Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2010 Jul 6;78(9):3942–3949. doi: 10.1128/IAI.00346-10

Immunization with a Combination of Integral Chlamydial Antigens and a Defined Secreted Protein Induces Robust Immunity against Genital Chlamydial Challenge ▿

Weidang Li 1,†, Ashlesh K Murthy 1,†, M Neal Guentzel 1, James P Chambers 1, Thomas G Forsthuber 1, J Seshu 1, Guangming Zhong 2, Bernard P Arulanandam 1,*
PMCID: PMC2937460  PMID: 20605976

Abstract

We have previously demonstrated the efficacy of recombinant chlamydial protease-like activity factor (rCPAF; a secreted chlamydial protein) in inducing antigen-specific CD4+ T cell/gamma interferon (IFN-γ)-mediated but not antibody-mediated chlamydial clearance and reduction of upper genital tract (UGT) pathological sequelae. Since chlamydial integral antigens may induce neutralizing antibody protection, we further evaluated induction of protective immunity using a combination of rCPAF and UV-inactivated chlamydial elementary bodies (UV-EB) against vaginal chlamydial challenge in comparison to immunization with the individual components or live EB. The rCPAF-UV-EB immunization induced a significantly enhanced anti-UV-EB cellular and antibody response and a reduced anti-CPAF cellular and antibody response, compared to immunization with the respective individual components. Moreover, vaccination with UV-EB and rCPAF-UV-EB induced serum antibodies that neutralized chlamydial infectivity. The rCPAF-UV-EB immunization resulted in a significant reduction of vaginal chlamydial shedding and induced earlier bacterial clearance than vaccination of mice with the individual components. Importantly, the UGT sequelae were significantly reduced in mice immunized with rCPAF or rCPAF-UV-EB, but not in those immunized with UV-EB alone, and approached the levels of protection induced by live EB. These results collectively suggest that a combination of neutralizing antibodies induced by integral chlamydial antigens and cell-mediated responses induced by secreted proteins such as CPAF induces optimal protective immunity against genital chlamydial infections.


There is currently no licensed vaccine against Chlamydia trachomatis, the leading cause of bacterial sexually transmitted disease worldwide (2, 16). We have previously demonstrated the efficacy of recombinant chlamydial protease-like activity factor (rCPAF) in inducing protective immunity against genital chlamydial challenge (23). Immunization using rCPAF with a T helper 1 (Th1)-type adjuvant induces significantly enhanced bacterial clearance and robust protection against upper genital tract (UGT) pathology following vaginal challenge with homologous or heterologous serovars/species of Chlamydia (5, 6, 23). The high degree of cross-serovar/species protection against UGT sequelae highlights the importance of further characterizing the potential of rCPAF as a component of an antichlamydial vaccine for humans (25). rCPAF-vaccinated mice display significant protection against UGT chlamydial sequelae and clear the bacteria with significantly accelerated kinetics, achieving complete clearance by day 18 (day 30 in mock-vaccinated mice) after challenge. However, vaginal bacterial shedding in rCPAF-vaccinated mice is comparable to the level for mock-vaccinated controls during the initial week after challenge (6, 23). Such enhanced clearance kinetics, in the absence of resistance to infection, may be attributed to the dependence of the protective response on gamma interferon (IFN-γ)-producing CPAF-specific CD4+ T cells (15), a limited role for anti-CPAF antibody (22), and the restriction of CPAF to replicating reticulate bodies.

Chlamydia muridarum infection in mice induces a high level of protective immune responses, including a certain degree of resistance to reinfection, mediated by robust IFN-γ-producing CD4+ T cell responses (4, 11-13, 16, 17, 20, 28-31, 34) and antibodies (16,18-20). A single immunogenic subunit that induces protective immunity comparable to that induced by live, replicating chlamydial organisms has yet to be identified (2, 16, 25). The immunogenic proteins that serve as targets for antibody and T cell responses may be broadly categorized, albeit with some overlap, as proteins that are integral to the chlamydial organism and those that are secreted from the organism, respectively. Specifically, proteins integral to the chlamydial organism would likely serve as targets for neutralizing infectivity extracellularly but may not be candidates of choice for eliciting T cell-mediated killing, due to the sturdy inclusion membrane barrier between the organisms and antigen-presentation pathways during the intracellular developmental cycle (25). On the other hand, secreted proteins such as CPAF are not present on the infectious chlamydial elementary body (EB) and therefore would not be expected to serve as targets for neutralizing chlamydial infectivity (25). However, proteins secreted into the host cytosol, and thereafter into extracellular compartments, may serve as exogenous antigens and a suitable target for CD4+ T cell-mediated effector responses (25, 37). Thus, it would appear that both integral and secreted proteins of Chlamydia may serve as targets for complementary immune responses and that the greatest potential for successful vaccination could be derived by combining them in a multisubunit vaccine.

In this study, we compared the protective immunities induced by intranasal (i.n.) immunization with rCPAF, UV-inactivated EBs (UV-EB), rCPAF-UV-EB, or live EB against genital C. muridarum challenge in female BALB/c mice. The combination of integral and secreted proteins enhanced protective immunity compared to the individual components and approached the high level of protection induced by live, replicating chlamydial organisms.

MATERIALS AND METHODS

Chlamydia.

Chlamydia muridarum was grown on confluent HeLa cell monolayers as described previously (26). Cells were lysed using a sonicator (Fisher Scientific, PA), and elementary bodies (EBs) were purified on discontinuous density gradients of Renografin-76 as described previously. Aliquots of bacteria were stored at −70°C in sucrose-phosphate-glutamine (SPG) buffer. Inactivation of EBs was carried out by exposure to UV light from a UV lamp (30 W) at a distance of 15 cm for 15 min at room temperature as described previously (6). To ensure that treated EBs were completely inactivated, viability in HeLa cells was tested, with no recoverable inclusion-forming units (IFU) found after inoculation of inactivated EBs on HeLa cells for 24 h. The numbers of IFU for both live EBs and UV-inactivated EBs (UV-EB) were calculated from titers determined for original chlamydial purified stocks.

rCPAF and CpG.

Recombinant CPAF (rCPAF) was purified as described previously (24). Briefly, rCPAF constructs from the C. trachomatis L2 genome with a 6-histidine tag (His) were cloned into pBAD vectors and Ni-nitrilotriacetic acid (NTA) agarose beads (Amersham, NJ) were used for purification of the rCPAF. The fusion protein was concentrated using Centriplus YM-10 tubes (Millipore, MA), suspended in phosphate-buffered saline (PBS) with proteinase inhibitor cocktail (Roche, CA), aliquoted, and then stored at −20°C. The purity of rCPAF was evaluated by SDS-polyacrylamide gel electrophoresis and by Western blot analysis using anti-CPAF mouse antibodies (23). CpG (TCCATGACGTTCCTGACGTT) was obtained from Sigma Genosys (St. Louis, MO) (6).

Mice.

Four-to-six week-old female BALB/c mice were obtained from Charles River Laboratory (Bar Harbor, ME). Mice were housed at the University of Texas at San Antonio and provided food and water ad libitum. Animal care and experimental procedures were performed in compliance with the Institutional Animal Care and Use Committee (IACUC) guidelines.

Intranasal immunization procedure.

Animals were immunized as described previously (5, 6, 14, 15, 21-24). Groups of mice were anesthetized (3% isoflurane) and immunized i.n. on day 0 with 15 μg rCPAF, 105 IFU UV-EB alone, or combinations of 15 μg rCPAF and 105 IFU UV-EB in 25 μl of sterile PBS. This was accompanied on days −1, 0, and +1 with 10 μg of recombinant CpG in PBS containing 1% normal mouse serum. Mice were boosted i.n. with the same doses on days 14 and 28. The dose of rCPAF that was selected (15 μg/mouse) provided optimal protection against genital C. muridarum challenge in our studies using BALB/c mice (23). Additional groups of mice received 500 IFU live EB or CpG alone i.n. as controls.

ELISPOT assay.

BALB/c mice were immunized i.n. with rCPAF-CpG, UV-EB-CpG, rCPAF-UV-EB-CpG, live EB, or CpG on day 0, and booster immunizations were given on days 14 and 28. Twenty days after the final immunization, the mice were euthanized, spleens collected, and single cell suspensions made. The enzyme-linked immunospot (ELISPOT) analyses were performed as described previously (10). Briefly, 96-well MultiScreenHTS filtration plates (Millipore) were coated overnight at 4°C with 2 μg/ml murine IFN-γ-specific monoclonal antibody (MAb) (clone AN-18; eBioscience, CA). Splenocytes (5 × 105 cells per well) in HL-1 medium (BW77201; Fisher) were added to the coated plates in the presence of rCPAF at 1 μg/ml or C. muridarum (1 × 105 IFU per well). After 20 h of incubation at 37°C with 5% CO2, the plates were washed and then incubated with biotinylated murine IFN-γ-specific MAbs (clone R4-6A2; Biotin-eBioscience) at 0.5 μg/ml. This was followed by incubation with streptavidin-alkaline phosphatase (no. D0396; Dako, CA) at a 1/1,000 dilution. The spots were visualized with a substrate consisting of BCIP/NBT (no. 50-81-07; KPL, MD). Plates were dried overnight, and images of the ELISPOT wells were captured with an ImmunoSpot series 3 analyzer (Cellular Technology, Ltd., OH). Image analysis of ELISPOT results was performed with the ImmunoSpot 3.0 analysis software program (Cellular Technology Limited, OH), allowing precise spot size measurements down to spot sizes of 8.8 μm2.

Detection of antibody and isotypes levels by ELISA.

Ten days after the final immunization, sera from the animals were analyzed by an enzyme-linked immunosorbent assay (ELISA) as described previously (5, 6, 14, 15, 21-24). Microtiter plates were coated overnight with UV-inactivated EBs (105 IFU/well) or rCPAF (5 μg/ml) in sodium bicarbonate buffer (pH 9.5). Serial dilutions of sera were added to wells and incubated at room temperature for 2 h. The plates were then washed and incubated for an additional 1 h with goat anti-mouse IgG1 or IgG2a conjugated to alkaline phosphatase (Southern Biotechnology Associates, AL). After a wash, p-nitrophenyl phosphate substrate (Sigma, MO) was added for color development and the absorbance at 405 nm measured using a μQuant microplate reader (Biotek Instruments, VT). Reciprocal serum dilutions corresponding to 50% maximal binding were used to obtain titers.

In vitro serum neutralization assays.

C. muridarum neutralization assays were performed with hamster kidney (HaK) cells as described previously (3). Briefly, 1 × 105 IFU of C. muridarum was added to different serial dilutions of nonimmune control and immune sera from UV-EB-vaccinated or live-EB-infected mice and then incubated for 1 h at 37°C in microcentrifuge tubes placed on a rotator. Then, 0.2 ml of each dilution was inoculated onto 1 × 105 HaK cells/well in a 24-well plate and incubated with rocking for 2 h at 37°C. Inocula were removed, and Dulbecco's modified Eagle's medium (DMEM) containing 1 μg/ml cycloheximide was added to the HaK cell monolayers, followed by incubation at 37°C for 24 h. Coverslips were stained with antibodies and counted for chlamydial IFU as described above. The percent specific neutralization for each dilution, with respect to the no-serum control, was calculated as (number of no-serum control IFU − number of immune serum IFU)/number of no-serum control IFU × 100.

Vaginal C. muridarum challenge and determination of bacterial shedding.

One month following the final vaccination, animals were challenged intravaginally (i.vag.) with 5 × 104 IFU of C. muridarum in 5 μl of SPG buffer as described previously (5, 6, 14, 15, 21-24). All animals were injected with Depo-Provera (Pharmacia Upjohn, MI) on days −10 and −3 before challenge. Vaginal swabs were obtained on the indicated days after challenge, followed by plating of the swab material on HeLa cell monolayers grown on culture coverslips. Chlamydial inclusions were detected using an anti-Chlamydia genus-specific murine monoclonal primary antibody and goat anti-mouse IgG secondary antibody conjugated to Cy3-plus-Hoescht nuclear stain. The number of inclusions was counted using a Zeiss Axioskop microscope, and the results were expressed as the average number of inclusions per 10 random midline fields per animal group for earlier times (until day 12 after challenge) and as the total number of inclusions on an entire coverslip per animal and the average per group for later times (at days 15 to 30 after challenge).

Gross pathology and histopathology.

Genital tracts were removed from mice at the various indicated time points after challenge, examined for the presence of hydrosalpinx, fixed in 10% neutral formalin, and then embedded into paraffin blocks. Serial horizontal sections (5 μm) were prepared and stained using hematoxylin and eosin (H&E). Stained sections were visualized using a Zeiss Axioskop microscope and scored in blinded fashion as described previously (23), using a modification of the scoring system of Roger Rank (32). Dilatation of oviducts was scored as follows: 0, no significant dilatation; 1, mild dilatation of a single cross-section of oviduct; 2, 1 to 3 dilated cross-sections of an oviduct; 3, >3 dilated cross-sections of an oviduct; and 4, confluent pronounced dilatation of the oviduct. Cellular parameters (polymorphonuclear cells [PMNs], mononuclear cells, and plasma cells) were individually scored as follows: 0, no significant presence of infiltration; 1, presence of infiltration at a single focus; 2, presence at 2 to 4 foci; 3, presence at more than 4 foci; or 4, confluent infiltration. Results are expressed as means ± standard deviations (SD) of scores from all animals in a group.

Statistical analyses.

Analysis of variance (ANOVA) was used for statistical comparisons of cellular and antibody responses. For comparison of neutralizing antibody and bacterial shedding, a repeated measures ANOVA was used. For comparison of the time taken to clearance and the number of mice developing hydrosalpinx, the Fisher exact test was used. Microscopic oviduct pathology and histopathology scores were compared using ANOVA on ranks. All data shown are representative of at least 2 independent experiments, and each experiment whose results are shown was analyzed independently, except in the case of macroscopic hydrosalpinx development, where the data are an aggregate of two independent experiments.

RESULTS

Antigen-specific immune responses observed after rCPAF and UV-EB immunization.

Immunity against genital chlamydial infection has been shown to involve antigen-specific IFN-γ producing cellular responses (4, 11-13, 16, 17, 20, 28-31, 34) and antibody (16, 18-20). Therefore, we evaluated these immune responses after i.n. immunization with rCPAF, UV-EB, and rCPAF-UV-EB (all with the addition of CpG as adjuvant), with live EB, and with CpG by itself. The frequencies of antigen-specific IFN-γ producing cells and serum antibody were measured at 20 days following the final booster immunization. As shown in Fig. 1, anti-UV-EB IFN-γ-producing cells were induced by UV-EB, rCPAF-UV-EB, and live-EB immunization. The frequency of anti-UV-EB IFN-γ-producing cells was significantly greater in animals immunized with live EB (519 ± 18 per 5 × 105 cells) than in those immunized with UV-EB (187 ± 8 per 5 × 105 cells) and rCPAF-UV-EB (189 ± 5 per 5 × 105 cells), which displayed comparable frequencies. Together, these results suggest that UV-EB immunization is not as effective as live-EB infection, at the examined doses, in priming anti-UV-EB cellular responses and that addition of rCPAF to UV-EB does not significantly alter the priming of cellular responses against UV-EB. Additionally, anti-CPAF IFN-γ-producing cells were induced by rCPAF, rCPAF-UV-EB, and live-EB immunization. The frequency of anti-CPAF IFN-γ-producing cells was significantly greater in mice immunized with rCPAF (363 ± 13 per 5 × 105 cells) than in those vaccinated with rCPAF-UV-EB (167 ± 7 per 5 × 105 cells) and live EB (185 ± 4 per 5 × 105 cells). These results suggest that rCPAF immunization results in greater induction of anti-CPAF cellular responses than live-EB infection and that addition of UV-EB to the rCPAF regimen significantly and adversely affects the induction of Th1-type responses against CPAF. As expected, rCPAF- or CpG-vaccinated animals did not display UV-EB-specific cellular responses and, conversely, UV-EB- or CpG-immunized animals did not display CPAF-specific cellular responses.

FIG. 1.

FIG. 1.

Splenic antigen-specific cellular response following immunization. Groups (6 mice per group) were immunized i.n. with rCPAF, UV-EB, rCPAF-UV-EB, or CpG on day 0, and booster immunizations were given on days 14 and 28. Another group (n = 6) of mice received live EB on day 0. On day 50 after initial immunization, the frequencies of UV-EB-specific and CPAF-specific IFN-γ producing cells in the spleen were measured, and the mean ± SD per group is shown. Significant differences (P < 0.001; ANOVA) between the indicated groups and the CpG or rCPAF group (*), between the live-EB group and all other groups (♣), between the indicated groups and the CpG or UV-EB group (♠), and between the rCPAF group and all other groups (♡) are shown. The results are representative of 2 individual experiments.

The serum antibody responses against the individual antigens at 20 days following the final immunization were also measured. As shown in Fig. 2, anti-UV-EB antibody responses were induced by UV-EB, rCPAF-UV-EB, and live-EB immunization. The reciprocal titers at 50% maximal binding of anti-UV-EB IgG1 and IgG2a antibody were significantly greater in animals immunized with live EB (1,681 ± 660 and 4,251 ± 748, respectively) than in those immunized with UV-EB (556 ± 100 and 669 ± 47, respectively) and rCPAF-UV-EB (583 ± 75 and 841 ± 76, respectively). The addition of rCPAF to UV-EB immunization induced comparable IgG1 and IgG2a antibody responses against UV-EB (841 ± 76 and 669 ± 47, respectively). These results suggest that UV-EB immunization is not as effective as live-EB infection, at the doses used in this study, in priming anti-UV-EB antibody responses and that addition of rCPAF to UV-EB did not affect antibody responses against UV-EB. Additionally, anti-CPAF antibody responses were induced by rCPAF, rCPAF-UV-EB, and live-EB immunization. Anti-CPAF IgG1 antibody levels were comparable in animals vaccinated with rCPAF-UV-EB (1,901 ± 495) and those receiving live EB (1,281 ± 600) or rCPAF (1,353 ± 166) immunization. Anti-CPAF IgG2a antibody levels also were comparable in mice immunized with rCPAF (4,323 ± 635) and those vaccinated with rCPAF-UV-EB (3,085 ± 838) or live EB (2,251 ± 748). As expected, rCPAF- or CpG-vaccinated animals did not display UV-EB-specific cellular responses and, conversely, UV-EB- or CpG-immunized animals did not display CPAF-specific cellular responses. As an indicator of Th1-type immune response, the IgG2a/IgG1 ratios were also comparable between the groups of mice. The anti-UV-EB IgG2a/IgG1 ratios was significantly greater in mice immunized with live EB (2.5 ± 0.3) and mice immunized with rCPAF-UV-EB (1.5 ± 0.1) than in mice immunized with UV-EB (1.2 ± 0.1). The anti-CPAF IgG2a/IgG1 ratio was significantly greater in mice immunized with rCPAF (3.2 ± 0.3) than in mice immunized with rCPAF-UV-EB (1.6 ± 0.2) and mice immunized with live EB (1.8 ± 0.2). Th1-type responses, as indicated by the IgG2a/IgG1 ratio, were significantly enhanced for anti-UV-EB antibody and adversely affected for anti-CPAF antibody upon addition of UV-EB to the rCPAF immunization.

FIG. 2.

FIG. 2.

Serum antibody response following immunization. Groups (6 mice per group) were immunized i.n. with rCPAF, UV-EB, rCPAF-UV-EB, or CpG on day 0, and booster immunizations were given on days 14 and 28. Another group (n = 6) of mice received live EB on day 0. On day 50 after initial immunization, the serum UV-EB-specific and CPAF-specific antibodies were measured, and the mean ± SD per group of the reciprocal titer corresponding to the 50% maximal binding is shown. Significant differences (P < 0.001; ANOVA) between the indicated groups and the CpG or rCPAF group (*), between the live-EB group and all other groups (♣), between the indicated group and the CpG, rCPAF, and UV-EB groups (∞), between the indicated groups and the CpG or UV-EB group (♠), and between the rCPAF group and all other groups (♡) are shown. The results are representative of 2 individual experiments.

We also measured the levels of serum antibodies that neutralized chlamydial infectivity in the immunized mice at 20 days following the final booster immunization, using an in vitro assay of chlamydial infectivity of hamster kidney cells. As shown in Fig. 3, sera from rCPAF- and CpG-immunized mice did not display neutralization of chlamydial infectivity. Sera from UV-EB (25% neutralization at 1:80 dilution)-, rCPAF-UV-EB (24% neutralization at 1:80 dilution)-, and live-EB (58% neutralization at 1:80 dilution)-immunized mice displayed significantly enhanced neutralization compared to rCPAF- and CpG-immunized mice (no neutralization at 1:80 dilution in either group). The effect was greater (although not statistically significant) in sera from mice immunized with live EB than in UV-EB and rCPAF-UV-EB mice, whereas UV-EB and rCPAF-UV-EB induced comparable effects. These results suggest that addition of rCPAF to UV-EB immunization does not significantly affect the induction of neutralizing antichlamydial antibodies.

FIG. 3.

FIG. 3.

Serum antibody neutralizing chlamydial infectivity in immunized mice. Groups (6 mice per group) were immunized i.n. with rCPAF, UV-EB, rCPAF-UV-EB, or CpG on day 0, and booster immunizations were given on days 14 and 28. Another group (n = 6) of mice received live EB on day 0. On day 50 after initial immunization, the sera were evaluated for neutralization of chlamydial infectivity in HaK cells. Significant differences (P ≤ 0.001; repeated measures ANOVA) (*) in the ability to neutralize chlamydial infectivity between sera from the indicated group and CpG- or rCPAF-CpG-immunized mice are shown. The results are representative of 2 individual experiments.

Vaginal chlamydial clearance following chlamydial challenge in immunized mice.

The immunized animals were rested for 1 month following the final booster immunization and challenged i.vag. with 5 × 104 IFU of C. muridarum. The vaginal chlamydial shedding was monitored every third day for a period of 30 days following bacterial challenge. As shown in Fig. 4, CpG-vaccinated animals displayed high levels of chlamydial shedding initially and progressively cleared the infection by day 30 after challenge. rCPAF-vaccinated animals displayed levels of vaginal chlamydial shedding comparable to those displayed by CpG-vaccinated animals on day 3 after challenge. However, as early as day 6 after challenge and at every time point thereafter, rCPAF-vaccinated mice displayed greater reductions in bacterial shedding than CpG-vaccinated animals. Complete cessation of vaginal chlamydial shedding was exhibited by 17% of animals by day 12, 50% by day 15, and 100% by day 18 after challenge, whereas 100% of CpG-vaccinated mice displayed chlamydial shedding during these periods (Table 1). UV-EB-vaccinated mice displayed reductions in vaginal chlamydial shedding as early as day 3 and at every time point thereafter (Fig. 4), with complete clearance in 33% of mice by day 12, 50% by day 18, and 100% of animals by day 21 after challenge. rCPAF-UV-EB-vaccinated mice displayed reduction of chlamydial shedding on day 3 and at every time point thereafter, with complete clearance in 17% of animals by day 9, 67% by day 12, and 100% by day 15 after challenge. The initial reduction of chlamydial shedding on day 3 after challenge in rCPAF-UV-EB-vaccinated mice was comparable to that in UV-EB-immunized animals. However, the shedding in rCPAF-UV-EB-vaccinated mice at day 6 and every time point thereafter and the time to clearance were reduced in rCPAF-UV-EB-vaccinated mice compared to the level for mice immunized individually with rCPAF or UV-EB. Only 33% of live-EB-vaccinated animals displayed chlamydial shedding at day 3 (Fig. 4), and this level was significantly reduced (∼3 log10) compared to the level for CpG-vaccinated mice; then, complete clearance was observed in 67% of live-EB-vaccinated animals by day 3, followed by 83% on day 6 and 100% by day 9 after challenge (Table 1). The vaginal chlamydial burden over the entire time course of shedding was significantly reduced in the UV-EB-, rCPAF-UV-EB-, and live-EB-immunized groups, and complete vaginal chlamydial clearance was observed at significantly earlier time periods in UV-EB-, rCPAF-, rCPAF-UV-EB-, and live-EB-immunized mice (listed in order from the least to the greatest reduction in period of shedding) than in CpG-vaccinated animals. These results indicate that combined rCPAF-UV-EB immunization induces enhanced chlamydial clearance compared to immunization with individual antigens but not compared to the level of clearance induced by live-EB immunization.

FIG. 4.

FIG. 4.

Vaginal chlamydial shedding following challenge in immunized mice. Groups (6 mice per group) were immunized i.n. with rCPAF, UV-EB, rCPAF-UV-EB, or CpG on day 0, and booster immunizations were given on days 14 and 28. Another group (n = 6) of mice received live EB on day 0. One month after the final immunization, mice were challenged i.vag. with 5 × 104 IFU of C. muridarum. Chlamydial shedding was monitored every third day after challenge for 1 month, and the mean ± SD of chlamydial shedding per group per each time point is shown. Significant reductions (P < 0.05; one-way ANOVA) (*) in bacterial shedding at the indicated time points between the indicated group and CpG-immunized mice are shown. The results are representative of 2 independent experiments.

TABLE 1.

Vaginal chlamydial shedding following challenge in immunized micea

Immunization % of mice (n = 6) shedding Chlamydia from the vagina on indicated day after i.vag. challenge
3 6 9 12 15 18 21 24 27 30
CpG 100 100 100 100 100 100 67 50 33 0
rCPAF-CpG 100 100 100 83 50 0 0 0 0 0
UV-EB-CpG 100 100 100 67 67 50 0 0 0 0
rCPAF-UV-EB-CpG 100 100 83 33 0 0 0 0 0 0
Live EB 33 17 0 0 0 0 0 0 0 0
a

The numbers of mice shedding at each time point were added, and the aggregate was used for comparison. By a two-tailed Fisher exact test, significant differences were detected between CpG-immunized mice and mice immunized with rCPAF-CpG (P < 0.0001), UV-EB-CpG (P < 0.01), rCPAF-UV-EB-CpG (P < 0.0001), and live EB (P < 0.001).

Upper genital pathology following challenge in immunized mice.

The immunized/challenged mice were rested until day 80 after challenge, and upper genital tract pathology was evaluated based on our previous extensive studies (23) demonstrating the suitability of this time period for analyses of UGT sequelae induced by genital C. muridarum challenge in mice. The macroscopic pathology was evaluated based on the presence of hydrosalpinx and is reported as the percentage of mice displaying bilateral, unilateral, and total hydrosalpinx at day 80 after chlamydial challenge (Table 2). Hydrosalpinx was observed in 83% (58% bilateral and 25% unilateral) of CpG-vaccinated mice. In comparison to what was found for CpG, the development of hydrosalpinx was significantly reduced in mice immunized with rCPAF (33% mice [8% bilateral and 25% unilateral]), rCPAF-UV-EB (33% mice [unilateral]), and live EB (16% mice [8% bilateral and 8% unilateral]) but not in those vaccinated with UV-EB (50% mice [25% bilateral and 25% unilateral]). Thus, rCPAF, rCPAF-UV-EB, and live-EB immunization induced comparable levels of protection against development of hydrosalpinx following chlamydial challenge.

TABLE 2.

Hydrosalpinx after chlamydial challenge in immunized micea

Intranasal immunization % of mice (n = 12) developing hydrosalpinx on day 80 after i.vag. C. muridarum challenge
Total Bilateral Unilateral
CpG 83 58 25
rCPAF-CpG 33 8 25
UV-EB-CpG 50 25 25
rCPAF-UV-EB-CpG 33 0 33
Live EB 16 8 8
a

By a two-tailed Fisher exact test, significant differences were detected between CpG-immunized mice and mice immunized with rCPAF-CpG (P < 0.05), rCPAF-UV-EB-CpG (P < 0.05), and live EB (P < 0.001).

We also analyzed microscopic pathology in the immunized animals following challenge. As shown in Fig. 5, mice immunized with rCPAF, rCPAF-UV-EB, and live EB, but not those immunized with UV-EB, displayed significant reductions in microscopic oviduct dilatation score compared to those receiving CpG immunization. The presence of inflammatory cellular infiltrates in the genital tract tissues was also scored by microscopy. Mice immunized with rCPAF, rCPAF-UV-EB, and live EB, but not those immunized with UV-EB, displayed significant reductions in mononuclear cells and plasma cells, compared to CpG-vaccinated animals. The levels of polymorphonuclear cell infiltrates were low in all groups of mice (data not shown).

FIG. 5.

FIG. 5.

Upper genital tract pathology following genital challenge in immunized mice. Groups (6 mice per group) were immunized i.n. with rCPAF, UV-EB, rCPAF-UV-EB, or CpG on day 0, and booster immunizations were given on days 14 and 28. Another group (n = 6) of mice received live EB on day 0. One month after the final immunization, mice were challenged i.vag. with 5 × 104 IFU of C. muridarum. On day 80 after challenge, microscopic oviduct dilatation and infiltration of mononuclear cells and plasma cells were scored. The means ± SD of the scores per group are shown. Significant differences (P ≤ 0.05; Kruskall-Wallis one-way ANOVA on ranks) (*) between the indicated groups and CpG-immunized mice are shown. The results are representative of 2 individual experiments.

These results confirm our previous demonstrations (5, 6, 14, 15, 21-24) that rCPAF immunization induces high levels of protection against development of UGT pathology following genital chlamydial challenge. Additionally, UV-EB immunization was not significantly protective against UGT pathology. Importantly, these results suggest that addition of UV-EB to rCPAF immunization does not adversely affect the high level of protection against UGT pathology while inducing significant enhancements in bacterial clearance approaching the levels induced by live-EB immunization.

DISCUSSION

A licensed vaccine has been considered the ideal solution for reducing transmission and preventing morbidity caused by genital chlamydial infections (2, 8, 16). The induction of Th1-type cellular responses and antibody has been an important consideration for antichlamydial vaccine development (2, 8, 16). We now confirm and extend this concept by demonstrating that the induction of antigen-specific Th1 cellular responses and antibody induces protective immunity against chlamydial infections. We further addressed the hypothesis that the antigenic targets that are likely affected by the cellular and antibody responses may be predominantly secreted and integral chlamydial proteins, respectively (25). Specifically, we found that integral, but not secreted, chlamydial proteins induce antibody responses that are capable of neutralizing chlamydial infectivity and may provide a certain degree of resistance to infection. Conversely, secreted, but not integral, chlamydial proteins induce optimal antigen-specific cell-mediated protective immunity against chlamydial UGT pathology. Importantly, we demonstrate that immunization with a combination of integral and secreted antigens provides synergistic benefits and induces partial resistance to infection, enhanced clearance of the vaginal infection compared to immunization with individual components, and protection against UGT pathology that approaches the robust levels of immune protection induced by immunization with live, replicating chlamydial organisms.

Intranasal immunization with live C. muridarum EB induced a robust EB-specific and CPAF-specific Th1 cellular and antibody response and antibodies that neutralize chlamydial infectivity. Live-EB-immunized mice displayed significant resistance to infection, completely cleared the vaginal infection within the first week after challenge, and displayed near-total protection against UGT pathological sequelae. These results suggest that Th1 cellular and antibody responses, including neutralizing antibodies, play a role in bacterial clearance and reduction of pathological sequelae following genital chlamydial infection. However, these results do not clarify the differential contribution, if any, of immune responses against different bacterial components to the observed effects.

Insights into the contribution of effector responses against different bacterial components can be gained from the groups of mice immunized individually with the secreted protein rCPAF, with a pool of integral proteins (UV-EB), or with a combination of both. rCPAF-vaccinated mice display a robust anti-CPAF Th1 immune response that was superior to the response against CPAF in live-EB-immunized mice. However, anti-CPAF antibodies do not neutralize chlamydial infectivity. This pattern was reflected in the lack of resistance to infection (absence of neutralizing antibody), in contrast to the enhanced chlamydial clearance (cell-mediated response), in rCPAF-vaccinated mice in this study and our extensive prior studies (5, 6, 14, 15, 21-24). UV-EB-vaccinated mice display anti-UV-EB Th1 responses and neutralizing antibodies. The reduction in bacterial shedding on day 3 after challenge suggests the efficacy of neutralizing antibodies induced by UV-EB vaccination. Cellular anti-UV-EB responses are unlikely to be responsible for these effects on day 3, since antigen-specific cellular responses were first detected in the genital tract only 5 to 6 days after vaginal chlamydial challenge (15, 33). The antibody-mediated neutralizing effects in UV-EB-vaccinated mice does not appear to be efficiently supported by the anti-UV-EB cellular response, as complete clearance fails to occur earlier than that observed in rCPAF-vaccinated mice, wherein only cellular responses, not neutralizing antibodies, help in clearing the infection (15, 22). Additionally, rCPAF immunization, not UV-EB immunization, significantly reduced UGT pathology, suggesting an important role for cell-mediated responses in inducing this effect. Our findings do not exclude the possibility that increasing the quantity of UV-EB immunogen may enhance the level of protective cell-mediated immunity (CMI) in comparison to that induced by secreted antigens such as CPAF. However, the addition of UV-EB to the rCPAF preparation reduced the anti-CPAF cellular and humoral Th1 type responses, suggesting that immunomodulatory effects other than those induced by the dose of UV-EB may have determined the levels of protective Th1-type anti-UV-EB immune response. Moreover, even the reduced levels of anti-CPAF IFN-γ responses, when combined with anti-UV-EB responses, were optimal for inducing protective effects in rCPAF-UV-EB-immunized mice. The enhanced chlamydial clearance and protection against UGT pathology in rCPAF-UV-EB-immunized mice, despite a reduction in anti-rCPAF Th1 type response, may have been due to the effects of neutralizing antibody, a greater repertoire of Th1 T cell specificities, or altered cytokine patterns beyond IFN-γ, e.g., increased tumor necrosis factor alpha (TNF-α), acting solitarily or jointly, resulting in a more effective immune response.

We (14) and others (1, 35, 36) have previously shown that mice vaccinated with soluble recombinant forms of integral chlamydial antigens, such as recombinant major outer membrane protein (rMOMP), recombinant inclusion membrane protein A (rIncA), and recombinant polymorphic membrane proteins (rPmps), display minimal resistance to infection but accelerate the bacterial clearance and reduce the UGT sequelae, compared to mock-vaccinated mice. However, the chlamydial clearance is delayed and the reduction of UGT sequelae is less efficient upon vaccination with recombinant integral proteins than upon rCPAF vaccination (14). It is tempting to speculate that a multisubunit vaccine composed of several integral chlamydial antigens may result in optimal CMI-induced chlamydial clearance and reduction of pathology. However, the suboptimal protection induced by the entire repertoire of integral chlamydial proteins (UV-EB) in this study and by combinations of rMOMP-rIncA in previous studies (14) suggests that this possibility is less likely. These results collectively suggest that while integral chlamydial proteins are capable of inducing CMI that mediates chlamydial clearance and reduction of UGT sequelae, secreted chlamydial proteins may be more efficacious in this context.

Conversely, integral chlamydial antigens induce antibodies that neutralize chlamydial infectivity, which is not an attribute of secreted antigens. Immunization with UV-EB induced neutralizing antibodies and a certain degree of resistance to infection, albeit to lower levels than those induced by live-EB vaccination. Chlamydial MOMP purified from the bacteria and refolded to native conformation has been shown to induce a level of resistance to infection comparable to that induced by live-EB immunization (27). Additionally, similarly high levels of resistance to challenge have been shown to be induced by monoclonal anti-MOMP IgA (7). It is promising that chlamydial MOMP, the predominant surface-exposed protein, can induce high levels of neutralizing antibody, a feature that is shared to a lesser extent by other surface antigens expressed at much lower levels than those observed for MOMP on the bacterial surface and, presumably, to a minimal extent by non-surface-exposed integral proteins. The usage of MOMP as a single antigen for inducing neutralizing protection against Chlamydia is enticing but constrained because MOMP (i) is variable between serovars and therefore induces serovar-specific protective immunity against UGT pathology and (ii) is less suitable for human immunization when purified from the bacteria with detergents that are difficult to remove and for mass production since it requires tedious refolding to native conformation. In contrast, CPAF (i) is highly conserved among different chlamydial species (9) and induces cross-species protection against upper genital pathologies (6, 14, 15, 21-24), (ii) is easily producible in large quantities in recombinant form, and (iii) induces protective immunity after heat denaturation and thus appears to be highly suitable as a single efficacious and safe antigen for reduction of UGT pathological sequelae. Other chlamydial secreted proteins with similar or better protective capabilities may also be used to realize the same goal.

On the basis of these observations, it appears that a combination of surface-exposed antigens that neutralize chlamydial infectivity and secreted antigens that induce protective CMI would make an ideal combination for vaccination. While CPAF represents a well-characterized secreted antigen for this purpose, a suitable comparable preparation of an integral chlamydial subunit antigen remains to be characterized in order to attain an efficacious and safe multisubunit antichlamydial vaccine for human use.

Acknowledgments

This work was supported by National Institutes of Health grant 1RO1AI074860.

Editor: R. P. Morrison

Footnotes

▿

Published ahead of print on 6 July 2010.

REFERENCES

  • 1.Berry, L. J., D. K. Hickey, K. A. Skelding, S. Bao, A. M. Rendina, P. M. Hansbro, C. M. Gockel, and K. W. Beagley. 2004. Transcutaneous immunization with combined cholera toxin and CpG adjuvant protects against Chlamydia muridarum genital tract infection. Infect. Immun. 72:1019-1028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Brunham, R. C., and J. Rey-Ladino. 2005. Immunology of Chlamydia infection: implications for a Chlamydia trachomatis vaccine. Nat. Rev. Immunol. 5:149-161. [DOI] [PubMed] [Google Scholar]
  • 3.Byrne, G. I., R. S. Stephens, G. Ada, H. D. Caldwell, H. Su, R. P. Morrison, B. Van der Pol, P. Bavoil, L. Bobo, S. Everson, et al. 1993. Workshop on in vitro neutralization of Chlamydia trachomatis: summary of proceedings. J. Infect. Dis. 168:415-420. [DOI] [PubMed] [Google Scholar]
  • 4.Cain, T. K., and R. G. Rank. 1995. Local Th1-like responses are induced by intravaginal infection of mice with the mouse pneumonitis biovar of Chlamydia trachomatis. Infect. Immun. 63:1784-1789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chaganty, B. K., A. K. Murthy, S. J. Evani, W. Li, M. N. Guentzel, J. P. Chambers, G. Zhong, and B. P. Arulanandam. 2010. Heat denatured enzymatically inactive recombinant chlamydial protease-like activity factor induces robust protective immunity against genital chlamydial challenge. Vaccine 28:2323-2329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cong, Y., M. Jupelli, M. N. Guentzel, G. Zhong, A. K. Murthy, and B. P. Arulanandam. 2007. Intranasal immunization with chlamydial protease-like activity factor and CpG deoxynucleotides enhances protective immunity against genital Chlamydia muridarum infection. Vaccine 25:3773-3780. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cotter, T. W., Q. Meng, Z. L. Shen, Y. X. Zhang, H. Su, and H. D. Caldwell. 1995. Protective efficacy of major outer membrane protein-specific immunoglobulin A (IgA) and IgG monoclonal antibodies in a murine model of Chlamydia trachomatis genital tract infection. Infect. Immun. 63:4704-4714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Debattista, J., P. Timms, J. Allan, and J. Allan. 2003. Immunopathogenesis of Chlamydia trachomatis infections in women. Fertil. Steril. 79:1273-1287. [DOI] [PubMed] [Google Scholar]
  • 9.Dong, F., Y. Zhong, B. Arulanandam, and G. Zhong. 2005. Production of a proteolytically active protein, chlamydial protease/proteasome-like activity factor, by five different Chlamydia species. Infect. Immun. 73:1868-1872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gross, D. M., T. Forsthuber, M. Tary-Lehmann, C. Etling, K. Ito, Z. A. Nagy, J. A. Field, A. C. Steere, and B. T. Huber. 1998. Identification of LFA-1 as a candidate autoantigen in treatment-resistant Lyme arthritis. Science 281:703-706. [DOI] [PubMed] [Google Scholar]
  • 11.Igietseme, J. U., K. H. Ramsey, D. M. Magee, D. M. Williams, T. J. Kincy, and R. G. Rank. 1993. Resolution of murine chlamydial genital infection by the adoptive transfer of a biovar-specific, Th1 lymphocyte clone. Reg. Immunol. 5:317-324. [PubMed] [Google Scholar]
  • 12.Kelly, K. A., and R. G. Rank. 1997. Identification of homing receptors that mediate the recruitment of CD4 T cells to the genital tract following intravaginal infection with Chlamydia trachomatis. Infect. Immun. 65:5198-5208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Landers, D. V., K. Erlich, M. Sung, and J. Schachter. 1991. Role of L3T4-bearing T-cell populations in experimental murine chlamydial salpingitis. Infect. Immun. 59:3774-3777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Li, W., M. N. Guentzel, J. Seshu, G. Zhong, A. K. Murthy, and B. P. Arulanandam. 2007. Induction of cross-serovar protection against genital chlamydial infection by a targeted multisubunit vaccination approach. Clin. Vaccine Immunol. 14:1537-1544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Li, W., A. K. Murthy, M. N. Guentzel, J. Seshu, T. G. Forsthuber, G. Zhong, and B. P. Arulanandam. 2008. Antigen-specific CD4+ T cells produce sufficient IFN-gamma to mediate robust protective immunity against genital Chlamydia muridarum infection. J. Immunol. 180:3375-3382. [DOI] [PubMed] [Google Scholar]
  • 16.Morrison, R. P., and H. D. Caldwell. 2002. Immunity to murine chlamydial genital infection. Infect. Immun. 70:2741-2751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Morrison, S. G., and R. P. Morrison. 2000. In situ analysis of the evolution of the primary immune response in murine Chlamydia trachomatis genital tract infection. Infect. Immun. 68:2870-2879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Morrison, S. G., and R. P. Morrison. 2001. Resolution of secondary Chlamydia trachomatis genital tract infection in immune mice with depletion of both CD4+ and CD8+ T cells. Infect. Immun. 69:2643-2649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Morrison, S. G., and R. P. Morrison. 2005. A predominant role for antibody in acquired immunity to chlamydial genital tract reinfection. J. Immunol. 175:7536-7542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Morrison, S. G., H. Su, H. D. Caldwell, and R. P. Morrison. 2000. Immunity to murine Chlamydia trachomatis genital tract reinfection involves B cells and CD4+ T cells but not CD8+ T cells. Infect. Immun. 68:6979-6987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Murphey, C., A. K. Murthy, P. A. Meier, M. N. Guentzel, G. Zhong, and B. P. Arulanandam. 2006. The protective efficacy of chlamydial protease-like activity factor vaccination is dependent upon CD4+ T cells. Cell. Immunol. 242:110-117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Murthy, A. K., B. K. Chaganty, W. Li, M. N. Guentzel, J. P. Chambers, J. Seshu, G. Zhong, and B. P. Arulanandam. 2009. A limited role for antibody in protective immunity induced by rCPAF and CpG vaccination against primary genital Chlamydia muridarum challenge. FEMS Immunol. Med. Microbiol. 55:271-279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Murthy, A. K., J. P. Chambers, P. A. Meier, G. Zhong, and B. P. Arulanandam. 2007. Intranasal vaccination with a secreted chlamydial protein enhances resolution of genital Chlamydia muridarum infection, protects against oviduct pathology, and is highly dependent upon endogenous gamma interferon production. Infect. Immun. 75:666-676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Murthy, A. K., Y. Cong, C. Murphey, M. N. Guentzel, T. G. Forsthuber, G. Zhong, and B. P. Arulanandam. 2006. Chlamydial protease-like activity factor induces protective immunity against genital chlamydial infection in transgenic mice that express the human HLA-DR4 allele. Infect. Immun. 74:6722-6729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Murthy, A. K., M. N. Guentzel, G. Zhong, and B. P. Arulanandam. 2009. Chlamydial protease-like activity factor—insights into immunity and vaccine development. J. Reprod. Immunol. 83:179-184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Murthy, A. K., J. Sharma, J. J. Coalson, G. Zhong, and B. P. Arulanandam. 2004. Chlamydia trachomatis pulmonary infection induces greater inflammatory pathology in immunoglobulin A deficient mice. Cell. Immunol. 230:56-64. [DOI] [PubMed] [Google Scholar]
  • 27.Pal, S., E. M. Peterson, and L. M. de la Maza. 2005. Vaccination with the Chlamydia trachomatis major outer membrane protein can elicit an immune response as protective as that resulting from inoculation with live bacteria. Infect. Immun. 73:8153-8160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Perry, L. L., K. Feilzer, and H. D. Caldwell. 1997. Immunity to Chlamydia trachomatis is mediated by T helper 1 cells through IFN-gamma-dependent and -independent pathways. J. Immunol. 158:3344-3352. [PubMed] [Google Scholar]
  • 29.Perry, L. L., K. Feilzer, J. L. Portis, and H. D. Caldwell. 1998. Distinct homing pathways direct T lymphocytes to the genital and intestinal mucosae in Chlamydia-infected mice. J. Immunol. 160:2905-2914. [PubMed] [Google Scholar]
  • 30.Perry, L. L., H. Su, K. Feilzer, R. Messer, S. Hughes, W. Whitmire, and H. D. Caldwell. 1999. Differential sensitivity of distinct Chlamydia trachomatis isolates to IFN-γ-mediated inhibition. J. Immunol. 162:3541-3548. [PubMed] [Google Scholar]
  • 31.Ramsey, K. H., and R. G. Rank. 1991. Resolution of chlamydial genital infection with antigen-specific T-lymphocyte lines. Infect. Immun. 59:925-931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Rank, R. G. 1994. Animal models for urogenital infections. Methods Enzymol. 235:83-93. [DOI] [PubMed] [Google Scholar]
  • 33.Roan, N. R., T. M. Gierahn, D. E. Higgins, and M. N. Starnbach. 2006. Monitoring the T cell response to genital tract infection. Proc. Natl. Acad. Sci. U. S. A. 103:12069-12074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Su, H., and H. D. Caldwell. 1995. CD4+ T cells play a significant role in adoptive immunity to Chlamydia trachomatis infection of the mouse genital tract. Infect. Immun. 63:3302-3308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Su, H., M. Parnell, and H. D. Caldwell. 1995. Protective efficacy of a parenterally administered MOMP-derived synthetic oligopeptide vaccine in a murine model of Chlamydia trachomatis genital tract infection: serum neutralizing IgG antibodies do not protect against chlamydial genital tract infection. Vaccine 13:1023-1032. [DOI] [PubMed] [Google Scholar]
  • 36.Yu, H., X. Jiang, C. Shen, K. P. Karunakaran, J. Jiang, N. L. Rosin, and R. C. Brunham. 2010. Chlamydia muridarum T-cell antigens formulated with the adjuvant DDA/TDB induce immunity against infection that correlates with a high frequency of gamma interferon (IFN-γ)/tumor necrosis factor alpha and IFN-γ/interleukin-17 double-positive CD4+ T cells. Infect. Immun. 78:2272-2282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Zhong, G., P. Fan, H. Ji, F. Dong, and Y. Huang. 2001. Identification of a chlamydial protease-like activity factor responsible for the degradation of host transcription factors. J. Exp. Med. 193:935-942. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES