Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2010 Jun 15;285(36):28141–28155. doi: 10.1074/jbc.M109.043679

Knockdown of Zebrafish Lumican Gene (zlum) Causes Scleral Thinning and Increased Size of Scleral Coats*

Lung-Kun Yeh ‡,§, Chia-Yang Liu , Winston W-Y Kao ¶,‖, Chang-Jen Huang **, Fung-Rong Hu ‡‡, Chung-Liang Chien ‡,1, I-Jong Wang ‡‡,2
PMCID: PMC2934679  PMID: 20551313

Abstract

The lumican gene (lum), which encodes one of the major keratan sulfate proteoglycans (KSPGs) in the vertebrate cornea and sclera, has been linked to axial myopia in humans. In this study, we chose zebrafish (Danio rerio) as an animal model to elucidate the role of lumican in the development of axial myopia. The zebrafish lumican gene (zlum) spans ∼4.6 kb of the zebrafish genome. Like human (hLUM) and mouse (mlum), zlum consists of three exons, two introns, and a TATA box-less promoter at the 5′-flanking region of the transcription initiation site. Sequence analysis of the cDNA predicts that zLum encodes 344 amino acids. zLum shares 51% amino acid sequence identity with human lumican. Similar to hLUM and mlum, zlum mRNA is expressed in the eye and many other tissues, such as brain, muscle, and liver as well. Transgenic zebrafish harboring an enhanced GFP reporter gene construct downstream of a 1.7-kb zlum 5′-flanking region displayed enhanced GFP expression in the cornea and sclera, as well as throughout the body. Down-regulation of zlum expression by antisense zlum morpholinos manifested ocular enlargement resembling axial myopia due to disruption of the collagen fibril arrangement in the sclera and resulted in scleral thinning. Administration of muscarinic receptor antagonists, e.g. atropine and pirenzepine, effectively subdued the ocular enlargement caused by morpholinos in in vivo zebrafish larvae assays. The observation suggests that zebrafish can be used as an in vivo model for screening compounds in treating myopia.

Keywords: Extracellular Matrix/Connective Tissue, Extracellular Matrix/Glycosaminoglycans, Extracellular Matrix/Keratan, Proteoglycans Structure, Proteoglycans Synthesis, Axial Myopia, Lumican, Sclera

Introduction

Myopia is a very common ocular disorder, which is characterized by excessive elongation of the eyeball. In Taiwan, the prevalence of myopia is about 84% of schoolchildren aged 16–18, and the prevalence of high myopia (less than −6.0 D) at 18 years of age is 24% in girls and 18% in boys (1). In contrast, the prevalence of high myopia is much lower in Western countries, about 1% of the general population (2). These studies imply that genetic susceptibility of ethnic differences may account for the high prevalence of myopia in Taiwanese.

The sclera contains a collagen-rich extracellular matrix that undergoes significant biochemical and biomechanical remodeling during the development of myopia (3). Linkage studies of high myopia have identified potential loci MYP1 (Xq28) and MYP3 (12q21-23); these loci are within and/or near the loci of the human genome containing several genes that encode small leucine-rich proteoglycans (SLRP),3 i.e. biglycan (Xq27ter), decorin (12q21-22), lumican (12q21.3-22), and DSPG3 (12q21) (4–9). Our previous study showed that certain variations (rs3759223 (C→T)) of single nucleotide polymorphism in the lumican regulatory region may influence the promoter activities of lumican and affect fibrillogenesis in myopic eyes (10). Furthermore, Majava et al. (11) found that a novel single nucleotide polymorphism (c.893–105G→A) of the lumican gene was associated with high myopia. Recently, our prospective case control study also showed that genetic variation in the regulatory domains of the lumican gene (rs3759223 and rs3741834) were associated with high myopia susceptibility among the Han Chinese (12).

Lumican, a member of the SLRP family, is one of the major extracellular components in interstitial collagenous matrices of corneal stroma, sclera, aorta, skin, skeletal muscle, lung, kidney, bone, cartilage, and intervertebral discs (13–20). In corneal stroma, lumican is a KSPG, whereas lumican presents as an under- or unglycanated glycoprotein in other tissues (9, 13, 14, 21). It has been proposed that the horseshoe-shaped lumican core protein binds collagen molecules to modulate collagen fibril diameter, whereas the N-linked glycosaminoglycan chains regulate fibril spacing and stromal hydration for the formation and maintenance of transparent corneas (22–24). The wide distribution of lumican implies that lumican may have multiple functions in tissue morphogenesis and maintenance of tissue homeostasis, besides serving as a regulatory molecule of collagen fibrillogenesis (24). Indeed, lumican plays essential roles in wound healing by modulating epithelial cell migration (25) and in epithelium-mesenchyme transition of the injured lens (26), in addition to regulating collagen fibrillogenesis (20, 25). Lumican-null (Lum−/−) mice and lumican- and fibromodullin-null (Lum−/−Fmod−/−) mice showed alterations of collagen fibril arrangement in interstitial connective tissues. Lum−/− Fmod−/− mice exhibited elongated axial lengths and thin sclera, which are characteristics of high myopia, and lumican-null mice (Lum−/−) also had a slight elongation of the eyeball (27, 28). These findings indicated that these proteoglycans may be directly or indirectly involved in scleral development, resulting in the pathoetiology of high myopia.

The zebrafish is an excellent model to study vertebrate genetics and development (29–31). As a disease model, transgenic zebrafish provide several advantages, such as shorter duration of embryonic development and optically transparent embryos; its development also provides easy access for observation and treatment schemes during embryogenesis in comparison with transgenic mouse models. In this study, we examined the structure, expression pattern, promoter activity, and function of zlum. Our data indicated that lumican is highly conserved between zebrafish and mammals (e.g. human and mouse) in respect to gene structure, expression patterns, and protein function. In particular, ocular enlargement and scleral thinning with changes in the ultrastructure of the sclera were noted when zLum expression was down-regulated by antisense zlum morpholinos (MO). Furthermore, in vivo zebrafish larvae assays were performed to elucidate the potential application of several muscarinic receptor antagonists to attenuate increased scleral coats caused by zlum knockdown with MO. Our results suggest that zebrafish can be used as an in vivo model for screening compounds of treating myopia.

EXPERIMENTAL PROCEDURES

Zebrafish Husbandry

Zebrafish were raised and maintained according to protocols established previously (32). Briefly, adult zebrafish and embryos were maintained at 28.5 °C on a 14-h light and 10-h dark cycle. Embryos were sorted at the different stages required for each experiment and staged according to Kimmel et al. (33). Chorions were removed manually with Dumont Watchmaker's Forceps No. 5. All procedures were approved by the Institutional Animal Care and Use Committee of National Taiwan University and performed in compliance with the Association for Research in Vision and Ophthalmology Statement for Use of Animals in Ophthalmic and Vision Research.

Characterization of zlum

To identify the zebrafish expressed sequence tag clone encoding a putative protein sharing high sequence similarity with the human and mouse SLRP family proteins, we applied the Basic Local Alignment Search Tool (BLAST) analysis of the GenBankTM database using the full-length human lumican cDNA sequence. An ∼4.6-kb NotI/MluI zebrafish genomic DNA fragment containing the 5′ portion of the zebrafish lumican gene was amplified by PCR and subcloned into the pBluescript SK vector (Stratagene, La Jolla, CA). The insert was sequenced, using T3, T7, and walk-in primers, by the DNA core of the Department of Molecular Genetics, National Taiwan University.

The 5′- and 3′-ends of the zlum mRNA were amplified using the 5′-rapid amplification of cDNA end (5′-RACE) and 3′-RACE systems, respectively (Invitrogen). For the 5′-RACE experiment, 1 μg of total RNA from zebrafish eyes was reverse-transcribed with a lumican-specific primer (5′-AAGTAGAGGTATTTGATTCCGGTC-3′) corresponding to a sequence in exon 2 of the zlum gene. The RNA templates were degraded by treatment with an RNase mix. A poly(dCTP) tail was added to the 3′-end of the cDNAs with terminal deoxynucleotidyltransferase. The cDNA was amplified with a second gene-specific primer (5′-GCACAAGAAGGTGATGAAACG-3′) corresponding to a sequence from the junction between exon 1 and 2 in conjunction with the abridged anchor primer (5′-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3′). The resulting PCR products were diluted 100-fold and used as templates to be reamplified with a third gene-specific primer (5′-CAGACTTAGAAGTCCAGCCAAC-3′) in conjunction with the universal amplification primer (5′-CUACUACUACUAGGCCACGCGTCGACTAGTAC-3′). For 3′-RACE, PCRs were performed using a gene-specific primer (5′-GCCTCAGAGATCATCTTTGAATAG-3′) corresponding to a sequence in exon 3 of the zlum gene. The cycling conditions were as follows: 34 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 3 min followed by a 10-min extension at 72 °C at the end of the cycles. Finally, the 5′-RACE and 3′-RACE PCR products were gel-purified, and the sequences were determined with a dideoxy sequencing protocol. The transcription initiation and termination sites of the zlum gene were determined by a sequence comparison between genomic DNA, the 5′-RACE product, and the 3′-RACE product, respectively.

Sequence Alignment and Phylogenetic Analysis of zLum

The amino acid sequences of the open reading frames (ORFs) were initially aligned using the ClustalW program, as described previously (34). The aligned amino acid sequences used were subsequently analyzed with the Neighbor-Joining distance analysis method to construct a phylogenetic tree by using Geneious Pro software (version 4.7). Bootstrap values were calculated from 100 replicates, and values >50% are indicated at each divergence point.

RT-PCR

Unless otherwise specified, RT-PCR reagents used in this procedure were purchased from Promega (Madison, WI). RevertAidTM H Minus First Strand cDNA synthesis kit was purchased from Fermentas (St-Leon-Rot, Germany). Zebrafish cDNA was synthesized using 40 μl of 5× reverse transcription buffer, 20 μl of 0.1 m dithiothreitol, 8 μl of 25 mm dNTPs, 10 μl of RNasin (40 units/ml), 10 μl of 50 mm random hexamers (GE Healthcare), 10 μl of avian myeloblastosis virus reverse transcriptase (9.5 units/μl), and 1 μg of heat-denatured corneal poly(A)+ RNAs. Diethylpyrocarbonate-treated water was added to bring the final reaction volume to 200 μl, and the reaction was incubated at room temperature for 10 min, 42 °C for 90 min, 100 °C for 2 min, and 0 °C for 5 min. Twenty microliters of each of the above RT reactions was added to 80 μl of a PCR mixture containing the following: 8 μl of 10× PCR buffer without MgCl2, 8 μl of 25 mm MgCl2, 10 μl of 20 ng/μl primers, 0.5 μl of Taq polymerase (5 units/μl), and 45.5 μl of H2O. The cycling conditions were as follows: 35 cycles of 94 °C for 1 min, 57 °C for 1 min, and 72 °C for 1 min followed by a 15-min extension at 72 °C at the end of these cycles. Primers used were as follows: CCGCTCGAGCGGATGTTTGCTCTGGGATCCATTC (forward 5′-XhoI cut site) and TCCCCGCGGGGACTATTCAAAGATGATCTCTGAGG (reverse 3′-SacII cut site). The PCR product was confirmed by an appropriate restriction enzyme digestion and analyzed by electrophoresis on a 1.5% agarose gel.

Generation of an Epitope-specific Anti-zebrafish Lumican Antibody

To develop an anti-zLum antibody, an oligopeptide deduced from zLum cDNA was synthesized (N-terminal peptide, CNERNLKFIPIVPTGIKY). The peptides were conjugated to keyhole limpet hemocyanin for antibody production in rabbits. The antibodies were purified through an immune absorbent column of the above zebrafish lumican oligopeptide conjugated to SulfoLink gel (Pierce) according to the manufacturer's instructions. Fractions containing purified anti-zebrafish lumican antibody were pooled and concentrated, and the protein concentration was measured by spectrophotometry at 280 nm.

In Situ Hybridization and Immunohistochemistry

Embryos were fixed in 4% paraformaldehyde in 1× PBS overnight at 4 °C, rinsed with PBS three times, transferred into 100% methanol, and stored at −20 °C until use. To prevent melanization, embryos raised to time points beyond the 24-h post-fertilization (hpf) stage were treated with 0.003% phenylthiourea. Whole mount RNA in situ hybridization was carried out as described previously (34). Sense and antisense digoxigenin-labeled oligonucleotide probes were obtained from Bio Basic Inc. (Ontario, Canada). The oligonucleotide sequence (5′-3′) was GTTTCCATCCAAGCGCAGGGTCCTCAGTCTAGAGTAGTTGACCGGTGAGCTAAATCTGCA. The hybridization signals were visualized with anti-digoxigenin antibody-alkaline phosphatase conjugates using procedures recommended by Roche Applied Science. The sections were counterstained with 0.5% neutral red and mounted. Images were obtained using an AxioCam digital camera on a dissection microscope (Zeiss, Germany).

Adult zebrafish corneal tissues were fixed with 4% paraformaldehyde in PBS and then embedded in paraffin. Paraffinized sections (5 μm) of adult zebrafish corneal tissue were placed on slides and processed for deparaffinization and immunohistochemistry. Before immunostaining, tissue sections were incubated with 0.5 unit/ml keratanase at 37 °C overnight. After blocking with 3% hydrogen peroxide for 30 min, the samples were incubated with either the primary affinity-purified anti-zebrafish lumican antibody (0.1 μg/ml) or monoclonal anti-keratan sulfate antibody, washed in PBS, and then incubated with a biotinylated secondary antibody (goat anti-rabbit IgG). After washing in PBS, sections were incubated with streptavidin-HRP (DAKO, Carpinteria, CA), then washed in PBS, and incubated with the 3′,3-diaminobenzidine chromogen for 5–10 min. Negative control samples were obtained using preimmune rabbit IgG.

Western Blot Analysis

Total proteins were extracted from adult fish eyes using lysis solution (10 ml containing 1 ml of 200 mm HEPES/KOH buffer (pH 7.5), 200 mm sucrose (0.86 g), 50 mm KCl (0.04 g), 2.5 mm MgCl2 (0.005 g), and 100 μl of 100 mm DTT). To remove keratan sulfate chains, protein aliquots were incubated with 0.1 unit/ml endo-β-galactosidase (Sigma) and 1 unit/ml keratanase (Sigma) at 37 °C overnight. The zebrafish corneal extracts were subjected to 10% SDS-PAGE and then probed with the anti-zebrafish lumican N-terminal peptide antibody (0.1 μg/ml) as described above. The immunocomplex was visualized by incubation with goat anti-rabbit IgG alkaline phosphatase conjugate (1:2500 (Novagen, Madison, WI)) and Western Blue®-stabilized substrate (Promega).

Analysis of zlum Promoter by Transgenic Zebrafish

Genomic DNA, both 1.7 and 0.48 kb from the 5′-untranslated region of the zlum gene, were amplified with specific PCR primers and inserted into the multiple cloning sites of pBluescript II SK vectors (Stratagene, La Jolla, CA) containing an EGFP sequence. PCR primers are as follows: 5′-ATAAGAATGCGGCCGCTCCATTAATTCGACAGACCAG-3′ and 5′-ATAAGAATGCGGCCGCAGGTAGACAACACGGTTATGT-3′ (forward primer) and 5′-CGACGCGTGGCTGCACAACTTAAATTAAACCT-3′ (reverse primer). The recombinant plasmids were propagated in Escherichia coli DH5α and purified with a Qiagen plasmid purification maxi kit. Purified plasmid DNA was adjusted to 50 ng/μl in distilled water and microinjected into one-cell stage zebrafish embryos under a dissecting microscope. Embryos with GFP expression were observed and imaged under a fluorescence microscope.

zlum Knockdown by Morpholino Injection

A morpholino-antisense oligonucleotide (Gene Tools, Philomath, OR) was designed to target the 5′-untranslated and/or -flanking regions, including the translation start codon of the respective genes. The MO sequence was designed as follows: zlum-MO, 5′-GATCCCAGAGCAAACATGGCTGCAC-3′. This oligonucleotide complemented the sequence from −8 through +17 with respect to the translation initiation codon. A search of the database did not identify any sequence similarity of known zebrafish genes to zlum-MO. A random sequence MO (RS-MO) serves as a control for zlum-MO, 5′-CCTCTTACCTCAGTTACAATTTATA-3′. This RS-MO was obtained from Gene Tools as a standard control oligonucleotide with no target specificity. Solutions were prepared and injected at the 1–4-cell stage as described by Nasevicius and Ekker (35).

Transmission Electron Microscopy

Corneas of zlum-MO-injected, RS-MO-injected, and wild type zebrafish at 7 and 12 days post-fertilization (dpf) stage were fixed in 50 mm phosphate buffer (pH 7.2) containing 2.5% glutaraldehyde and 2% paraformaldehyde for 24 h at room temperature. After re-fixation in 1% osmium tetraoxide for 4 h at room temperature, the samples were washed in phosphate buffer, dehydrated, and embedded in Epon 812 epoxy resin. Semi-thick sections (100 nm) were stained with toluidine blue. Ultrathin 50-nm sections were collected on 75 mesh copper grids and stained with uranyl acetate and lead citrate, and images were photographed with a Hitachi 7100 transmission electron microscope (TEM) (Hitachi, Tokyo, Japan) equipped with an AMT digital camera.

Image Analysis

Collagen fibril diameters and scleral thickness were measured with Image-Pro Plus version 4.5. Corneal stroma, anterior sclera, and posterior sclera from six zlum-MO and six wild type zebrafish at each 7- and 12-dpf stage were analyzed. Six to 12 areas of collagen fibrils were analyzed for each region in each group, generating 772–1678 measurements for each condition, and 27–84 measurements were generated by analysis of scleral thickness for anterior and posterior sclera in each group at the 12-dpf stage. Collagen fibers and scleral thickness (in micrometers) are represented as the mean ± S.D., and all measurements were analyzed using Student's t tests assuming unequal variances.

In Vivo Zebrafish Larvae Assays for the Eye Size Regulation by Muscarinic Receptor Antagonists

To apply our zebrafish model for myopia drug screening, different muscarinic receptor antagonists, atropine, pirenzepine (M1), and methoctramine (M2) purchased from Sigma were used according to protocols previously described with some modifications (36–38). Briefly, before drug screening test, the maximal sublethal concentration of each drug was determined, and the drug concentration was selected by the survival rate of embryos greater than 60% at 6 dpf stage. Zebrafish larvae were placed in a 96-well plate at 1 fish per well. In this assay, the zlum-MO-injected larvae were exposed to 0.5% atropine, 0.25% pirenzepine, and 0.01% methoctramine starting at 3 dpf for 48 h, respectively, after which the larvae were anesthetized with Tricaine, immobilized in 3% methylcellulose, and observed under dissecting microscopy. The axial length of eyeball, diameter of scleral coat, and the ratio of RPE diameter/scleral coat diameter were measured. Student's t test was used to compare these parameters between control group and treated groups, respectively. The difference of significance was defined as p < 0.05.

RESULTS

Primary Structure of zlum and Alignment Analysis of the Zebrafish Lumican Amino Acid Sequence

We identified zlum by performing a BLAST search of the publicly available zebrafish databases with human LUM. The zlum gene is 11 kb upstream of zkera (keratocan) (Fig. 1). We have isolated clones representing the full open reading frames (ORF) of zebrafish lumican. A cDNA clone encoding the lumican ORF was subcloned into the pBluescript SK vector (Stratagene, La Jolla, CA). The ORF of the zlum gene was 1032 bp long and encoded 344 amino acid residues. The proved nucleotide sequence of the zebrafish lumican gene (zlum) gene was submitted to the GenBankTM database under GenBankTM accession number GQ376197. This sequence has been scanned against the database and is significantly related to the sequence NM_001002059.1, which is derived from BC071347.1 and has not yet been subject to final NCBI review (39).

FIGURE 1.

FIGURE 1.

Schematic diagram showing the organization of the zlum gene. The zebrafish lumican gene is 11 kb upstream from the keratocan gene. It contains three exons and two introns. The figure shows the zebrafish lumican gene drawn to scale. Blank boxes indicate the coding region of the mRNA. The translation start and stop codons are indicated by ATG and TAA, respectively.

The entire genomic DNA sequence of zlum is shown in supplemental Fig. 1. The zlum gene spans ∼4.6 kb (4610 bp) and contains three exons and two introns (Fig. 1). Sequence analysis revealed that exon 1 contains 26 untranslated nucleotides, exon 2 contains 24 noncoding and 880 coding nucleotides, and exon 3 contains 152 bases of coding sequence and 1106 bases of 3′-untranslated sequence. The transcription initiation site marked +1 was determined by 5′-RACE, as described under “Experimental Procedures.” The first translation initiation ATG codon is located at the 844th base downstream of the beginning of exon 1. There was no TATA consensus sequence found in the ∼2.58 kb of proximal 5′-flanking region. The full-length zlum cDNA clone (∼1.9 kb) contains a 1032-bp ORF of 344 amino acids of zLum core protein. Like other SLRP core proteins such as bovine lumican (40), bovine mimecan (41), and mouse keratocan (42), zebrafish lumican consists of three distinct domains, a highly conserved central leucine-rich repeat region flanked by hypervariable N- and C-terminal regions. As shown in supplemental Fig. 1, after the signal peptide (Met to Tyr, the first 20 amino acids), the negatively charged N-terminal domain contains a possibly sulfated tyrosine and four possibly conserved cysteine residues that form intramolecular disulfide bonds, followed by nine tandem leucine-rich repeats (LXXLXLXXNX(L/I)) that are similar to lumican of other species and might mediate binding to other extracellular matrix components and C-terminal globular domains containing two conserved cysteine residues.

Sequence Alignment and Phylogenetic Analysis

For comparison, multiple alignment analysis of the predicted amino acid sequences of zLum with those of other species is shown in supplemental Fig. 2. Using the sequence of zLum, a search for homologous sequences was made with BLAST. The predicted amino acid sequences showed a high homology among lumican core proteins of different species. Zebrafish lumican shared 51% amino acid identity to human, 50% amino acid identity to mouse, and 53% amino acid identity to chicken lumican, respectively. Human lumican shared 86% amino acid identity to mouse and 68% amino acid identity to chicken lumican.

To analyze the evolutionary relationships, a bootstrapped neighbor-joining tree using Jukes-Cantor model was used to illustrate the relationship between different 18 species (Fig. 2). The numbers at the nodes represent the statistical confidence estimated by the bootstrap procedure. Bootstrap values were calculated from 100 replicates, and values of >50% are indicated at each divergence point. The bootstrap values allow inspection of the relationships among clades with low or no ambiguity. The mouse lumican appears to be more closely related to the lumican of human and primates. The zebrafish and chicken lumican are closer to those of Salmo salar and Taeniopygia guttata as compared with human and other mammalian lumican, although they displayed similar structure and >50% homology with those of other species.

FIGURE 2.

FIGURE 2.

Neighbor-joining phylogenic tree of the lumican protein. Phylogenetic tree of lumican protein from 18 different species. The numbers at the nodes represent the statistical confidence estimates computed by the bootstrap procedure. Bootstrap values were calculated from 100 replicates, and values of >50% are indicated at each divergence point. The following are cited: Canis familiaris (dog); Equus caballus (horse); Sus scrofa (pig); Bos taurus (cow); Mus musculus (mouse); Rattus norvegicus (rat); Pan troglodytes (chimpanzee); Macaca fascicularis (macaque); Macaca mulatta (rhesus mulatta); Homo sapiens (human); Pongo abelii (Sumatran orangutan); Ornithorhynchus anatinus (platypus); Salmo salar (Atlantic salmon); Danio rerio (zebrafish); Silurana tropicalis (Xenopus); Taeniopygia guttata (zebra finch); Coturnix japonica (Japanese quail); Gallus gallus (chicken). The tree was constructed with Geneious Pro software (version 4.7).

Spatial Distribution of Zebrafish Lumican mRNA

To further confirm the expression patterns of zlum, RT-PCR analysis was carried out using template cDNAs that were reverse-transcribed from total RNAs from various tissues. The results of RT-PCR revealed that an ∼1-kb RT-PCR product was abundant in most tissues examined, e.g. eye, brain, liver, muscle, and fin (Fig. 3). Whole mount in situ hybridization was used to analyze the expression of zLum mRNA during development. The results revealed that zLum mRNA was widely expressed in many tissues throughout the fish body, and it is highly expressed in the embryonic fore-, mid-, and hindbrain, anterior spinal cord, and eyes at 1 and 3 dpf (Fig. 4, A–C). The corresponding control sense riboprobes showed negative staining in samples (Fig. 4D). Lumican could be found in the corneal stromal layer of adult human and mouse corneas (43). In the zebrafish eye, zLum mRNA was also expressed mainly in the corneal stromal layer (Fig. 4, E and F) and sclera (Fig. 4, G and H), which was similar to other species (17, 44). The corresponding control sense riboprobes showed negligible hybridization signals in samples (Fig. 4, I–L).

FIGURE 3.

FIGURE 3.

zlum expression by RT-PCR analyses. RT-PCR was carried out using total RNAs from adult fish eye (lane 1), brain (lane 2), heart (lane 3), liver (lane 4), gut (lane 5), muscle (lane 6), and fin (lane 7). Note that amplified zlum PCR product could be found not only in the eye but also in other tissues (bottom panel).

FIGURE 4.

FIGURE 4.

In situ hybridization analyses of zLum mRNA in early zebrafish larvae (whole mount) and adult fish cornea (sections). Hybridization signals were demonstrated with anti-digoxigenin antibody-alkaline phosphatase conjugates. A, zLum mRNA was detected in zebrafish larvae (24 hpf). B, in older zebrafish larvae (48 hpf), the zLum mRNA was detected in the eyes and all the major subdivisions of the embryonic central nervous system, including the fore-, mid-, and hindbrain and the spinal cord. C, strong hybridization signals could be also found in corneal tissue at 48 hpf. D, no hybridization signals could be detected in sense probe hybridization group at the 48-hpf larval stage. E, in the zebrafish eye, zLum mRNA was predominantly detected in the corneal stromal layer. F, higher magnification showed that hybridization-positive signals are observed in the corneal stromal layer. G, zLum mRNA was also detected in the periocular extracellular matrix. H, higher magnification showed that hybridization-positive signals are observed in the scleral layer (arrow). I–L, no hybridization signals could be detected in the adult eye (I), cornea (J), or sclera (K and L) using a sense probe in hybridization. Sections were counterstained with fast red. (Scale bars, 100 μm, E, G, I, and K; and 50 μm, F, H, J, and L.)

Characterization and Spatial Distribution of Zebrafish Lumican Protein

An affinity-purified anti-zLum antibody against a synthetic peptide N-terminal peptide (CNERNLKFIPIVPTGIKY), corresponding to the 18 N-terminal amino acid residues deduced from the zlum cDNA, was generated to detect zebrafish lumican. Immunohistochemistry with anti-zLum antibodies showed that similar to human and mouse lumicans, which were both found in the corneal stromal layer (25), zLum was also present mainly in corneal stromal layers (Fig. 5, A and B) and scleral tissue (Fig. 5, C and D), and weak immunostaining signal was also detected in the corneal epithelium and surrounding tissues, such as the iris and ciliary body. No immunoreactivity could be detected in samples incubated with preimmune rabbit IgG (Fig. 5, E–H). Tissue sections probed with anti-keratan sulfate (KS) antibody demonstrated that keratan sulfate-glycosaminoglycan was primarily present in corneal stroma, and little or no immune reactivity could be seen in the corneal epithelium (Fig. 5, I and J). Keratanase treatment abolished the immune reactivity seen in the stroma by the anti-KS antibody (Fig. 5, M and N). It was of interest to note that no immune reactivity was seen in the scleral tissue by the anti-KS antibody (Fig. 5, I, K, and L). This observation indicates that keratan sulfate-glycosaminoglycan is not present in the scleral tissue, consistent with the notion that zLum exists as KSPG in corneal stroma and under-glycanated glycoprotein in other tissues, such as the corneal epithelium and sclera.

FIGURE 5.

FIGURE 5.

Immunohistochemistry staining pattern of zebrafish eye using the epitope-specific anti-zLum antibody. A, lumican protein was found in zebrafish eye tissue. B, note that lumican protein was found mainly in the corneal stromal layer. C and D, lumican protein was also found in the scleral tissue (arrow). E–H, no immunoreactivity was detected in the negative control group. (E, whole eye; F, corneal tissue; G and H, scleral tissue.) I–P, tissue sections treated with (M–P) and without (I–L) keratanase and stained with an anti-keratan sulfate antibody are shown. I and J, tissue sections showed that keratan sulfate chains existed mainly in the corneal stromal layer. K and L, keratan sulfate chains did not exist in the scleral layer. M–P, there was nearly no immunoreactive reaction in tissue sections treated with keratanase and stained with anti-keratan sulfate antibody. (Scale bars, 200 μm, A, E, I, and M; scale bars, 100 μm, C, G, K, and O; scale bars, 50 μm, B, D, F, H, J, L, N, and P; and arrow indicates scleral tissue ins D, H, L, and P.)

To further demonstrate that the lumican in zebrafish cornea is a proteoglycan, total lysates from zebrafish eyes were treated with or without keratanase or endo-β-galactosidase digestion and were then subjected to Western blotting analysis. Fig. 6 shows that a major band of 50 kDa and multiple high molecular mass bands ranging from 60 to 170 kDa were labeled by the antibodies (lane 1) in specimens prepared from eyes without enzyme digestion. By contrast, in specimens treated with keratanase (Fig. 6, lane 2) or endo-β-galactosidase digestion (lane 3), the high molecular mass bands diminished, but the major band at 50 kDa remained. These data indicated that the zLum protein isolated from eyes exists in two forms, as a KSPG and an under-glycanated core protein.

FIGURE 6.

FIGURE 6.

Western blot analysis of zebrafish lumican. Total proteins extracted from adult zebrafish eyes by lysis buffer were subjected to 10% SDS-PAGE followed by Western blotting. Samples without treatment (lane 1) and with either keratanase (lane 2) or endo-β-galactosidase treatment (lane 3) were probed with a rabbit anti-zebrafish lumican antibody. The result showed multiple bands with a similar smearing pattern without enzyme digestion (lane 1), whereas one ∼50-kDa band was visualized after treatment with keratanase (lane 2) and endo-β-galactosidase (lane 3). These data demonstrate that the zebrafish lumican protein contains keratan sulfate chains.

zLum Promoter Activity in Transgenic Zebrafish

To confirm that the genomic DNA clone of the isolated zlum was indeed derived from a functional allele, we examined promoter activity of the 5′-flanking sequence of the zlum genomic DNA, using transgenic zebrafish microinjected with zlumpr1.7-EGFP-bpA and zlumpr0.5-EGFP-bpA, respectively (Fig. 7, B and C). Live transgenic EGFP-positive embryos were screened and selected under a fluorescent microscope. In transgenic zebrafish, 86% (212:246) of the 1.7-kb zlum promoter fragment-injected embryos expressed the EGFP transgene throughout the fish body, including the eyes, at 3 and 7 dpf (Fig. 7, D–F). However, the 0.5-kb promoter fragment of zlum failed to drive EGFP expression in transgenic zebrafish (0:113) (Fig. 7G). These results indicated that the 1.7-kb zlum promoter is able to drive EGFP expression in the transgenic fish, whereas deletion of the 5′ 1.2 kb of the sequence completely eliminates EGFP expression, suggesting that the 1.2-kb region between the 1.7- and 0.5-kb 5′-flanking sequence consists of the necessary regulatory elements controlling lumican promoter activity for zlum expression in vivo.

FIGURE 7.

FIGURE 7.

Generation of transgenic fish harboring zlumpr1.7-EGFP SV40 and zlumpr0.5-EGFPSV40. A, schematic representation of the zebrafish lumican gene. B, structure of zlumpr1.7-EGFP SV40 (3.3 kb). It contains a 1.7-kb 5′-regulatory region of the zlum gene, the untranslated region of exon 1 (844 bp), an SV40 polyadenylation signal, and the pEGFP vector sequence. C, structure of zlumpr0.5-EGFPSV40 (2.0 kb). It contains a 0.5-kb 5′-regulatory region of the zlum gene, the untranslated region of exon 1 (844 bp), an SV40 polyadenylation signal, and the pEGFP vector sequence. D, EGFP expression was observed in the 3 dpf zebrafish after injecting linearized zlumpr1.7-EGFP SV40 DNA fragment. E, under different observation view of the same fish (3 dpf), strong EGFP expression was detected in corneal tissue. F, EGFP was expressed at the 7 dpf stage. G, as a control, no EGFP was detected after injecting the linearized zlumpr0.5-EGFP SV40 DNA fragment.

Effects of zlum Knockdown on Embryonic Development

To investigate zlum function during zebrafish development, MO was microinjected into fertilized zebrafish eggs. Western blot showed that zLum protein decreased after zlum-MO was injected. (Fig. 8A). Retarded development was seen in the zlum-MO embryos as compared with wild type embryos at the 22-hpf stages (Fig. 8, C and D). Significant morphological variations could be readily identified between zlum-MO embryos and control embryos beginning at 6 dpf stage, although there were no identifiable differences in phenotypes between the control RS-MO and wild type embryos. About 58.6% of zlum-MO-injected 7-dpf larvae (277:473) exhibited severe major defects, and less than 1% of the RS-MO negative control group (1:105) and 2.1% of the wild type group with mock injection of PBS alone (9:438) had minor morphological changes. A higher dose of zlum-MO (20 ng/2 μl) produced more severe abnormalities in embryos and led to a higher mortality rate (187 dead embryos out of 211 total injected). The most common abnormalities of the zlum MO-injected group were enlarged eyes, enlarged pericardium, and deformed body shape (Fig. 8, E and F). In particular, significantly enlarged ocular eyeballs were noticed in the zlum-MO-injected group compared with the RS-MO-injected group and wild type group from around the 6-dpf stage. Significant increases in axial lengths were noted in the zlum-MO-injected group compared with those of RS-MO-injected group and wild type group (276.83 ± 27.4 μm (MO) versus 237.04 ± 12.8 μm (RS control) and 276.83 ± 27.4 μm (MO) versus 243.32 ± 10.69 μm (WT), respectively, all p < 0.05) (Fig. 8G). Moreover, the zlum-MO-injected group had larger eyeball diameters in comparison with those of the RS-MO-injected group and wild type group (443.12 ± 58.1 μm (MO) versus 337.58 ± 16.6 μm (control) and 443.12 ± 58.1 μm (MO) versus 342.57 ± 14.31 μm (WT), respectively, all p < 0.05) (Fig. 8H). The control group injected with RS-MO had normal eye morphologies like the mock-injected control group.

FIGURE 8.

FIGURE 8.

Ocular enlargement developed because of the reduction of zLum protein by morpholino microinjection. A, Western blot was carried out using embryo lysates from wild type embryos (1st lane) and zlum-MO-injected 3-dpf embryos (2nd lane). It showed that zLum protein decreased after zlum-MO was injected. B, this figure showed the definition of axial length (AL) and diameter (D) of eye in zebrafish. C, RS-MO-injected embryos showed normal phenotypes as a control group at 22 hpf stages. D, developmental delay was found in the zlum-MO-injected group at 22 hpf stages. E, normal phenotype was noted in the RS-MO-injected group at the 7 dpf stage. F, significant ocular enlargement was noted in the zlum-MO-injected group at the 7 dpf stage. G, significantly increased axial length was noted in the zlum-MO-injected group as compared with the RS-MO-injected embryos and wild type embryos at 7 dpf (respectively, p < 0.05). H, significantly increased eyeball diameter was also noted in the zlum-MO-injected group compared with the RS-MO-injected embryos and wild type embryos at 7 dpf (respectively, p < 0.05).

Decreased Lumican Synthesis Results in Abnormal Collagen Architecture of the Corneal Stroma and Scleral Tissue

To elucidate the function of lumican in regulating collagen fibrillogenesis in the fish eye, eyes of zlum-MO fish were subjected to morphological analysis with TEM at 7 and 12 dpf (n = 6, in each group). Fig. 9 shows the ultrastructural changes of collagenous matrix at corneal stroma (CS), anterior sclera (AS), and posterior sclera (PS) area (as shown in Fig. 9A) between the zlum-MO and wild type group at 12 dpf stage. The fibril architecture of corneal stroma and anterior sclera collagen of the MO-treated group differed from that of the control group and appeared irregularly, with large variations in fibril diameter and fibril spacing in comparison with WT control (compare Fig. 9, C with D and E with F). However, there was no significant difference in the diameter of collagen fibrils at the posterior sclera area between both groups (compare Fig. 9, G with H). For summary of the data of fibril diameter measurement, Fig. 9B shows that there was significant difference in the collagen fibril diameter of corneal stroma and anterior sclera matrix between the wild type and zlum-MO group at 12 dpf stage (CS, 13.80 ± 2.84 nm (WT) versus 22.71 ± 4.46 nm (MO), p < 0.05; AS, 14.91 ± 3.32 nm (WT) versus 20.42 ± 3.63 nm (MO), respectively, p < 0.05), whereas there was no significant difference in the collagen fibril diameter of PS matrix between the wild type and zlum-MO group at 12 dpf stage (PS, 16.34 ± 4.0 nm (WT) versus 16.01 ± 3.71 nm (MO), p > 0.05).

FIGURE 9.

FIGURE 9.

zlum-MO knockdown induces ultrastructural changes in the CS, AS, and PS. A, WT fish at 12 dpf stage in toluidine blue staining. The figure indicates CS, AS, and PS. B, diameters of collagen fibril were analyzed in the corneal stroma, anterior and posterior sclera of 12 dpf-old-wild type, and zlum-MO-injected group. Significant increases in collagen fibril diameter of corneal stroma and anterior sclera are noted in the zlum-MO group, and the diameter of collagen fibril in the posterior sclera is not significantly different in both groups. C–H, morphological comparison of collagen fibril architecture in the corneal stroma (C and D), anterior scleral tissue (E and F), and posterior scleral tissue (G and H) between the control group (C, E, and G) and zlum-MO-injected group (D, F, and H) at the 12 dpf stage. C, TEM micrograph showing regular and smaller fibril architecture of collagen localized in the corneal stroma of the wild type group. D, irregular arrangement and increasing collagen fibril diameter was found in the corneal stroma of the zlum-MO-injected group. E, TEM micrograph showing relatively regular fibril architecture of collagen localized in the anterior sclera of the wild type group. F, irregular collagen fibrils with increasing fibril diameter were noted in the anterior sclera of the zlum-MO-injected group. G, top is adjacent to the retina. TEM micrograph showing fibril architecture of collagen localized in the posterior sclera of the wild type group. H, top is adjacent to the retina. TEM micrograph showing irregular and little collagen fibril architecture was noted in the posterior sclera of the zlum-MO-injected group. (scale bar, C–H, 100 nm.)

Interestingly, a larger size of eyeball accompanied by thinner sclera was noted in the zlum MO-injected larva (Figs. 8F, 9, and 10). Lower magnification of electron microscopy showed that posterior scleral tissue from the wild type group consisted of ∼3–4 layers of fibroblastic cells with newly formed collagen fibrils in relatively regular rearrangements at 7 dpf stage in the posterior sclera (Fig. 10A). However, there was only about one layer of fibroblastic cells in the posterior sclera of MO-treated larva at 7 dpf stage (Fig. 10B), which consisted of very few and irregular collagenous matrix with large variegations in fibril diameters and fibril spacing (Fig. 9H). Fig. 10C shows significant decrease in the posterior scleral thickness found in zlum-MO-treated group (MO) in comparison with that of control group (WT) at 7 dpf stage (PS, 5.93 ± 0.81 μm (WT) versus 1.49 ± 0.68 μm (MO), p < 0.05); in contrast, there was no significant decrease in the thickness of AS thickness between both MO and WT groups (AS, 5.64 ± 1.01 μm (WT) versus 6.19 ± 0.60 μm (MO), p > 0.05)). At 12 dpf stage, the scleral thickness was significantly decreased at both anterior and posterior regions of sclera of MO-treated group (AS, 5.44 ± 0.94 μm (WT) versus 3.36 ± 0.37 μm (MO); and PS, 4.87 ± 1.34 μm (WT) versus 1.36 ± 1.12 μm (MO), p < 0.05) (Fig. 10C).

FIGURE 10.

FIGURE 10.

Ultrastructure changes in scleral thinning in zlum-MO group. A, top is adjacent to the retina. Two to three layers of scleral fibroblastic cells with collagen fibril formation between the layers was found at the posterior sclera of the WT fish at 7 dpf stage. B, top is adjacent to the retina. Only one to two layers of fibroblastic cells at the posterior sclera of the zlum-MO-injected fish at 7 dpf stage is shown. C, scleral thinning was observed obviously in the zlum-MO-injected fish at 7 dpf stage. The phenomenon was much more prominent in the zlum-MO-injected fish at 12 dpf stage. In particular, significant scleral thinning was observed in the posterior sclera of the zlum-MO-injected fish at 7 and 12 dpf stage as compared with wild type group. (Scale bar, A and B, 1.5 μm.)

In conclusion, our results demonstrated that the ultrastructural changes of scleral tissue caused by decreased lumican synthesis with morpholinos were similar to the features found in sclera of mammalian model of high myopia. Taking the advantage that zebrafish eye development can be easily manipulated, e.g. administration of morpholinos and analyzed, we have attempted to develop a protocol of using zebrafish as an experimental model to test the efficacy of compounds, e.g. antagonist of muscarinic receptors, which can potentially modulate the pathoetiology of myopia as described below.

Administration of Muscarinic Receptor Antagonists Reverts the Enlargement of Scleral Coats Caused by zlum Knockdown with Morpholinos

To evaluate if the zebrafish could be an experimental drug screening model for treatment of induced myopia, we tested several different muscarinic receptor antagonists that have been used in treating myopia. As shown in Fig. 11, two drugs out of the three muscarinic receptor antagonists tested, atropine (0.5%) and pirenzepine (0.25%), produced promising outcomes as there was significant reduction in excessive axial elongation and enlarged scleral coats observed in the treated zlum-MO group as compared with those of untreated zlum-MO group (Fig. 11, D, E versus C). However, no obvious improvement was noted in the eye of fish treated with 0.01% methoctramine (M2 receptor antagonist) and injected by zlum-MO at 7 dpf stage (Fig. 11F). To better evaluate the effects of drugs, we measured the diameters of the retina and sclera of the experimental fish (as shown in Fig. 12, A and B). Fig. 12C (1st to 5th lanes) showed a significant reduction in the excessive axial elongation found in the atropine- and pirenzepine-treated groups as compared with those of the untreated zlum-MO group at 7 dpf stage ((205.01 ± 21.10 μm (atropine-treated) and 208.27 ± 23.51 μm (pirenzepine-treated) versus 248.71 ± 20.41 μm (untreated), both have a p < 0.001, n = 55, 64, and 70, respectively)), and there was no significant change in the axial length in the methoctramine-treated group (242.05 ± 21.68 μm, p > 0.05, n = 56). Fig. 12C (6 to 10th lanes) showed a significant decrease in scleral diameters in the atropine- and pirenzepine-treated groups as compared with those of the untreated zlum-MO group at 7 dpf stage ((323.51 ± 46.83 μm (atropine-treated) and 326.18 ± 32.88 μm (pirenzepine-treated) versus 399.07 ± 59.68 μm (untreated), both have p values <0.001, n = 55, 64, and 70, respectively)), whereas there was no significant reduction of scleral diameter in methoctramine-treated group at 7 dpf stage (381.47 ± 43.74 μm, p > 0.05, n = 56).

FIGURE 11.

FIGURE 11.

Zebrafish larvae assay for drug screen. A, normal phenotype of WT fish at 7 dpf stage. B, normal phenotype of RS-MO-injected embryos at 7 dpf stage. C, significantly enlarged eyeball of zlum-MO-injected fish at 7 dpf stage. D, significant decrease in ocular enlargement was noted in the zlum-MO-injected larvae at 7 dpf stage after treating with 0.5% atropine for 2 days. E, decrease in ocular enlargement was also found in the zlum-MO-injected larvae at 7 dpf stage after treating with 0.25% pirenzepine (P) for 2 days. F, no obvious changes in the phenotypes of zlum-MO-injected fish at 7 dpf stage after treating with 0.01% methoctramine (M).

FIGURE 12.

FIGURE 12.

Zebrafish drug screen assay. A and B show the definition of outer margin of RPE (red color) and diameter (D) of scleral coat (green color) in zebrafish. C, significant decrease in excessive axial elongation in the zlum-MO-injected fish at the 7 dpf stage after treating with 0.5% atropine (A) and 0.25% pirenzepine (P), whereas no obvious changes in excessive axial elongation after treating with 0.01% methoctramine (M). 1st lane, WT; 2nd lane, MO + 0.5% atropine; 3rd lane, MO + 0.25% pirenzepine; 4th lane, MO + 0.01% methoctramine; 5th lane, MO. Significant decrease in the diameter of scleral coat of the zlum-MO-injected fish at the 7 dpf stage after treating with 0.5% atropine and 0.25% pirenzepine, whereas no obvious changes in the zlum-MO-injected group treated with 0.01% methoctramine. 6th lane, WT; 7th lane, MO + 0.5% atropine; 8th lane, MO + 0.25% pirenzepine; 9th lane, MO + 0.01% methoctramine; 10th lane, MO. D, significant decrease in the ratio of RPE/scleral coat (%) was noted during ocular enlargement developed due to the reduction of zLum protein. Some muscarinic receptor antagonists (atropine and pirenzepine) attenuate the decreasing ratio of RPE/scleral coat due to the reduction of zLum protein, whereas there was no obvious changes in the decreased ratio of RPE/scleral coat in the methoctramine-treated group. 1st lane, WT; 2nd lane, MO + 0.5% atropine; 3rd lane, MO + 0.25% pirenzepine; 4th lane, MO + 0.01% methoctramine; 5th lane, MO.

Another index of eye enlargement is the ratio of retina diameter to sclera diameter (the smaller the ratio, the larger the eye). Fig. 12D showed that there was a significant decrease in the ratio of the RPE/scleral coat during ocular enlargement caused by the knockdown of zlum ((97.22 ± 3.86% (WT) versus 56.11 ± 4.64% (MO), p < 0.001)). The administration of muscarinic receptor antagonists, 0.5% atropine and 0.25% pirenzepine, effectively attenuate the decrease in the ratio of the RPE/scleral coat caused by zlum knockdown group ((71.29 ± 8.52% (atropine-treated) and 71.33 ± 9.37% (pirenzepine-treated) versus 56.11 ± 4.64% (MO), both have p values < 0.001, respectively)), whereas there was no obvious reversion of the decreased ratio of the RPE/scleral coat in the 0.01% methoctramine-treated zlum-MO larvae (58.19 ± 6.37% (methoctramine-treated) versus 56.11 ± 4.64% (MO), p > 0.05).

DISCUSSION

In this study, we have demonstrated that zebrafish lumican has all the structural features of SLRPs, i.e. a central domain of nine leucine-rich repeats flanked by N- and C-terminal domains with conserved cysteine residues (45). Interestingly, zlum does not have a TATA box in its promoter. Unlike the TATA-less promoters of housekeeping genes, the zebrafish lumican promoter does not have a GC-rich sequence. As shown in Fig. 7, our results implied that zLum exists as a KSPG in corneal stroma but as unglycanated glycoprotein in sclera.

The sclera, a fibrous extracellular matrix, contains irregularly arranged lamellae of collagen fibrils, proteoglycans, elastin, and matrix-secreting fibroblasts (46). The changes of collagen matrix in the sclera caused by increased or decreased proteoglycans may lead to changes in the biomechanical properties of the sclera and may ultimately lead to the alteration of the eyeball shape seen in myopic patients (46–48). Therefore, the sclera is a dynamic tissue rather than a static container of the eye. Moring et al. (49) found that biglycan and lumican mRNA levels were lowered in the sclera during experimentally induced myopia and increased during recovery in the tree shrew model. Lum−/− mice and Lum−/−Fmod−/− mice presented altered collagen fibril diameter in sclera (28, 29), suggesting that these proteoglycans play an important role in the biomechanical properties of the sclera. Our zebrafish model indicated that the altered collagen fibril diameter in corneal stroma and anterior sclera by zlum knockdown with morpholinos is similar to some features of the Lum−/− mice (Fig. 10). Although the collagen fibril diameter was altered in lumican-null mice, there was no ocular enlargement found in Lum−/− mice. Young and co-workers (50) proposed that the phenotypes of Lum−/− mice and Lum−/−Fmod−/− mice may be the possibility of false positive results due to the “hitchhiker” effect (51). However, ocular enlargement and scleral thinning resembling characteristics of high myopia could be readily recognized in our zebrafish model of decreased synthesis of lumican caused by zlum knockdown with morpholinos. This difference can be explained in part by the fact that in mice there are more layers of lamellar organization in anterior and posterior sclera tissue than that of zebrafish, and thus mouse sclera may be more resilient to the loss of lumican and maintain a stable sclera structure seen in Lum−/− mice.

The changes in refractive status in developing myopia are greatest from the elongated axial length of the eyeball rather than from the changes of corneal and anterior lens curvature. In humans, thinning of the scleral tissue, particularly at the posterior pole following the elongation of eyeball, is a characteristic of high myopia, which is compatible with our observations in this zebrafish model in that the most immature collagen fibrils are located in the posterior sclera (46). Therefore, a decrease and/or disruptions of the arrangement of collagen fibrils in this region are highly probable to weaken sclera strength and integrity and result in ocular enlargement seen in our zebrafish model.

In this study, we also found that the number of scleral fibroblasts are significantly reduced at the posterior sclera of zlum-MO injected fish (Fig. 10B). Thus, the lumican protein may also affect the functions of scleral fibroblasts during early development. Kao et al. (24, 52) has suggested that lumican is a matrikine and can modulate fibroblast activities in addition to serving as a regulator of collagen fibrillogenesis.

In this study, we have also established a brand new platform of using the zlum-MO zebrafish as a screen tool for identifying drugs that can affect myopic progression. Recently, Barathi et al. (53) confirmed the presence of all five (M1 to M5) muscarinic acetylcholine receptors in human and mouse scleral fibroblasts. Muscarinic acetylcholine receptors have also been found in the brain of the zebrafish by radioligand binding techniques (37). Liu et al. (54) demonstrated that muscarinic antagonists acted directly on the sclera to prevent myopia development induced by form deprivation in guinea pigs in which myopia progression was accompanied by overexpression of muscarinic acetylcholine receptors (M1 and M4). Furthermore, atropine, a nonselective muscarinic antagonist, and pirenzepine, an antagonist specific for M1, have been found to be effective in clinical trials to prevent myopia progression (55–58). In experimentally induced myopia, including chicks and tree shrews, several muscarinic antagonists have been applied to control ocular growth in different species, although the mechanism of drug effects against myopia remain unclear (59–61). However, variable effects on experimental myopia were shown by applying these muscarinic antagonists when administered intravitreously or by subconjunctival injection (36, 59). In this study, we chose these muscarinic antagonists, i.e. 0.5% atropine, 0.25% pirenzepine, and 0.01% methoctramine, according to a previous study with minor modifications (36). In our results, we showed that the effect of ocular enlargement due to the reduction of zLum protein was blocked by atropine and pirenzepine but not by the M2-selective receptor antagonist methoctramine. Therefore, the observations are similar to the effects of muscarinic receptor antagonists in other myopic animal models and clinical trials. With our model, one can quickly screen drugs that may have therapeutic effects on controlling myopia progression within a week. Another advantage of our model is it can be easily and conveniently carried out by adding the drugs to the embryos kept in 96-well tissue culture plates without any injection procedures to the experimental animals.

In conclusion, we have identified and characterized the zebrafish lumican gene. Lumican is highly conserved during evolution. zlum shares high homology with human and mouse lumican with respect to gene structure, expression pattern, and promoter function. Moreover, we present evidence of ultrastructural changes of ocular enlargement, which are similar to the features of high myopia in humans. We have also established a protocol of drug screening tests for the identification of compounds that are of potential in modulating scleral growth. Therefore, the zebrafish can serve as a potential vertebrate model for studying the early development of corneal and scleral diseases.

Supplementary Material

Supplemental Data

Acknowledgments

We thank Chun-Wen Chen, Yu-Ching Wu, and Ting-Shuan Chiang for their excellent technical assistance throughout the course of this study and Dr. Bei-En Chang and Dr. Huey-Jen Tsai for their critical comments on the manuscript. We also thank Hui-Chun Kung and Ya-Ling Chen for preparation of TEM studies at the Microscope Center of Chang-Gung Memorial Hospital.

*

This work was supported, in whole or in part, by National Institutes of Health Grants EY12486 from NEI (to C.-Y. L.) and EY011845 (to W. W.-Y. K.). This work was also supported in part by National Science Council Grants 923112B002004, 933112B002031, 943112B002007, 932314B002090, 942314B002043, 952314B002149MY3, 972314B182A059, 982314B182A029MY3, and 983112B002040, Research to Prevent Blindness, and Ohio Lions Eye Research Foundation.

Inline graphic

The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. 1 and 2.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) GQ376197.

3
The abbreviations used are:
SLRP
small leucine-rich proteoglycan
MO
morpholino
KSPG
keratan sulfate proteoglycan
EGFP
enhanced GFP
RS-MO
random sequence MO
TEM
transmission electron microscope
RACE
rapid amplification of cDNA end
z
zebrafish
m
mouse
h
human
CS
corneal stroma
AS
anterior sclera
PS
posterior sclera
RPE
retinal pigment epithelium
hpf
h post-fertilization
dpf
days post-fertilization.

REFERENCES

  • 1.Lin L. L., Shih Y. F., Hsiao C. K., Chen C. J., Lee L. A., Hung P. T. (2001) J. Formos. Med. Assoc. 100, 684–691 [PubMed] [Google Scholar]
  • 2.Kempen J. H., Mitchell P., Lee K. E., Tielsch J. M., Broman A. T., Taylor H. R., Ikram M. K., Congdon N. G., O'Colmain B. J. (2004) Arch. Ophthalmol. 122, 495–505 [DOI] [PubMed] [Google Scholar]
  • 3.McBrien N. A., Metlapally R., Jobling A. I., Gentle A. (2006) Invest. Ophthalmol. Vis. Sci. 47, 4674–4682 [DOI] [PubMed] [Google Scholar]
  • 4.Deere M., Johnson J., Garza S., Harrison W. R., Yoon S. J., Elder F. F., Kucherlapati R., Hook M., Hecht J. T. (1996) Genomics 38, 399–404 [DOI] [PubMed] [Google Scholar]
  • 5.Fisher L. W., Heegaard A. M., Vetter U., Vogel W., Just W., Termine J. D., Young M. F. (1991) J. Biol. Chem. 266, 14371–14377 [PubMed] [Google Scholar]
  • 6.Pulkkinen L., Alitalo T., Krusius T., Peltonen L. (1992) Cytogenet. Cell Genet. 60, 107–111 [DOI] [PubMed] [Google Scholar]
  • 7.Young T. L., Ronan S. M., Alvear A. B., Wildenberg S. C., Oetting W. S., Atwood L. D., Wilkin D. J., King R. A. (1998) Am. J. Hum. Genet. 63, 1419–1424 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Schwartz M., Haim M., Skarsholm D. (1990) Clin. Genet. 38, 281–286 [PubMed] [Google Scholar]
  • 9.Grover J., Chen X. N., Korenberg J. R., Roughley P. J. (1995) J. Biol. Chem. 270, 21942–21949 [DOI] [PubMed] [Google Scholar]
  • 10.Wang I. J., Chiang T. H., Shih Y. F., Hsiao C. K., Lu S. C., Hou Y. C., Lin L. L. (2006) Mol. Vis. 12, 852–857 [PubMed] [Google Scholar]
  • 11.Majava M., Bishop P. N., Hägg P., Scott P. G., Rice A., Inglehearn C., Hammond C. J., Spector T. D., Ala-Kokko L., Männikkö M. (2007) Hum. Mutat. 28, 336–344 [DOI] [PubMed] [Google Scholar]
  • 12.Chen Z. T., Wang I. J., Shih Y. F., Lin L. L. (2009) Ophthalmology 116, 1920–1927 [DOI] [PubMed] [Google Scholar]
  • 13.Funderburgh J. L., Funderburgh M. L., Mann M. M., Conrad G. W. (1991) J. Biol. Chem. 266, 24773–24777 [PubMed] [Google Scholar]
  • 14.Funderburgh J. L., Caterson B., Conrad G. W. (1987) J. Biol. Chem. 262, 11634–11640 [PubMed] [Google Scholar]
  • 15.Iozzo R. V., Murdoch A. D. (1996) FASEB J. 10, 598–614 [PubMed] [Google Scholar]
  • 16.Knudson C. B., Knudson W. (2001) Semin. Cell Dev. Biol. 12, 69–78 [DOI] [PubMed] [Google Scholar]
  • 17.Ying S., Shiraishi A., Kao C. W., Converse R. L., Funderburgh J. L., Swiergiel J., Roth M. R., Conrad G. W., Kao W. W. (1997) J. Biol. Chem. 272, 30306–30313 [DOI] [PubMed] [Google Scholar]
  • 18.Raouf A., Ganss B., McMahon C., Vary C., Roughley P. J., Seth A. (2002) Matrix Biol. 21, 361–367 [DOI] [PubMed] [Google Scholar]
  • 19.Iozzo R. V., Danielson K. G. (1999) Prog. Nucleic Acid Res. Mol. Biol. 62, 19–53 [DOI] [PubMed] [Google Scholar]
  • 20.Chakravarti S., Magnuson T., Lass J. H., Jepsen K. J., LaMantia C., Carroll H. (1998) J. Cell. Biol. 141, 1277–1286 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Funderburgh J. L., Funderburgh M. L., Mann M. M., Conrad G. W. (1991) Biochem. Soc. Trans. 19, 871–876 [DOI] [PubMed] [Google Scholar]
  • 22.Iozzo R. V. (1999) J. Biol. Chem. 274, 18843–18846 [DOI] [PubMed] [Google Scholar]
  • 23.Conrad G. W. (2000) in Carbohydrates in Chemistry and Biology (Ernst B., Hart G. W., Sinaý P. eds) pp. 717–727, Wiley Interscience, New York [Google Scholar]
  • 24.Kao W. W., Funderburgh J. L., Xia Y., Liu C. Y., Conrad G. W. (2006) Exp. Eye Res. 82, 3–4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Saika S., Shiraishi A., Liu C. Y., Funderburgh J. L., Kao C. W., Converse R. L., Kao W. W. (2000) J. Biol. Chem. 275, 2607–2612 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Saika S., Miyamoto T., Tanaka S., Tanaka T., Ishida I., Ohnishi Y., Ooshima A., Ishiwata T., Asano G., Chikama T., Shiraishi A., Liu C. Y., Kao C. W., Kao W. W. (2003) Invest. Ophthalmol. Vis. Sci. 44, 2094–2102 [DOI] [PubMed] [Google Scholar]
  • 27.Austin B. A., Coulon C., Liu C. Y., Kao W. W., Rada J. A. (2002) Invest. Ophthalmol. Vis. Sci. 43, 1695–1701 [PubMed] [Google Scholar]
  • 28.Chakravarti S., Paul J., Roberts L., Chervoneva I., Oldberg A., Birk D. E. (2003) Invest. Ophthalmol. Vis. Sci. 44, 2422–2432 [DOI] [PubMed] [Google Scholar]
  • 29.Udvadia A. J., Linney E. (2003) Dev. Biol. 256, 1–17 [DOI] [PubMed] [Google Scholar]
  • 30.Xu Y. S., Kantorow M., Davis J., Piatigorsky J. (2000) J. Biol. Chem. 275, 24645–24652 [DOI] [PubMed] [Google Scholar]
  • 31.Soules K. A., Link B. A. (2005) BMC Dev. Biol. 5, 12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Westerfield M. (1995) The Zebrafish Book, University of Oregon Press, Eugene, OR [Google Scholar]
  • 33.Kimmel C. B., Ballard W. W., Kimmel S. R., Ullmann B., Schilling T. F. (1995) Dev Dyn. 203, 253–310 [DOI] [PubMed] [Google Scholar]
  • 34.Yeh L. K., Liu C. Y., Chien C. L., Converse R. L., Kao W. W., Chen M. S., Hu F. R., Hsieh F. J., Wang I. J. (2008) J. Biol. Chem. 283, 506–517 [DOI] [PubMed] [Google Scholar]
  • 35.Nasevicius A., Ekker S. C. (2000) Nat. Genet. 26, 216–220 [DOI] [PubMed] [Google Scholar]
  • 36.Luft W. A., Ming Y., Stell W. K. (2003) Invest. Ophthalmol. Vis. Sci. 44, 1330–1338 [DOI] [PubMed] [Google Scholar]
  • 37.Williams F. E., Messer W. S. (2004) Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 137, 349–353 [DOI] [PubMed] [Google Scholar]
  • 38.Berghmans S., Butler P., Goldsmith P., Waldron G., Gardner I., Golder Z., Richards F. M., Kimber G., Roach A., Alderton W., Fleming A. (2008) J. Pharmacol. Toxicol. Methods 58, 59–68 [DOI] [PubMed] [Google Scholar]
  • 39.Strausberg R. L., Feingold E. A., Grouse L. H., Derge J. G., Klausner R. D., Collins F. S., Wagner L., Shenmen C. M., Schuler G. D., Altschul S. F., Zeeberg B., Buetow K. H., Schaefer C. F., Bhat N. K., Hopkins R. F., Jordan H., Moore T., Max S. I., Wang J., Hsieh F., Diatchenko L., Marusina K., Farmer A. A., Rubin G. M., Hong L., Stapleton M., Soares M. B., Bonaldo M. F., Casavant T. L., Scheetz T. E., Brownstein M. J., Usdin T. B., Toshiyuki S., Carninci P., Prange C., Raha S. S., Loquellano N. A., Peters G. J., Abramson R. D., Mullahy S. J., Bosak S. A., McEwan P. J., McKernan K. J., Malek J. A., Gunaratne P. H., Richards S., Worley K. C., Hale S., Garcia A. M., Gay L. J., Hulyk S. W., Villalon D. K., Muzny D. M., Sodergren E. J., Lu X., Gibbs R. A., Fahey J., Helton E., Ketteman M., Madan A., Rodrigues S., Sanchez A., Whiting M., Madan A., Young A. C., Shevchenko Y., Bouffard G. G., Blakesley R. W., Touchman J. W., Green E. D., Dickson M. C., Rodriguez A. C., Grimwood J., Schmutz J., Myers R. M., Butterfield Y. S., Krzywinski M. I., Skalska U., Smailus D. E., Schnerch A., Schein J. E., Jones S. J., Marra M. A. (2002) Proc. Natl. Acad. Sci. U.S.A. 99, 16899–16903 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Funderburgh J. L., Funderburgh M. L., Brown S. J., Vergnes J. P., Hassell J. R., Mann M. M., Conrad G. W. (1993) J. Biol. Chem. 268, 11874–11880 [PubMed] [Google Scholar]
  • 41.Funderburgh J. L., Corpuz L. M., Roth M. R., Funderburgh M. L., Tasheva E. S., Conrad G. W. (1997) J. Biol. Chem. 272, 28089–28095 [DOI] [PubMed] [Google Scholar]
  • 42.Liu C. Y., Shiraishi A., Kao C. W., Converse R. L., Funderburgh J. L., Corpuz L. M., Conrad G. W., Kao W. W. (1998) J. Biol. Chem. 273, 22584–22588 [DOI] [PubMed] [Google Scholar]
  • 43.Liu C. Y., Zhu G., Converse R., Kao C. W., Nakamura H., Tseng S. C., Mui M. M., Seyer J., Justice M. J., Stech M. E., Hansen G. M., Kao W. W. (1994) J. Biol. Chem. 269, 24627–24636 [PubMed] [Google Scholar]
  • 44.Johnson J. M., Young T. L., Rada J. A. (2006) Mol. Vis. 12, 1057–1066 [PubMed] [Google Scholar]
  • 45.Iozzo R. V. (1997) Crit. Rev. Biochem. Mol. Biol. 32, 141–174 [DOI] [PubMed] [Google Scholar]
  • 46.Rada J. A., Shelton S., Norton T. T. (2006) Exp. Eye Res. 82, 185–200 [DOI] [PubMed] [Google Scholar]
  • 47.Phillips J. R., Khalaj M., McBrien N. A. (2000) Invest. Ophthalmol. Vis. Sci. 41, 2028–2034 [PubMed] [Google Scholar]
  • 48.Siegwart J. T., Jr., Norton T. T. (1999) Vision Res. 39, 387–407 [DOI] [PubMed] [Google Scholar]
  • 49.Moring A. G., Baker J. R., Norton T. T. (2007) Invest. Ophthalmol. Vis. Sci. 48, 2947–2956 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Paluru P. C., Scavello G. S., Ganter W. R., Young T. L. (2004) Mol. Vis. 10, 917–922 [PubMed] [Google Scholar]
  • 51.Morel L. (2004) PLoS Biol. 2, E241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Kao W. W. (2006) Cornea 25, S7–S19 [DOI] [PubMed] [Google Scholar]
  • 53.Barathi V. A., Weon S. R., Beuerman R. W. (2009) Mol. Vis. 15, 1277–1293 [PMC free article] [PubMed] [Google Scholar]
  • 54.Liu O., Wu J., Wang X., Zeng J. W. (2007) Mol. Vis. 13, 1234–1244 [PubMed] [Google Scholar]
  • 55.Shih Y. F., Hsiao C. K., Chen C. J., Chang C. W., Hung P. T., Lin L. L. (2001) Acta Ophthalmol. Scand. 79, 233–236 [DOI] [PubMed] [Google Scholar]
  • 56.Tan D. T., Lam D. S., Chua W. H., Shu-Ping D. F., Crockett R. S. (2005) Ophthalmology 112, 84–91 [DOI] [PubMed] [Google Scholar]
  • 57.Chou A. C., Shih Y. F., Ho T. C., Lin L. L. (1997) J. Ocul. Pharmacol. Ther. 13, 61–67 [DOI] [PubMed] [Google Scholar]
  • 58.Cottriall C. L., McBrien N. A., Annies R., Leech E. M. (1999) Ophthalmic Physiol. Opt. 19, 327–335 [PubMed] [Google Scholar]
  • 59.Cottriall C. L., McBrien N. A. (1996) Invest. Ophthalmol. Vis. Sci. 37, 1368–1379 [PubMed] [Google Scholar]
  • 60.Stone R. A., Lin T., Laties A. M. (1991) Exp. Eye Res. 52, 755–758 [DOI] [PubMed] [Google Scholar]
  • 61.McBrien N. A., Moghaddam H. O., Reeder A. P. (1993) Invest. Ophthalmol. Vis. Sci. 34, 205–215 [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Data

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES