini M., Inuzuka H., Xu J., Xiong Y., Yang X., Castleberry A. M., Hall R. A. (2006) J. Biol. Chem. 281, 2820–2827 [DOI] [PubMed] [Google Scholar]
  • 43.Bünemann M., Frank M., Lohse M. J. (2003) Proc. Natl. Acad. Sci. U.S.A. 100, 16077–16082 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Frank M., Thümer L., Lohse M. J., Bünemann M. (2005) J. Biol. Chem. 280, 24584–24590 [DOI] [PubMed] [Google Scholar]
  • 45.Vilardaga J. P., Nikolaev V. O., Lorenz K., Ferrandon S., Zhuang Z., Lohse M. J. (2008) Nat. Chem. Biol. 4, 126–131 [DOI] [PubMed] [Google Scholar]
  • 46.Woodruff M. L., Sampath A. P., Matthews H. R., Krasnoperova N. V., Lem J., Fain G. L. (2002) J. Physiol. 542, 843–854 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ahn W., Kim K. H., Lee J. A., Kim J. Y., Choi J. Y., Moe O. W., Milgram S. L., Muallem S., Lee M. G. (2001) J. Biol. Chem. 276, 17236–17243 [DOI] [PubMed] [Google Scholar]
  • 48.Sun C., Mierke D. F. (2005) J. Pept. Res. 65, 411–417 [DOI] [PubMed] [Google Scholar]
  • 49.Sneddon W. B., Syme C. A., Bisello A., Magyar C. E., Rochdi M. D., Parent J. L., Weinman E. J., Abou-Samra A. B., Friedman P. A. (2003) J. Biol. Chem. 278, 43787–43796 [DOI] [PubMed] [Google Scholar]
  • 50.Mahon M. J., Bonacci T. M., Divieti P., Smrcka A. V. (2006) Mol. Endocrinol. 20, 136–146 [DOI] [PubMed] [Google Scholar]
  • 51.Yamamoto I., Shigeno C., Potts J. T., Jr., Segre G. V. (1988) Endocrinology 122, 1208–1217 [DOI] [PubMed] [Google Scholar]
  • 52.Bringhurst F. R., Juppner H., Guo J., Urena P., Potts J. T., Jr., Kronenberg H. M., Abou-Samra A. B., Segre G. V. (1993) Endocrinology 132, 2090–2098 [DOI] [PubMed] [Google Scholar]
  • 53.Weinman E. J., Hall R. A., Friedman P. A., Liu-Chen L. Y., Shenolikar S. (2006) Annu. Rev. Physiol. 68, 491–505 [DOI] [PubMed] [Google Scholar]
  • 54.Lau A. G., Hall R. A. (2001) Biochemistry 40, 8572–8580 [DOI] [PubMed] [Google Scholar]
  • 55.Tawfeek H. A., Qian F., Abou-Samra A. B. (2002) Mol. Endocrinol. 16, 1–13 [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES