Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2010 Jun 7;54(9):3569–3577. doi: 10.1128/AAC.00057-10

Genomewide Analysis of Divergence of Antibiotic Resistance Determinants in Closely Related Isolates of Acinetobacter baumannii▿

Mark D Adams 1,3,*, E Ricky Chan 1, Neil D Molyneaux 1, Robert A Bonomo 2,3,4
PMCID: PMC2934971  PMID: 20530228

Abstract

Multidrug resistance has emerged as a significant concern with infections caused by Acinetobacter baumannii. Ample evidence supports the involvement of mobile genetic elements in the transfer of antibiotic resistance genes, but the extent of variability and the rate of genetic change associated with the acquisition of antibiotic resistance have not been studied in detail. Whole-genome sequence analysis of six closely related clinical isolates of A. baumannii, including four from the same hospital, revealed extensive divergence of the resistance genotype that correlated with observed differences in antimicrobial susceptibility. Resistance genes associated with insertion sequences, plasmids, and a chromosomal resistance gene island all showed variability. The highly dynamic resistance gene repertoire suggests rapid evolution of drug resistance.


Acinetobacter baumannii has garnered significant attention as a cause of infection among military personnel injured in Iraq and Afghanistan and is also a rapidly emerging nosocomial pathogen in hospitals throughout the world (1, 8, 24, 28, 29, 38). In many health care facilities, more than two-thirds of A. baumannii infections are resistant to at least three chemical classes of antimicrobial compounds and are considered multidrug resistant (MDR), leaving patients and doctors few options for therapy (18, 28). Better understanding of the mechanisms of acquisition of multidrug resistance and the rate and nature of genetic change is essential for developing strategies to combat the spread of MDR A. baumannii.

Comparative analysis of genome sequences of A. baumannii isolates revealed considerable genetic variability among recent isolates, with poor correlation between genetic relatedness and pattern of antimicrobial susceptibility (2, 14, 39). Mobile genetic elements are known to contribute to antibiotic resistance by facilitating resistance gene transfer and by upregulating transcription (7). A “resistance island” (RI) of variable composition is present in the MDR A. baumannii strains analyzed to date (2, 11, 15, 31). The RI is a complex composite transposon that carries laterally transferred genes related to antibiotic and heavy metal resistance. In addition, plasmid-borne and insertion sequence (IS)-associated resistance genes are common (3, 4, 19, 36). Several families of insertion sequences in A. baumannii have been described, including ISAba1, which is frequently associated with β-lactamase genes and has intrinsic mobilization capability (23, 33).

In general, outbreaks occurring in hospitals are presumed to be clonal, with patient-to-patient transmission of essentially identical strains. Treatment decisions are based on a combination of in vitro susceptibility assays and empirical results based on patient outcomes. Molecular strain typing methods such as pulsed-field gel electrophoresis (PFGE) and PCR combined with electrospray ionization-mass spectrometry (PCR/ESI-MS) are used to assess the relatedness of isolates (8). Based on PFGE and PCR/ESI-MS sequence typing, the large outbreak at Walter Reed Army Medical Center (WRAMC) was clearly polyclonal (14, 39). Furthermore, a diversity of resistance phenotypes was observed, even among isolates with identical molecular typing signatures. This suggests that either the molecular typing methods lack the resolution necessary to distinguish closely related strains or the resistance gene repertoire can change rapidly by lateral gene transfer (or both).

Recently, genomewide studies enabled by high-throughput DNA sequencing have enhanced our ability to evaluate the microevolution of bacterial pathogens (9), for example, by characterizing the appearance of point mutations associated with the development of antibiotic resistance over the course of an infection in a single patient (25), the worldwide distribution of pathogens with reasonably stable genomes (13, 22), and the extent of evolution in more highly variable genomes (17). These and other studies have led to the pan-genome concept, in which “core” genes are shared by all isolates of a species and “accessory” genes are present in a subset of isolates (12, 21). Here we describe a genomewide analysis of six closely related A. baumannii isolates belonging to European clone type I (27), including four from WRAMC. Our results illustrate the extent to which mobile genetic elements have caused a rapid divergence of resistance genotype and phenotype.

MATERIALS AND METHODS

Bacterial strains and DNA sequencing.

The complete genome sequences of A. baumannii AYE, AB307-0294, and AB0057 have been determined (2, 37). The MDR isolates AB056, AB058, and AB059 have been previously described (14). A summary of relevant antibiotic resistance traits is given in Table 1. Assignment to strain types was performed by PCR/ESI-MS for AB056, AB0057, AB058, and AB059 (14) and by comparison of the genome sequence to the sequence type patterns (14) for AYE and AB307-0294. Genomic DNA was prepared using a DNeasy kit from Qiagen, and libraries were prepared for sequencing using kits supplied by Illumina (San Diego, CA), exactly as described by the manufacturer. Illumina sequencing was performed in the Genomics Core Facility at Case Western Reserve University. Single-end 36-base reads were obtained for each genome.

TABLE 1.

Summary of antimicrobial resistance of WRAMC isolates

Characteristic AB307-0294 AYE AB058 AB059 AB056 AB0057
Source Buffalo, NY France WRAMC WRAMC WRAMC WRAMC
Culture date 1994 2001 May 2003 January 2004 February 2004 August 2004
Resistance phenotypea
    AMP + + + + + +
    CIP + + + + +
    CAZ + + + + +
    FEP + + + + +
    AMK + + +
    TOB + +
    SAM NDb + + +
    MEM + + +
    IPM + + +
PCR-positive genes
    Tn6018 − + + + + +
    aadB − + + + − −
    topA − − + + + +
    tetA − + − + − +
    merAC − + − + − +
    merE-R − + − + − +
    cat − + − + − +
    blaTEM − − − + − +
    int1 − + − + + +
    aadA1 − + − + + +
    aacC1 − + − + + +
    aac/aad1 − + − + + +
    blaOXA-23 − − − + + +
a

AMP, ampicillin; CIP, ciprofloxacin; CAZ, ceftazidime; FEP, cefepime; AMK, amikacin; TOB, tobramycin; SAM, ampicillin-sulbactam; MEM, meropenem; IPM, imipenem.

b

ND, not determined.

Sequence data analysis.

The alignment program Maq (16) was used to align the Illumina reads to the sequence of each published genome. This information was used to determine the presence and absence of specific open reading frames (ORFs) in each draft genome sequence. Each genome set of reads was also assembled independently using the de novo sequence assembly program Velvet (41). A series of values was used for the word size parameter k, with the setting that resulted in the smallest number of contigs used for further analysis. Sequences and sequence assemblies were compared using Mummer (6). The percentage of each genome represented in the assembled contigs was estimated based on the Mummer alignments of the draft genomes with AB0057.

Phylogenetic analysis.

AB0057 ORFs were aligned to each genome. DNA sequences from a set of 1,927 ORFs with alignments at ≥95% nucleotide identity and spanning the full length of the ORF in all six genomes were aligned using ClustalW (5). The concatenated alignment was analyzed in PHYLIP (10), and an unrooted tree was inferred using the neighbor-joining algorithm with 1,000 bootstrap replicates.

Verification of assembly structure by PCR.

Eight primer pairs (Table 2) spanning key repeat regions or gaps between contigs were used to amplify segments of the RI and aphA6 region to confirm the sequence structures hypothesized based on computational analysis.

TABLE 2.

PCR primers

Primer names Primer sequences (5′ to 3′) Purpose
pACICU2A, pACICU2B TTTAAAACCCATTTACATCTCCTT, AAAACCGCTCGAAAAGATCA Determine presence of ISAba125 at 34.9-36.0 kbp
aphA, aphB TTTGACGTTGCTCTTGTTGC, TGCACAATGTGATGGAGTCT Test insertion at 10.7 kb of pACICU2
aphC, aphD TCAAGCTCTAGCCGAAAACAA, TTCATCTATTTCAAATTCATCTTGC Test insertion at 21.9-22.3 kb of pACICU2
aphE, aphF CATTTTCTTTCGCATACAGCA, TTTTTGCAATTTCAGCTTGAG Test assembly across aphA6 region
aphK, aphJ CAGGGGTATATGATGCACTTGA, ATCACATATCCCGCTTCTGG Test assembly across aphA6 region
aphG, aphL GAGGCCCGCATTTAATCTCT, ATGGGTGGCAAAGTAAGGTT Test insertion at 21.9-22.3 kbp of pACICU2
RIB, RI3 AGGTGACGATTTCCGATGAC, CTCAAGTAGATTGCGAATCGTG Test RI structure in AB056, AB058
RIE, RI6 TTGCTCGGCCTTCAGCCTGC, GCCTTGCTCCGCAGCGGTTA Test RI structure in AB056, AB058

Nucleotide sequence accession numbers.

The Whole Genome Shotgun projects described in “Sequence data analysis” above have been deposited at DDBJ/EMBL/GenBank under accession numbers ADGZ00000000, ADHA00000000, and ADHB00000000.

RESULTS AND DISCUSSION

Our goal is to understand the highly dynamic resistance gene repertoire of A. baumannii. To that end, we performed genomewide comparative analyses of six closely related strains. Four isolates from an A. baumannii outbreak at WRAMC between 2003 and 2004 were identified as belonging to ESI-MS sequence type 15 (ST15), suggesting a high degree of similarity to one another (14, 39) and to A. baumannii strain AYE, which was responsible for an outbreak in France in 2001 (11, 30, 37). AB307-0294 belongs to ST46, which differs from ST15 by one nucleotide across 1,679 bp assayed by PCR/ESI-MS; it was included in the analysis since it is closely related to the ST15 strains based on genomewide analysis (2) and because it is largely drug susceptible and so serves as a useful comparison. The antibiotic susceptibility profile among the MDR ST15 isolates has considerable overlap, but differences were observed, and each strain is distinct at the level of resistance genotype based on PCR analysis of specific resistance determinants (Table 1). In order to further characterize the relatedness among these isolates and to assess the context of the genetic differences in resistance, we collected and analyzed genome sequences for the WRAMC strains.

The genome sequences of AB0057, AYE, and AB307-0294 were previously completed to high quality (2, 37) and serve as a reference for comparison. We obtained “draft”-quality genome sequence data from the other three isolates (AB056, AB058, and AB059). Table 3 provides summary statistics on the sequencing and assembly.

TABLE 3.

Features of draft genome assemblies

Parameter Value for isolate:
AB056 AB058 AB059
No. of reads passing quality filter 5,060,940 6,539,630 4,831,329
No. of reads mapped to AB0057 chromosome 4,615,115 5,527,077 4,369,180
No. of Velvet contigs (>100 bases) 1,354 1,416 1,540
Velvet N50 (kbp) 11.3 8.3 9.8
Assembled length (bp) 3,857,297 3,774,325 3,928,094
Avg fold coverage 45.7 57.4 40.7
Estimated % coverage 99.3 99.5 99.2

The sequence data were analyzed in two ways. First, each read was mapped to the AB0057, AYE, and AB307-0294 genomes, and the coverage of each predicted open reading frame was determined. The number of AB0057 ORFs without sequence coverage ranged from zero (AB059) to 19 (AB056) to 354 (AB058). Second, a de novo assembly of each data set was performed using Velvet (41) to characterize unique sequences and sequence organization in each isolate. Genome sequencing results confirmed the presence of specific resistance determinants that had been inferred previously on the basis of PCR amplification (Table 1) and clarified their genomic context. We consider the roles of three classes of mobile genetic elements, i.e., the RI, IS elements, and plasmids, in contributing to antibiotic resistance and the roles of endogenous chromosomal genes. We then address other genomic changes and the broader relationships of the ST15 strains.

Resistance island structure.

The AB059 RI is identical to AbaR3 (AB0057). Each other isolate has a distinct genetic complement in the resistance island (Fig. 1). The RIs in AB056 and AB058 have been designated AbaR9 and AbaR10, respectively. AbaR9 is missing 19 RI ORFs relative to AbaR3, including the genes tetA, cat, and blaTEM-1 (AB57_0270 to AB57_0288). AbaR10 is missing 26 ORFs compared with AbaR3. The missing region is a superset of the genes that are absent from AbaR9 and includes the additional loss of the aminoglycoside-modifying enzyme genes aacC1 and aadA1, leaving a sulfonamide-resistant dihydropteroate synthase gene as the only resistance gene located on the RI.

FIG. 1.

FIG. 1.

Diagram of the resistance island. The AB0057 RI is shown, with boxed areas indicating regions that are absent from AbaR9 in AB056 (solid) and from AbaR10 in AB058 (solid and dashed). (Adapted from reference 31 with permission.)

Although it is not possible to firmly establish whether AbaR9 and AbaR10 represent independent or sequential deletions from a common larger progenitor or whether the RIs have been built by independent insertions in a smaller progenitor, the nature of the junction sequences argues for deletions rather than insertions. In AbaR9, a 5′-ward deletion mediated by an IS26 element is likely. In AbaR10, a deletion mediated by recombination in the two class I integron 3′ conserved sequence (3′CS) regions would explain the observed structure. Structurally, AbaR9 and AbaR10 are more closely related to AbaR3 than to AbaR1 (AYE). Four additional A. baumannii RI sequences with distinct structures and gene complements support the dynamic nature of the RI (15, 31, 32).

Mobile genetic elements: insertion sequences.

The locations of ISAba1 and ISAba125 insertion sequences in the draft genomes were determined (Tables 4 and 5). The ISAba1 sequence was represented as a single contig in each Velvet assembly, representing a collapsed consensus sequence of multiple IS copies. By using a high E-value cutoff, however, we were able to map short junction fragments located at regions where unique genome segments abut the beginning or end of the ISAba1 sequence.

TABLE 4.

Insertion sequence locations in ST15 strains: ISAba1 locations

AB0057 location (bp) Present in:
Gene(s) Knockout Left Right
AB0057 AB056 AB059 AB058 AYE AB307-0294
6679 Yes Yes Yes AB57_0006/0013 RND-type efflux pump AdeT
11014 Yes Yes Yes AB57_0006/0013 RND-type efflux pump AdeT
553764 Yes Yes Yes AB57_0513/0516 ABC transporter ATP-binding protein Uup
584630 Yes Yes Yes AB57_0548/0557 Sulfate permease
588255 Yes Yes Yes AB57_0548/0557 Sulfate permease
976679 Yes Yes Yes AB57_0915/0918 Hypothetical protein Hypothetical protein
2837512 Yes Yes Yes ABAYesE1139 Hypothetical protein
2182134 Yes AB57_2102/2103 Putative acid phosphatase Hypothetical protein
567008 Yes AB57_0529 Monovalent cation transporter
42837 Yes AB57_0043/0044 Phosphoribosylaminoimidazole carboxylase, ATPase subunit Transglycolase
327369 Yes AB57_0307 Mg chelatase-related protein
343044 Yes AB57_0323/0324 Type 4 fimbria expression regulatory protein PilR Sensor protein histidine kinase
1754856 Yes AB57_1667/1668 Cytochrome bd ubiquinol oxidase, subunit I Conserved hypothetical protein
1795889 Yes AB57_1703 Lysine exporter protein
1891168 Yes AB57_1804 Type 4 fimbrial biogenesis protein
1927343 Yes AB57_1839 Hypothetical protein
2165299 Yes AB57_2084 AdeS
2234941 Yes AB57_2153/2154 Antibiotic biosynthesis monooxygenase Conserved hypothetical protein
2873291 Yes Yes AB57_2795/2796 GTP cyclohydrolase I Beta-lactamase AmpC
3100988 Yes AB57_3010 Hypothetical protein
3874912 Yes AB57_3756/3757 Acetate coenzyme A ligase Conserved hypothetical protein
3932193 Yes AB57_3812 Hypothetical protein
29318 Yes AB57_0028/0029 Cation diffusion facilitator family transporter Thiol:disulfide interchange protein DsbC
67617 Yes AB57_0062/0063 Riboflavin biosynthesis protein RibF C4-dicarboxylate transporter/malic acid transport protein
601852 Yes AB57_0567/0568 Alkaline phosphatase Twin arginine-targeting protein translocase TatC
1219316 Yes AB57_1148 TonB-dependent siderophore receptor
1224004 Yes AB57_1151 Hypothetical protein
1229984 Yes AB57_1155-AB57_1187 32 genes
1502475 Yes AB57_1426 Transcriptional regulator
1523389 Yes AB57_1443 RHS family protein
1626096 Yes AB57_1540/1541 Hypothetical protein Hypothetical protein
1835470 Yes AB57_1745 Fimbrial biogenesis outer membrane usher protein
2087097 Yes AB57_1996/1997 Conserved hypothetical protein Phospholipase D/ transphosphatidylase
2089231 Yes AB57_1998 Hypothetical protein
2221018 Yes AB57_2137 Conserved hypothetical protein
2348892 Yes AB57_2261/2262 Conserved hypothetical protein Cytochrome d ubiquinol oxidase subunit I
2848450 Yes AB57_2777/2778 Superoxide dismutase [Fe] Conserved hypothetical protein
2977293 Yes AB57_2884/2885 Hypothetical protein Fatty acid desaturase
3540209 Yes AB57_3433 Conserved hypothetical protein
3856951 Yes AB57_3743/3744 GGDEF family protein Hypothetical protein

TABLE 5.

Insertion sequence locations in ST15 strains: ISAba125 locations in AB058

AB0057 location (bp) AYE location Gene(s) Knockout Left Right
NAa Hypothetical protein AphA6
NA AphA6 Hypothetical protein
3849585 ABAYE3813 Polysaccharide polymerase
257283 AB57_0237 Outer membrane protein OprE3
919546 AB57_0855/6 Trehalose-phosphotase Biotin biosynthesis protein BioH
1559510 AB57_1478 Hypothetical protein
1836640 AB57_1745/6 Fimbrial biogenesis outer membrane usher protein Pilus assembly chaperone
2224066 AB57_2143 Hypothetical protein
2508844 AB57_2422 Conserved hypothetical protein
2912916 AB57_2829 Hypothetical protein
3671716 AB57_3564 Hypothetical protein
3971913-3971985 AB57_3850 Histidine kinase
a

NA, not applicable; the ISAba125 element is located on a plasmid that is not present in AB0057 or AYE.

ISAba1-flanked β-lactamase genes blaADC-7 and blaOXA-23 were found in AB056 and AB059 in the same chromosomal positions as in AB0057, but both of these insertion sequence cassettes were not present in AB058. The presence of blaOXA-23 results in resistance to the carbapenems meropenem and imipenem in AB056 and AB059. Ampicillin/sulbactam resistance in AB0057, AB056, and AB059 may be due to a combination of overexpression of blaADC-7 driven by the adjacent ISAba1 promoter and the blaTEM-1 gene located on the RI; neither of these resistance genes is present in AB058 or AYE.

Seven of eight ISAba1 insertion locations in AB0057 are preserved in AB056 and AB059, and each of these three genomes appears to contain one unique insertion site for ISAba1. In contrast, AB058 carries 13 ISAba1 elements, and none of them is at the same location as in AB0057. AB058 ISAba1 insertion sites also have only a single overlap with the 21 ISAba1 insertion sites in the AYE genome: both have an insertion at precisely the same location immediately upstream of the chromosomal blaADC-7 gene. An ISAba1 insertion in the adeS gene, which encodes a regulator of the efflux pump AdeABC, may contribute to the resistance phenotype (34).

AB058 has 12 copies of the ISAba125 element. As discussed below, two of these flank an aphA6 gene on the plasmid pAB059, and the remainder are chromosomal. The aphA6-associated ISAba125 elements are the only two representatives of this IS class found in AB059. The only other sequenced A. baumannii genome with ISAba125 sequences is ACICU, which belongs to European clone II (15).

Mobile genetic elements: plasmids.

A total of nine different plasmids were identified (Table 6) among the five ST15 strains; no plasmids are present in AB307-0294. All four WRAMC isolates carry the plasmid pAB0057. AB056 and AB0057 share the same two plasmids, but the plasmid content is otherwise distinct in each strain. Three plasmids are worthy of further note.

TABLE 6.

Plasmid contents of ST15 isolates

Plasmid Accession no. Size (kbp) Note(s) Present in:
AB0057 AB056 AB058 AB059 AYE AB307-0294
pAB0057 CP001183 8.7 + + + +
pAB49 L77992 2.5 + +
pAB059 66.5 Related to pACICU2; ISAba125-aphA6 + +
pAB058 7.2 Related to pABIR +
pRAY AF003958 6.1 aadB +
pABAYE1 CU459137 5.6 +
pABAYE2 CU459138 9.7 Related to pAB0057 +
pABAYE3 CU459140 94.4 +
pABAYE4 CU459139 2.7 +

AB058 and AB059 are known to harbor the aminoglycoside-modifying enzyme gene aphA6 (14), which confers resistance to amikacin. The aphA6 gene was found on an ∼900-bp contig in each assembly that is flanked by ISAba125 sequences. This structure matches the original description of the aphA6 gene, although the IS elements were not recognized at the time (20). ISAba125-associated sequences adjacent to aphA6 provide the −35 sequence to drive aphA6 transcription (26). An ISAba125 element is present in the plasmid pACICU2, and a closely related plasmid, termed pAB059, was found in both AB058 and AB059. pACICU2 was originally described in the European clone type II strain ACICU (15). Although an ISAba125 element is present in the published pACICU2 sequence at bases 34926 to 35996, our sequence assemblies and directed PCR across this region confirmed that the IS element is not present at that location in pAB059. Further examination of the ISAba125 flanking sequences suggested that the 5.7-kbp aphA6 gene region was located elsewhere in pAB059, and this was confirmed by PCR.

pAB058 is a significantly smaller relative of pABIR (40) that lacks the blaOXA-58 gene for which the plasmid was named (IR stands for imipenem resistance) and also lacks the ISAba125 element. The aadB gene (conferring resistance to tobramycin) in AB058 is on the plasmid pRAY (35) and is not associated with an IS element or transposon. This is in contrast to the location on AbaR1 in AYE.

Endogenous chromosomal genes associated with antibiotic resistance.

Quinolone resistance mutations in gyrA and parC were as described previously, except that AB058 carries the resistant allele of parC. Predicted protein sequences of the penicillin-binding proteins are identical in AYE, AB056, AB057, and AB059; however, differences in the expression of penicillin-binding protein genes could also contribute to the resistance phenotype. As noted above, ISAba1 elements have also affected genes associated with resistance, including blaADC-7 (upregulation) and adeS (inactivation).

Unique chromosomal sequences in each isolate.

Other than the shorter RI in AB056, the AB056 and AB059 assemblies are consistent with chromosomal sequences that are essentially identical to the AB0057 chromosome. No additional AB0057 gene regions were missing from the assemblies, and there were no contigs that could not be mapped to the AB0057 genome or the plasmids described above.

AB058 has more differences in gene content. In addition to the differences in RI gene content and bla gene regions described above, six chromosomal regions that are present in AB0057/AB056/AB059 are absent from AB058 as well as AYE and AB307-0294 (Table 7). A cluster of nine genes, including at least four involved in iron uptake, is missing from AB058. Interestingly, these nine genes are present in A. baylyi ADP1 and A. baumannii ACICU and SDF but not in ATCC 17978 or A900, suggesting that they are not essential for pathogenicity. The cluster of genes involved in biosynthesis of the O-linked antigen component of lipopolysaccharide has been shown to vary in A. baumannii, with one set of genes present in AB0057 and a different set in AYE and AB307-0294 (2); AB058 has the AYE-type O-antigen gene cluster. AB057/AB056/AB059 also share four prophage insertions that are not present in AB058. Three additional regions are absent from AB058 but present in all the other ST15 strains, including a 14-gene block encoding a taurine transporter and arsenate resistance genes and a 17-kbp region containing a recombination hot spot (Rhs) family gene. With the exception of the taurine/arsenate block, each of these regions is part of the “accessory” genome, meaning that it is absent from at least one additional sequenced A. baumannii genome.

TABLE 7.

Chromosomal gene content differences between AB058 and AB0057/AB056/AB059: AB0057 regions absent from AB058

Region
No. of genes Present in:
Description
Start End AYE AB307-0294
AB57_0007 AB57_0012 6 No No ISAba1/blaADC cassette
AB57_0091 AB57_0114 24 No No O-antigen biosynthesis
AB57_0268 AB57_0293 26 Yes No RI
AB57_0547 AB57_0566 20 No No AbaR4
AB57_0985 AB57_0996 12 No No Iron uptake operon including FecI, FecR, and heme oxygenase
AB57_1225 AB57_1310 86 No No Phage
AB57_1437 AB57_1449 13 Yes Yes Rhs operon, hypothetical proteins
AB57_1673 AB57_1686 14 Yes Yes Taurine, arsenate
AB57_2010 AB57_2071 62 No No Phage
AB57_2397 AB57_2400 4 Yes Yes OmpW and 3 hypothetical proteins
AB57_2726 AB57_2739 14 No No Partial phage
AB57_3193 AB57_3258 66 No No Phage
AB57_3399 AB57_3402 4 No No Glycosyltransferase genes

The AB058 sequence assembly has ∼49.5 kbp of chromosomal sequence that is not represented in AB0057. Approximately 10.6 kbp of this sequence is present in the AYE and AB307-0294 genomes in the O-antigen biosynthetic gene cluster. The remaining 38.9 kbp is distributed across one or more novel prophage regions and a novel 5.4-kbp insertion (Table 8).

TABLE 8.

Chromosomal gene content differences between AB058 and AB0057/AB056/AB059: AB058 regions absent from AB0057

Region Length (bp) No. of contigs
Putative phage region(s) 33,504 7
5.4 kbp insertion in AB57_3078 (diacylglycerol kinase) 5,408 1
AYE/AB307-0294 O-antigen biosynthetic genes 10,592 29

Phylogenetic relationships.

The draft nature of three genomes makes full phylogenetic analysis impractical; however, we identified 1,927 ORFs that are complete in all six ST15/46 genome assemblies. Each was the reciprocal best BLAST match, suggesting that they are orthologous. ClustalW was used to create a multiple-sequence alignment of each gene separately, and the resulting alignments were concatenated and used to build a phylogenetic tree (Fig. 2). The tree clearly groups AB0057, AB056, and AB059 together. The AB0057/AB056/AB059 group has >99.99% intragroup similarity, implying fewer than 300 nucleotide differences genomewide, which is within the expected error rate of the draft genome assemblies. AB307-0294, AYE, and AB058 range from 99.93 to 99.97% identical to one another. The AB0057/AB056/AB059 group is also distinguished from the other ST15 strains by its O-antigen biosynthetic gene cluster (2).

FIG. 2.

FIG. 2.

Phylogenetic tree of ST15 strains. A phylogenetic tree was made using the neighbor-joining method based on an alignment of DNA sequences from 1,972 open reading frames that are present in each genome assembly. Each branch is supported by at least 90% of 1,000 bootstrap replicates.

The locations of seven ISAba1 insertion sites are identical in AB056, AB059, and AB0057, arguing strongly for a clonal relationship, yet these strains differ in important aspects of their antimicrobial resistance genotype and phenotype. Based on dates of arrival and of culture isolation, it is clear that the AB0057 strain arrived at WRAMC after AB056 and AB059 (Table 1). If AbaR9 (AB056) does in fact represent a deletion relative to an AB0057-like progenitor, then this deletion must have happened prior to the arrival of AB0057 at WRAMC.

Summary of analysis of ST15 strains.

All five MDR ST15 strains have a distinct and unique genetic repertoire that includes variation in three classes of mobile element composition: plasmids, IS elements, and the RI. Each class of mobile element has contributed to the development of antimicrobial resistance, either by facilitating the transfer of resistance genes or by upregulation of an endogenous gene. The role of IS-mediated gene knockout in resistance and pathogenicity merits further exploration.

The resistance gene repertoire in the ST15 strains does not strictly conform to the genomewide phylogeny. For example, only AB058 and AB059 carry the plasmid with the aphA6 gene. Furthermore, one shared gene, aadB, is in a completely different genomic context in AYE (RI) and AB058 (plasmid). The pattern of insertion (or deletion) in the RI also cannot be readily explained as a series of stepwise differences consistent with the phylogeny. Multiple independent gene transfer and IS mobilization events have occurred among these closely related strains. In AYE, most of the genes that play a role in antibiotic resistance are located in AbaR1. In the WRAMC strains and in ACICU, the RI plays a significant but less dominant role in resistance to the clinically important classes of antibiotics, including cephalosporins, carbapenems, aminoglycosides, and fluoroquinolones.

An essential assumption of clonality testing is that clonal isolates will have similar antimicrobial susceptibility patterns. The ST15 strains are quite similar genomewide but have considerable divergence in their antibiotic resistance phenotype. Therefore, genomewide assays of relatedness such as PFGE and PCR/ESI-MS are likely to be less effective in monitoring changes in resistance genotype and phenotype. Development of more specific and comprehensive molecular assays for detection of specific resistance genes should prove useful in monitoring changes in resistance pattern and in selection of appropriate therapeutic regimens.

This study has not directly addressed the rate of lateral gene transfer or IS mobilization, and it remains to be determined whether rapid gene gain/loss is common in the context of a clinical outbreak. The diversity of strains present at WRAMC likely derives from multiple founders, and the historical relationships between strains cannot be inferred based on the information available. Therefore, study of more homogenous outbreaks, where most infections are nosocomially transmitted, will be necessary to clarify many aspects of RI- and mobile element-driven evolution. This study highlights the need for further study of IS mobilization, lateral gene transfer, and the kinetics of novel gene acquisition.

Acknowledgments

We thank David Craft for providing strains and Simone Edelheit and Pamela Supelak at the Case Western Reserve University Genomics Core Facility for performing the Illumina sequencing.

R.A.B. was supported by VA MERIT Award VISN10, the Geriatric Research Education and Clinical Center, and NIH grant R01-AI072219. This publication was made possible by Case Western Reserve University/Cleveland Clinic CTSA grant no. UL1 RR024989 from the National Center for Research Resources.

Footnotes

▿

Published ahead of print on 7 June 2010.

REFERENCES

  • 1.Abbott, A. 2005. Medics braced for fresh superbug. Nature 436:758. [DOI] [PubMed] [Google Scholar]
  • 2.Adams, M. D., K. Goglin, N. Molyneaux, K. M. Hujer, H. Lavender, J. J. Jamison, I. J. MacDonald, K. M. Martin, T. Russo, A. A. Campagnari, A. M. Hujer, R. A. Bonomo, and S. R. Gill. 2008. Comparative genome sequence analysis of multidrug-resistant Acinetobacter baumannii. J. Bacteriol. 190:8053-8064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Adams-Haduch, J. M., D. L. Paterson, H. E. Sidjabat, A. W. Pasculle, B. A. Potoski, C. A. Muto, L. H. Harrison, and Y. Doi. 2008. Genetic basis of multidrug resistance in Acinetobacter baumannii clinical isolates at a tertiary medical center in Pennsylvania. Antimicrob. Agents Chemother. 52:3837-3843. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bertini, A., L. Poirel, S. Bernabeu, D. Fortini, L. Villa, P. Nordmann, and A. Carattoli. 2007. Multicopy blaOXA-58 gene as a source of high-level resistance to carbapenems in Acinetobacter baumannii. Antimicrob. Agents Chemother. 51:2324-2328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chenna, R., H. Sugawara, T. Koike, R. Lopez, T. J. Gibson, D. G. Higgins, and J. D. Thompson. 2003. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 31:3497-3500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Delcher, A. L., A. Phillippy, J. Carlton, and S. L. Salzberg. 2002. Fast algorithms for large-scale genome alignment and comparison. Nucleic Acids Res. 30:2478-2483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Depardieu, F., I. Podglajen, R. Leclercq, E. Collatz, and P. Courvalin. 2007. Modes and modulations of antibiotic resistance gene expression. Clin. Microbiol. Rev. 20:79-114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Dijkshoorn, L., A. Nemec, and H. Seifert. 2007. An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nat. Rev. Microbiol. 5:939-951. [DOI] [PubMed] [Google Scholar]
  • 9.Falush, D. 2009. Toward the use of genomics to study microevolutionary change in bacteria. PLoS Genet. 5:e1000627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Felsenstein, J. 1989. PHYLIP—Phylogeny Inference Package (version 3.2). Cladistics 5:164-166. [Google Scholar]
  • 11.Fournier, P. E., D. Vallenet, V. Barbe, S. Audic, H. Ogata, L. Poirel, H. Richet, C. Robert, S. Mangenot, C. Abergel, P. Nordmann, J. Weissenbach, D. Raoult, and J. M. Claverie. 2006. Comparative genomics of multidrug resistance in Acinetobacter baumannii. PLoS Genet. 2:e7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hiller, N. L., B. Janto, J. S. Hogg, R. Boissy, S. Yu, E. Powell, R. Keefe, N. E. Ehrlich, K. Shen, J. Hayes, K. Barbadora, W. Klimke, D. Dernovoy, T. Tatusova, J. Parkhill, S. D. Bentley, J. C. Post, G. D. Ehrlich, and F. Z. Hu. 2007. Comparative genomic analyses of seventeen Streptococcus pneumoniae strains: insights into the pneumococcal supragenome. J. Bacteriol. 189:8186-8195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Holt, K. E., J. Parkhill, C. J. Mazzoni, P. Roumagnac, F. X. Weill, I. Goodhead, R. Rance, S. Baker, D. J. Maskell, J. Wain, C. Dolecek, M. Achtman, and G. Dougan. 2008. High-throughput sequencing provides insights into genome variation and evolution in Salmonella Typhi. Nat. Genet. 40:987-993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hujer, K. M., A. M. Hujer, E. A. Hulten, S. Bajaksouzian, J. M. Adams, C. J. Donskey, D. J. Ecker, C. Massire, M. W. Eshoo, R. Sampath, J. M. Thomson, P. N. Rather, D. W. Craft, J. T. Fishbain, A. J. Ewell, M. R. Jacobs, D. L. Paterson, and R. A. Bonomo. 2006. Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center. Antimicrob. Agents Chemother. 50:4114-4123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Iacono, M., L. Villa, D. Fortini, R. Bordoni, F. Imperi, R. J. Bonnal, T. Sicheritz-Ponten, G. De Bellis, P. Visca, A. Cassone, and A. Carattoli. 2008. Whole genome pyrosequencing of an epidemic multidrug resistant Acinetobacter baumannii of the European clone II. Antimicrob. Agents Chemother. 52:2616-2625. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Li, H., J. Ruan, and R. Durbin. 2008. Mapping short DNA sequencing reads and calling variants using mapping quality scores. Genome Res. 18:1851-1858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Linz, B., and S. C. Schuster. 2007. Genomic diversity in Helicobacter and related organisms. Res. Microbiol. 158:737-744. [DOI] [PubMed] [Google Scholar]
  • 18.Lockhart, S. R., M. A. Abramson, S. E. Beekmann, G. Gallagher, S. Riedel, D. J. Diekema, J. P. Quinn, and G. V. Doern. 2007. Antimicrobial resistance among Gram-negative bacilli causing infections in intensive care unit patients in the United States between 1993 and 2004. J. Clin. Microbiol. 45:3352-3359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lu, P. L., M. Doumith, D. M. Livermore, T. P. Chen, and N. Woodford. 2009. Diversity of carbapenem resistance mechanisms in Acinetobacter baumannii from a Taiwan hospital: spread of plasmid-borne OXA-72 carbapenemase. J. Antimicrob. Chemother. 63:641-647. [DOI] [PubMed] [Google Scholar]
  • 20.Martin, P., E. Jullien, and P. Courvalin. 1988. Nucleotide sequence of Acinetobacter baumannii aphA-6 gene: evolutionary and functional implications of sequence homologies with nucleotide-binding proteins, kinases and other aminoglycoside-modifying enzymes. Mol. Microbiol. 2:615-625. [DOI] [PubMed] [Google Scholar]
  • 21.Medini, D., C. Donati, H. Tettelin, V. Masignani, and R. Rappuoli. 2005. The microbial pan-genome. Curr. Opin. Genet. Dev. 15:589-594. [DOI] [PubMed] [Google Scholar]
  • 22.Monot, M., N. Honore, T. Garnier, N. Zidane, D. Sherafi, A. Paniz-Mondolfi, M. Matsuoka, G. M. Taylor, H. D. Donoghue, A. Bouwman, S. Mays, C. Watson, D. Lockwood, A. Khamispour, Y. Dowlati, S. Jianping, T. H. Rea, L. Vera-Cabrera, M. M. Stefani, S. Banu, M. Macdonald, B. R. Sapkota, J. S. Spencer, J. Thomas, K. Harshman, P. Singh, P. Busso, A. Gattiker, J. Rougemont, P. J. Brennan, and S. T. Cole. 2009. Comparative genomic and phylogeographic analysis of Mycobacterium leprae. Nat. Genet. 41:1282-1289. [DOI] [PubMed] [Google Scholar]
  • 23.Mugnier, P. D., L. Poirel, and P. Nordmann. 2009. Functional analysis of insertion sequence ISAba1, responsible for genomic plasticity of Acinetobacter baumannii. J. Bacteriol. 191:2414-2418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Munoz-Price, L. S., and R. A. Weinstein. 2008. Acinetobacter infection. N. Engl. J. Med. 358:1271-1281. [DOI] [PubMed] [Google Scholar]
  • 25.Mwangi, M. M., S. W. Wu, Y. Zhou, K. Sieradzki, H. de Lencastre, P. Richardson, D. Bruce, E. Rubin, E. Myers, E. D. Siggia, and A. Tomasz. 2007. Tracking the in vivo evolution of multidrug resistance in Staphylococcus aureus by whole-genome sequencing. Proc. Natl. Acad. Sci. U. S. A. 104:9451-9456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Naas, T., D. Aubert, T. Lambert, and P. Nordmann. 2006. Complex genetic structures with repeated elements, a sul-type class 1 integron, and the blaVEB extended-spectrum beta-lactamase gene. Antimicrob. Agents Chemother. 50:1745-1752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Nemec, A., L. Dijkshoorn, and T. J. van der Reijden. 2004. Long-term predominance of two pan-European clones among multi-resistant Acinetobacter baumannii strains in the Czech Republic. J. Med. Microbiol. 53:147-153. [DOI] [PubMed] [Google Scholar]
  • 28.Peleg, A. Y., H. Seifert, and D. L. Paterson. 2008. Acinetobacter baumannii: emergence of a successful pathogen. Clin. Microbiol. Rev. 21:538-582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Perez, F., A. M. Hujer, K. M. Hujer, B. K. Decker, P. N. Rather, and R. A. Bonomo. 2007. Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob. Agents Chemother. 51:3471-3484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Poirel, L., O. Menuteau, N. Agoli, C. Cattoen, and P. Nordmann. 2003. Outbreak of extended-spectrum beta-lactamase VEB-1-producing isolates of Acinetobacter baumannii in a French hospital. J. Clin. Microbiol. 41:3542-3547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Post, V., and R. M. Hall. 2009. AbaR5, a large multiple-antibiotic resistance region found in Acinetobacter baumannii. Antimicrob. Agents Chemother. 53:2667-2671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Post, V., P. A. White, and R. M. Hall. 2010. Evolution of AbaR-type genomic resistance islands in multiply antibiotic-resistant Acinetobacter baumannii. J. Antimicrob. Chemother. 65:1162-1170. [DOI] [PubMed] [Google Scholar]
  • 33.Ruiz, M., S. Marti, F. Fernandez-Cuenca, A. Pascual, and J. Vila. 2007. Prevalence of IS(Aba1) in epidemiologically unrelated Acinetobacter baumannii clinical isolates. FEMS Microbiol. Lett. 274:63-66. [DOI] [PubMed] [Google Scholar]
  • 34.Ruzin, A., D. Keeney, and P. A. Bradford. 2007. AdeABC multidrug efflux pump is associated with decreased susceptibility to tigecycline in Acinetobacter calcoaceticus-Acinetobacter baumannii complex. J. Antimicrob. Chemother. 59:1001-1004. [DOI] [PubMed] [Google Scholar]
  • 35.Segal, H., and B. G. Elisha. 1999. Characterization of the Acinetobacter plasmid, pRAY, and the identification of regulatory sequences upstream of an aadB gene cassette on this plasmid. Plasmid 42:60-66. [DOI] [PubMed] [Google Scholar]
  • 36.Tsakris, A., A. Ikonomidis, A. Poulou, N. Spanakis, D. Vrizas, M. Diomidous, S. Pournaras, and F. Markou. 2008. Clusters of imipenem-resistant Acinetobacter baumannii clones producing different carbapenemases in an intensive care unit. Clin. Microbiol. Infect. 14:588-594. [DOI] [PubMed] [Google Scholar]
  • 37.Vallenet, D., P. Nordmann, V. Barbe, L. Poirel, S. Mangenot, E. Bataille, C. Dossat, S. Gas, A. Kreimeyer, P. Lenoble, S. Oztas, J. Poulain, B. Segurens, C. Robert, C. Abergel, J. M. Claverie, D. Raoult, C. Medigue, J. Weissenbach, and S. Cruveiller. 2008. Comparative analysis of Acinetobacters: three genomes for three lifestyles. PLoS One 3:e1805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Villegas, M. V., and A. I. Hartstein. 2003. Acinetobacter outbreaks, 1977-2000. Infect. Control Hosp. Epidemiol. 24:284-295. [DOI] [PubMed] [Google Scholar]
  • 39.Wortmann, G., A. Weintrob, M. Barber, P. Scott, S. T. Zoll, M. W. Eshoo, R. Sampath, D. J. Ecker, and C. Massire. 2008. Genotypic evolution of Acinetobacter baumannii strains in an outbreak associated with war trauma. Infect. Control Hosp. Epidemiol. 29:553-555. [DOI] [PubMed] [Google Scholar]
  • 40.Zarrilli, R., D. Vitale, A. Di Popolo, M. Bagattini, Z. Daoud, A. U. Khan, C. Afif, and M. Triassi. 2008. A plasmid-borne blaOXA-58 gene confers imipenem resistance to Acinetobacter baumannii isolates from a Lebanese hospital. Antimicrob. Agents Chemother. 52:4115-4120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Zerbino, D. R., and E. Birney. 2008. Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Res. 18:821-829. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES