Transcriptional Regulation of the Terephthalate Catabolism Operon in Comamonas sp. Strain E6

Abstract

Two almost identical gene clusters, tphR_IC_IA2_IA3_IB_IA1_I and tphR_IIC_IIA2_IIA3_IIB_IIA1_II, are responsible for the conversion of terephthalate (TPA) to protocatechuate in Comamonas sp. strain E6. In the present study, we investigated the transcriptional regulation of the tphR_IIC_IIA2_IIA3_IIB_IIA1_II gene cluster. Reverse transcription-PCR analysis suggested that the tphR_IIC_IIA2_IIA3_IIB_IIA1_II genes form two transcriptional units, the tphC_IIA2_IIA3_IIB_IIA1_II catabolism operon and tphR_II, with the latter encoding an IclR-type transcriptional regulator (ITTR). The transcription start site of the tph_II catabolism operon was mapped at 21 nucleotides upstream of the initiation codon of tphC_II. The lacZ transcriptional fusion experiments showed that tphR_II encodes a transcriptional activator of the tph_II catabolism operon and that TPA acts as an inducer. On the other hand, TphR_II appeared to repress its own transcription regardless of the presence of TPA. The analysis of mutant derivatives of E6 indicated that tphR_II is essential for the transcriptional activation of the tph_II catabolism operon and the growth on TPA of a tph_I-deficient derivative of E6. Purified His-tagged TphR_II bound specifically to the tphR_II-tphC_II intergenic region containing a 21-bp inverted repeat sequence. Alignment of the inverted repeat sequences in the binding sites for TphR_II and other members of ITTRs revealed highly conserved nucleotides. The substitution of conserved nucleotides resulted in significantly reduced TPA-dependent transcriptional activation from the tphC_II promoter and reduced binding to His-tagged TphR_II. These results clearly indicate that the conserved nucleotides are required for the inducible expression of the tph_II catabolism operon regulated by TphR_II.

The phthalate isomers terephthalate (TPA), isophthalate, and o-phthalate are widely used as plasticizers and are degraded by microbial catabolic pathways via protocatechuate (PCA) (8, 9, 26, 30). The degradation of PCA is catalyzed by one of the following three aromatic ring cleavage pathways: the PCA 2,3-cleavage (17), the PCA 3,4-cleavage (14), or the PCA 4,5-cleavage (19, 20) pathway. 2-Pyrone-4,6-dicarboxylate (PDC), which appears as an intermediate metabolite in the PCA 4,5-cleavage pathway (19, 20), has been considered to be a useful chemical building block for the synthesis of biodegradable and high-function polymers (15, 22, 23). Due to the potentiality of phthalate isomers to act as starting materials for the production of PDC, it has become increasingly more important to elucidate the microbial catabolism genes for phthalates and their regulation.

Previously, our research group isolated a TPA degrader, Comamonas sp. strain E6, which is able to grow on TPA, isophthalate, and o-phthalate as the sole source of carbon and energy; and these compounds are degraded via the PCA 4,5-cleavage pathway (9, 30). We reported on the characterization of two almost identical TPA catabolism gene clusters (>94% identity) of E6, tphR_IC_IA2_IA3_IB_IA1_I (GenBank accession no. AB238678) and tphR_IIC_IIA2_IIA3_IIB_IIA1_II (GenBank accession no. AB238679) (30). The catabolism of TPA is initiated by the transformation of TPA into 1,2-dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylate (1,4-DCD) by TPA 1,2-dioxygenase (oxygenase component, TphA2 and TphA3; reductase component, TphA1), and 1,4-DCD is converted to PCA by 1,4-DCD dehydrogenase (TphB) (Fig. 1 A). The resulting PCA is further degraded via the PCA 4,5-cleavage pathway. On the basis of the amino acid sequence similarity and the findings of expression studies, tphC and tphR were suggested to code for a receptor and a regulator involved in TPA catabolism: a periplasmic TPA binding receptor and an IclR-type transcriptional regulator (ITTR), respectively.

FIG. 1.

TPA catabolic pathway of Comamonas sp. strain E6 (A) and schematic diagrams of the gene disruptions in E6 (B). (A) TphA2, oxygenase large subunit of TPA 1,2-dioxygenase; TphA3, oxygenase small subunit of TPA 1,2-dioxygenase; TphA1, reductase component of TPA 1,2-dioxygenase; TphB, 1,4-DCD dehydrogenase. (B) The horizontal bars in the thick arrows indicate the regions deleted in EME009, EME010, and EME011. Abbreviations for restriction enzymes: M, MunI; P, PstI; Sm, SmaI; Sp, SphI; T, Tth111I; Xb, XbaI.

The TPA catabolic pathway has also been reported in Comamonas testosteroni T-2 (32), C. testosteroni YZW-D (37), Delftia tsuruhatensis T7 (33), Rhodococcus sp. strain DK17 (4), and Rhodococcus jostii RHA1 (13). The TPA catabolism gene clusters were identified in YZW-D, DK17, and RHA1; and all of these gene clusters include a gene encoding a putative ITTR, which appeared to be involved in TPA catabolism. Several ITTRs involved in the degradation of aromatic compounds have been described. This family includes, among others, PcaU and PcaR, activators of β-ketoadipate pathway genes in Acinetobacter baylyi ADP1 (5, 10) and Pseudomonas putida PRS2000 (29), respectively; PobR, an activator of the p-hydroxybenzoate 3-hydroxylase gene, pobA, from A. baylyi ADP1 (6); as well as CatR, a repressor of the catechol ortho-cleavage pathway genes in Rhodococcus erythropolis CCM2595 (36). However, the transcriptional regulation of TPA catabolism genes has not yet been reported.

In this report, we describe the transcriptional control of one of the tph catabolism gene clusters, tphC_IIA2_IIA3_IIB_IIA1_II, regulated by the tphR_II gene product. This is the first report on the characterization of the regulation of TPA catabolism genes.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. Comamonas sp. strain E6 was grown in Luria-Bertani (LB) medium or in W minimal salt medium (27) containing 10 mM TPA or 10 mM succinate at 30°C. Escherichia coli strains were grown in LB medium at 37°C. For cultures of cells carrying antibiotic resistance markers, the media for E. coli transformants were supplemented with 100 mg of ampicillin (Ap)/liter or 25 mg of kanamycin (Km)/liter, and the media for E6 transformants were supplemented with 50 mg of Km/liter or 30 mg of chloramphenicol/liter.

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid	Relevant characteristic(s)a	Source or reference
Comamonas sp.
E6	Wild type, TPA+	30
EME009	E6 derivative, ΔtphRItphCI	This study
EME010	EME009 derivative, ΔtphRII	This study
EME011	EME009 derivative, ΔtphA2IA3IBIA1ItphA2II	This study
E. coli
DH5α	supE44 ΔlacU169 (φ80 lacZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1	12
XL2-Blue	recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15 Tn10 (Tcr) Amy Cmr]	Stratagene
BL21(DE3)	F−ompT hsdSB(rB− mB−) gal dcm (DE3), T7 RNA polymerase gene under control of the lacUV promoter	35
Plasmids
pBluescript II SK(+)	Cloning vector, Apr	34
pT7Blue	Cloning vector, Apr T7 promoter	Novagen
pK19mobsacB	oriT sacB Kmr	31
pKT230MC	IncQ broad-host-range cloning vector, Kmr	25
pJB866	RK2 broad-host-range expression vector, Tcr PmxylS	2
pET16b	Expression vector, N-terminal His10 tag, Apr T7 promoter	Novagen
pPR9TZ	Broad-host-range promoter probe vector, RK2 ori Apr Cmr	17
pSS92R	pBluescript II SK(+) with a 4.0-kb SalI fragment carrying tphRI and tphCI	This study
pK19RCI	pK19mobsacB with a 2.5-kb EcoRV-HindIII fragment of pSS92R	This study
pDTRCI	pK19RCI with a deletion of a 0.5-kb XbaI-SmaI fragment carrying the tphRI-tphCI intergenic region	This study
pEJ89	pJB866 with a 8.9-kb EcoRI fragment carrying tphRIICIIA2IIA3IIBIIA1II	30
pEJ84	pEJ89 with a deletion of a 0.6-kb MunI-Tth111I fragment carrying part of tphRII	30
pDTRII	pK19mobsacB with a 2.3-kb EcoRI-HindIII fragment of pEJ84	This study
pK19A2II	pK19mobsacB with a 2.0-kb HindIII-XhoI fragment carrying tphA2II	This study
pDTA2II	pK19A2II with a deletion of a 0.5-kb SphI-PstI fragment carrying part of tphA2II	This study
pK19ABIF	pK19mobsacB with a 4.3-kb HindIII fragment carrying tphA2IA3IBIA1I	This study
pDTABI	pK19ABIF with a deletion of a 1.9-kb PstI fragment carrying tphA2IA3IBIA1I	This study
pKTRII	pKT230MC with a 1.8-kb KpnI fragment carrying tphRII	This study
pKTtphII	pKT230MC with a 8.9-kb EcoRI fragment carrying tphRIICIIA2IIA3IIBIIA1II	This study
pTRII	pT7Blue with a 779-bp PCR fragment generated by the TphRII-F and TphRII-R primer pair	This study
pETtprII	pET16b with a 772-bp NdeI-XhoI fragment of pTRII	This study
pTTC	pT7Blue with a 393-bp PCR fragment carrying the tphRII-tphCII intergenic region	This study
pZTC	pPR9TZ with a 381-bp HindIII-KpnI fragment of pTTC	This study
pTTR	pT7Blue with a 500-bp PCR fragment carrying the tphRII-tphCII intergenic region	This study
pZTR	pPR9TZ with a 379-bp HindIII-KpnI fragment of pTTR	This study
pTTCT5C	Site-directed mutant of pTTC generated by the SMT5C-F and SMT5C-R primer pair	This study
pTTCG6A	Site-directed mutant of pTTC generated by the RM315-F and RM315-R primer pair	This study
pTTCC7T	Site-directed mutant of pTTC generated by the SMC7T-F and SMC7T-R primer pair	This study
pTTCG8A	Site-directed mutant of pTTC generated by the SMG8A-F and SMG8A-R primer pair	This study
pT5C	pPR9TZ with a 381-bp HindIII-KpnI fragment of pTTCT5C	This study
pG6A	pPR9TZ with a 381-bp HindIII-KpnI fragment of pTTCG6A	This study
pC7T	pPR9TZ with a 381-bp HindIII-KpnI fragment of pTTCC7T	This study
pG8A	pPR9TZ with a 381-bp HindIII-KpnI fragment of pTTCG8A	This study

^aAbbreviations: TPA⁺, able to grow on TPA as the sole carbon source; Ap^r, Km^r, Tc^r, and Cm^r, resistance to ampicillin, kanamycin, tetracycline, and chloramphenicol, respectively.

DNA manipulations and nucleotide sequencing.

DNA manipulations, including total DNA isolation, construction of deletion derivatives, and nucleotide sequencing, were performed as described previously (18). Analysis of nucleotide sequences was carried out as described previously (1).

Generation of mutants.

The 2.5-kb EcoRV-HindIII fragment carrying tphR_I and tphC_I of pSS92R was inserted into pK19mobsacB to generate pK19RCI. The 0.5-kb XbaI-SmaI fragment including the intergenic region between tphR_I and tphC_I of pK19RCI was deleted. The resulting plasmid, pDTRCI, was introduced into E6 cells by electroporation, and candidates for the deletion mutant of the tphR_I-tphC_I intergenic region (strain EME009) were isolated (Fig. 1B) as described previously (21). In order to disrupt the tphR_II gene in EME009, the 0.6-kb MunI-Tth111I fragment of the tphR_II internal region in pEJ89 was deleted, and then the 2.3-kb EcoRI-HindIII fragment carrying part of tphR_II was cloned into pK19mobsacB. The resulting plasmid, pDTRII, was further introduced into EME009 cells, and candidates for the mutant (strain EME010) were isolated (Fig. 1B). To obtain a mutant which lacked the ability to transform TPA, the tphA2_II disruption plasmid, pDTA2II, was introduced into EME009 cells. Furthermore, the tphA2_IA3_IB_IA1_I disruption plasmid, pDTABI, was introduced into the resulting mutant cells to obtain EME011 (Fig. 1B).

Disruption of the genes was examined by Southern hybridization analysis. To confirm the disruptions of the tphR_I-tphC_I intergenic region, tphR_II, and tphA2_II, total DNA of candidates for mutants were digested with HincII-HindIII. To confirm the tphA2_IA3_IB_IA1_I deletion, total DNA of candidates for the mutant was digested with HindIII. The 0.8-kb XbaI-PvuII fragment carrying the tphR_I-tphC_I intergenic region, the 1.3-kb PstI fragment carrying tphR_II, and the 0.9-kb SmaI-NcoI fragment carrying tphA2_II were labeled with a digoxigenin (DIG) system (Roche, Mannheim, Germany) and used as probes.

Reverse transcription (RT)-PCR.

EME009 cells were grown in W minimal salt medium supplemented with 10 mM TPA or 10 mM succinate at 30°C. When the absorbance at 600 nm (A₆₀₀) of the culture was 1.0, the cells were harvested by centrifugation at 5,000 × g at 4°C for 10 min. Total RNA was isolated with the Isogen reagent (Nippon Gene, Toyama, Japan), according to the manufacturer's instructions. Purified RNA was then treated with RNase-free DNase I (Takara Bio Inc., Otsu, Japan) to remove contaminating DNA. Single-stranded cDNA was synthesized from 5.0 μg of total RNA utilizing PrimeScript reverse transcriptase (Takara Bio Inc.) with random primers in a 20-μl reaction mixture. PCR amplification was performed using 2.0 μl of the cDNA mixture, specific primers (Table 2), and Ex Taq DNA polymerase (Takara Bio Inc.) under the following conditions: 95°C for 30 s and 35 cycles of 95°C for 60 s, 62°C for 60 s, and 72°C for 60 s. A control without reverse transcriptase was used for each reaction to verify the absence of genomic DNA contamination. Samples from the PCR were electrophoresed on a 1.8% agarose gel and visualized with ethidium bromide.

TABLE 2.

Primer sequences used in this study

Primer use and primer	Sequence (5′-3′)a
RT-PCR analysis
insxRF	CCTAACAGCAATGCTCATGG
insRR	ACTACTGGATGCACTGTCGG
intRCF	ACAGTGCATCCAGTAGTGGC
intRCR	AGGCTAGCACAGTCATTCCG
insCF	ACGGAATGACTGTGCTAGCC
insCR	GGATGAACTGAGCAGTCTTGG
intCA2F	CGAGAAGTGGAAGAAGGTGC
intCA2R	TTGTGAGAGGCGATTCAGC
intA2A3F	GCTGCCTAACAACTGGAAGC
intA2A3R	GCAATAGTGGCAATCCTTGG
intA3BF	TGTCGACAACCATGATGAGG
intA3BR	ACGATGTCTTGAAGAAGCGG
intBA1F	ACGACCTGTATGTAGCCATGC
intBA1R	ATAGTGCTGAAGCGACCACC
insA1F	GATCCATATCCACGACTCCG
insA1R	ATGGCGCTAGGAAGATACAGG
Primer extension
PEtphC110	GGCACGACGATCTTGAGAGG
PEtphR160	GCTGTACCAGTGTGCTGAGC
Construction of promoter-lacZ fusion plasmids
HRC-F	AAGCTTGAGCGAACGTCTGG (HindIII)
HRC-R	GGAACACTAGATCGGCACC
KRCH-F	GGTACCGATAGCCAAGCTGTACC (KpnI)
KRCH-R	AAGCTTCGACGATCTTGAGAGG (HindIII)
Construction of tphRII expression plasmids
TphRII-F	CATATGCAGGACAAGAACTTTGTGG (NdeI)
TphRII-R	CTCGAGCACTACAACCCCTGCG (XhoI)
EMSAs
RMF01	GTTCTTGTCCTGCATAGCG
RMF11	GACATCCTCATACTGCAGTTCC
RMR01	GTCTGCGAATAGATTCGTTGC
RMR11	AACTGCAGTATGAGGATGTCG
RM31-F	CAACATTTTTGCGCATAGCGCAAAAACAGGT
RM31-R	ACCTGTTTTTGCGCTATGCGCAAAAATGTTG
RM315-F	CAACATTTTTaCGCATAGCGCAAAAACAGGT
RM315-R	ACCTGTTTTTGCGCTATGCGtAAAAATGTTG
Site-directed mutagenesis
SMT5C-F	GGTGTTTTCAACATTTTcGCGCATAGCGCAAAAACAGG
SMT5C-R	CCTGTTTTTGCGCTATGCGCgAAAATGTTGAAAACACC
SMC7T-F	GGTGTTTTCAACATTTTTGtGCATAGCGCAAAAACAGG
SMC7T-R	CCTGTTTTTGCGCTATGCaCAAAAATGTTGAAAACACC
SMG8A-F	GGTGTTTTCAACATTTTTGCaCATAGCGCAAAAACAGG
SMG8A-R	CCTGTTTTTGCGCTATGtGCAAAAATGTTGAAAACACC

^aEngineered restriction sites are underlined, and the corresponding restriction enzymes are shown in parentheses. Mutated nucleotides are in lowercase.

Primer extension.

E6 cells harboring pKTtphII were grown in W minimal salt medium containing 10 mM succinate either with or without 10 mM TPA at 30°C. After 4 h of incubation, total RNA was isolated as described above. The primers used to detect the start sites of tphC_II and tphR_II mRNAs were PEtphC110 and PEtphR160 (Table 2), respectively, which are complementary to the nucleotide sequences between positions +90 and +110 and between positions +138 and +157 relative to the start codons of tphC_II and tphR_II, respectively. The primers were labeled at their 5′ ends with dye D4 (Beckman Coulter Inc., Fullerton, CA). A labeled primer (2 pmol) was hybridized to 5.0 μg of the total RNA preparation. A primer extension reaction was performed by incubating the annealing mixture with 200 U of PrimeScript reverse transcriptase at 42°C for 45 min. After the extension, the enzyme was inactivated by being exposed to a temperature of 95°C for a period of 10 min and ethanol precipitated. The products were then analyzed by a CEQ2000XL genetic analysis system (Beckman Coulter Inc.).

LacZ transcriptional fusions and β-galactosidase activity assays.

To determine the promoter activities of tphC_II and tphR_II, pZTC and pZTR, which expressed the tphC_II promoter-lacZ fusion and the tphR_II promoter-lacZ fusion, respectively, were introduced into cells of E6 and its mutant derivatives by electroporation. The resulting transformants were grown in W minimal salt medium containing 10 mM succinate either with or without 10 mM TPA, phthalate, isophthalate, or PCA at 30°C. After 4 h of incubation, cells were harvested and resuspended in 20 mM Tris-HCl buffer (pH 8.0), broken by an ultrasonic disintegrator (UD-201; Tomy Seiko Co., Tokyo, Japan), and centrifuged at 15,000 × g for 15 min. The resulting supernatants were used as crude enzymes. The protein concentration was determined by the Bradford method (3).

β-Galactosidase activity assays with 4-methylumbelliferyl-β-d-galactopyranoside (4MUG) as the substrate were performed as follows. A 300-μl assay mixture contained 20 mM Tris-HCl (pH 8.0), crude extract (50 μg or 1 mg of protein), and 300 μM 4MUG. After incubation of said mixture for 15 min, 200 μl of the reaction mixture was transferred to 1.8 ml of 100 mM glycine-NaOH buffer (pH 10.0), and then the production of 4-methylumbelliferone (4MU) was detected with an RF-1500 spectrofluorometer (Shimadzu, Kyoto, Japan). One unit of enzyme activity was defined as the amount of enzyme that resulted in the production of 1 μmol of 4MU per min. Specific activity was expressed in units per milligram of protein.

Expression of His tag-fused tphR_II in E. coli.

The coding region of tphR_II was amplified by PCR using Ex Taq DNA polymerase together with pKTtphII as the template as well as the TphRII-F and TphRII-R primer pair (Table 2). The 779-bp PCR product was cloned in pT7Blue and sequenced. The 772-bp NdeI-XhoI fragment of the resulting plasmid was inserted into pET16b to generate pETtprII, which fused the codons for 10 histidines (His tag) at the 5′ end of tphR_II. E. coli BL21(DE3) cells harboring pETtprII were grown in 1 liter of LB medium containing 100 mg of Ap/liter at 30°C. When the A₆₀₀ of the culture reached 0.5, the expression of His tag-fused tphR_II was induced for 2 h by adding 1 mM isopropyl-β-d-thiogalactopyranoside. After the incubation, cells were harvested and resuspended in 50 mM Tris-HCl buffer (pH 7.5), broken by three passages through a French pressure cell (Aminco, Urbana, IL), and centrifuged at 26,000 × g for 20 min. The resulting supernatants were used as crude enzymes.

Purification of His-TphR_II.

To remove nucleic acids, streptomycin sulfate was added to the crude enzyme to a final concentration of 1%. The lysate was kept on ice for 10 min and centrifuged at 15,000 × g for 15 min. The supernatant was applied to an Ni Sepharose 6 Fast Flow column (GE Healthcare, Buckinghamshire, United Kingdom) previously equilibrated with buffer A, consisting of 50 mM Tris-HCl (pH 7.5), 500 mM NaCl, and 40 mM imidazole. Proteins were allowed to bind for 1 min at 4°C while they were rotated, followed by washing five times in 5 ml of buffer B, consisting of 50 mM Tris-HCl (pH 7.5), 500 mM NaCl, and 100 mM imidazole. His-tagged TphR_II (His-TphR_II) was eluted with 5 ml of buffer C, consisting of 50 mM Tris-HCl (pH 7.5), 500 mM NaCl, and 500 mM imidazole; and 500-μl fractions were pooled and concentrated by centrifugal filtration with a Microcon YM-30 apparatus (Millipore, Billerica, MA). The purity of the enzyme preparation was examined by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (SDS-PAGE).

Electrophoretic mobility shift assays (EMSAs).

DNA fragments containing the tphR_II-tphC_II intergenic region were synthesized by PCR with the specific primer pairs (Table 2). To prepare the RM31 and G6A probes, the RM31-F and RM31-R and the RM315-F and RM315-R oligonucleotide pairs, respectively, were annealed to each other. To prepare probes T5C, C7T, and G8A, the DNA fragments were amplified from pTTCT5C, pTTCC7T, and pTTCG8A, respectively, using the RMF01 and RMR01 primer pair. The 3′ ends of the fragments of probes were labeled with DIG-11-ddUTP utilizing the 2nd-generation DIG gel shift kit (Roche), according to the manufacturer's instructions. Binding reactions were performed in 10-μl reaction mixtures containing 20 ng of purified His-TphR_II (65 nM monomer), 0.1 or 1 nM DIG-labeled probes, 1 μg of poly[d(I-C)], 0.1 μg of poly-l-lysine, and 1× reaction buffer (20 mM Tris-HCl [pH 8.0], 100 mM KCl, 10% glycerol, 5 mM EDTA). The mixtures were then incubated at 20°C for 20 min, loaded onto 10% polyacrylamide gels in 0.5× Tris-borate-EDTA buffer, and then separated by gel electrophoresis at 80 V for 120 to 150 min. Subsequently, the DIG-labeled DNA was transferred to a nylon membrane (Hybond-N; GE Healthcare) at 200 mA for 1 h with a Trans Blot SD apparatus (Bio-Rad, Hercules, CA) and then visualized by an enzyme immunoassay using a DIG gel shift kit, following the manufacturer's instructions. For detection of the labeled DNA, X-ray film was used. In competitive assays, a 1,000-fold molar excess of unlabeled probe was added to the preformed protein-DNA complexes.

Site-directed mutagenesis of the tphR_II-tphC_II intergenic region.

Site-directed substitutions in the inverted repeat sequence occurring in the tphR_II-tphC_II intergenic region were introduced using a QuikChange site-directed mutagenesis kit (Stratagene, San Diego, CA) and plasmid pTTC as the template, according to the manufacturer's instructions. The oligonucleotides used for site-directed mutagenesis are listed in Table 2. All mutational changes were verified by DNA sequencing.

RESULTS AND DISCUSSION

RT-PCR analysis of tph_II genes.

Because tph_I and tph_II gene clusters are organized as tphR and tphCA2A3BA1, which are divergently transcribed from one another, the promoter regions for tphR and tphC were expected to be present in the tphR-tphC intergenic regions. Due to the fact that the nucleotide sequences of the tphR_I-tphC_I and tphR_II-tphC_II intergenic regions (109 bp) are identical and the amino acid sequence identity between TphR_I and TphR_II is 99%, the transcriptional regulation of both operons was thought to be the same. For all of these reasons, we focused on the regulation of the tph_II gene cluster. In order to characterize the transcription of the tph_II genes, we constructed a mutant of Comamonas sp. strain E6, EME009, in which the tphR_I-tphC_I intergenic region was deleted (Fig. 1B). To verify the effect of the deletion of the tphR_I-tphC_I intergenic region on E6 cells, RT-PCR was performed using total RNAs extracted from the cells of E6 and EME009 and the intBA1F and intBA1R primer pair, which was designed to amplify a 742-bp region of the tph_I and tph_II gene clusters (Fig. 2 A). The resulting RT-PCR products were digested with PstI and then analyzed by agarose gel electrophoresis. In the case of the wild-type strain, fragments of 301 bp and 441 bp derived from tph_I and fragments of 301 bp, 287 bp, and 154 bp derived from tph_II were observed. However, the 441-bp fragment was missing in the digested fragments obtained from EME009 cells, indicating that the tph_I genes were no longer transcribed in EME009 cells (Fig. 2A). The growth rate of EME009 cells on TPA was almost identical to that of the wild-type strain (data not shown). This result indicates that the tph_II gene cluster is sufficient to support the normal growth of E6 on TPA.

FIG. 2.

RT-PCR analysis of the tph gene clusters. (A) Agarose gel electrophoresis of the RT-PCR products digested with PstI. RT-PCR was performed using total RNAs extracted from the cells of E6 and EME009 grown on TPA and the intBA1F and intBA1R primer pair. Lane M, molecular size markers; lanes 1 and 2, PstI digests of RT-PCR products obtained from E6 and EME009 cells, respectively. (B) Total RNA used for cDNA synthesis was isolated from EME009 cells grown on TPA. The results of agarose gel electrophoresis of the products of RT-PCR assays with primers targeting tphR_II (lane 1; expected size, 403 bp), tphR_II-tphC_II (lane 2; expected size, 666 bp), tphC_II (lane 3; expected size, 657 bp), tphC_II-tphA2_II (lane 4; expected size, 745 bp), tphA2_II-tphA3_II (lane 5; expected size, 771 bp), tphA3_II-tphB_II (lane 6; expected size, 533 bp), tphB_II-tphA1_II (lane 7; expected size, 742 bp), and tphA1_II (lane 8; expected size, 738 bp) are shown. Lane M, molecular size markers; lanes + and −, RT-PCR with and without reverse transcriptase, respectively.

RT-PCR experiments were performed with total RNA extracted from EME009 cells grown on TPA and primers complementary to neighboring tph_II genes, as shown in Fig. 2B. RT-PCR products of the expected sizes were detected for the internal regions of tphR_II, tphC_II, and tphA1_II and the intergenic regions of tphC_II-tphA2_II, tphA2_II-tphA3_II, tphA3_II-tphB_II, and tphB_II-tphA1_II (Fig. 2B). However, no product was observed when a primer pair that spans tphR_II-tphC_II was used. These results suggest that all the tph_II catabolism genes except tphR_II are organized in the same transcriptional unit, with tphR_II being transcribed divergently from tphC_II.

Determination of transcription start site of tph_II catabolism operon.

The transcription start site of the tph_II catabolism operon was determined by primer extension analysis using a primer, PEtphC110, that anneals to tphC_II sequences. Due to the fact that no significant extension product was observed when total RNA from E6 cells was used as the template, total RNAs were prepared from E6 cells harboring plasmid pKTtphII, which carries tphR_IIC_IIA2_IIA3_IIB_IIA1_II. In this analysis, a single major product was observed using RNA isolated from the cells grown in W minimal salt medium containing succinate and TPA (Fig. 3 A), while no product was obtained with RNA isolated from the cells grown on succinate (data not shown). The transcription start site of the tph_II catabolism operon was mapped at the C residue located at 21 nucleotides upstream from the ATG start codon of tphC_II (Fig. 3B). Putative −35 (TTAACA) and −10 (CATACT) sequences were found upstream of the transcription start site. We also carried out a primer extension analysis to determine the transcription start site of tphR_II; however, no extension product was obtained under our experimental conditions.

FIG. 3.

Determination of the transcription start site of the tphC_II operon. (A) Fluorescent primer extension was performed with D4-labeled primer PEtphC110 and 5 μg of total RNA isolated from E6 cells harboring pKTtphII grown in W minimal salt medium containing 10 mM succinate with 10 mM TPA. The transcription start site was determined by comparing the retention time of the D4-labeled primer extension product with the retention times of DNA size standards. AU, arbitrary fluorescence units. (B) Nucleotide sequence of the tphR_II-tphC_II intergenic region. The initiation codons for tphR_II and tphC_II are indicated by boldface lowercase letters. The transcription start site (position +1), putative −10 and −35 regions of the tphC_II promoter, and sequence of PEtphC110 are indicated. The inverted repeat sequence is boxed.

Promoter activities of tph_II catabolism operon and tphR_II.

The tphR_II-tphC_II intergenic region amplified by PCR was cloned into the promoter-probe vector pPR9TZ to generate a transcriptional fusion to the promoterless lacZ reporter gene. The resulting tphC_II promoter-lacZ fusion plasmid, pZTC, included a DNA fragment which spans from positions −254 to +127 in relation to the transcription start site of tphC_II. The levels of expression of the tphC_II promoter were examined in E6 and EME009 cells harboring pZTC. β-Galactosidase activity of E6 cells harboring pZTC was detected only in the cells grown in the presence of TPA (Table 3); therefore, the cis-acting region necessary for the transcriptional activation of the tph_II catabolism operon appeared to be in the tphR_II-tphC_II intergenic region. tphC_II promoter activity in response to TPA was also detected in EME009 cells harboring pZTC (Table 3), suggesting that the presence of tphR_II is sufficient to control the inducible expression of the tph_II catabolism operon. In the cells of EME011 (Fig. 1B) harboring pZTC, which lacks the ability to transform TPA, tphC_II promoter activity was observed by supplementation with TPA (Table 3). This result demonstrates that TPA itself acts as an inducer for the tph_II catabolism operon. In addition, the tphC_II promoter activities observed in the presence of isophthalate, o-phthalate, or PCA were negligible; and these were also found in the absence of either compound (data not shown). The tphR_II promoter activity was constitutively expressed at a low level in E6 and EME009 cells, both harboring the tphR_II promoter-lacZ fusion plasmid pZTR (Table 3).

TABLE 3.

Promoter activities of tphC_II and tphR_II

Promoter	Strain	β-Galactosidase activity (mU/mg)
		With TPA	Without TPA
tphCII (pZTC)	E6	2.03 ± 0.14	NDa
	EME009	2.02 ± 0.12	ND
	EME011	2.53 ± 0.18	ND
	EME010	ND	ND
tphRII (pZTR)	E6	0.04 ± 0.01	0.04 ± 0.01
	EME009	0.05 ± 0.01	0.06 ± 0.01
	EME010	0.11 ± 0.02	0.09 ± 0.003

^aND, not detected.

Disruption of tphR_II.

The tphR_II gene in EME009 was inactivated by the gene replacement technique with the tphR_II disruption plasmid pDTRII so as to evaluate the role of tphR_II in TPA catabolism. The ability of the resulting mutant, EME010 (Fig. 1B), to grow on TPA was completely lost (Fig. 4). To determine if this growth deficiency was caused by the disruption of tphR_II, pKTRII, which contains the 1.8-kb KpnI fragment carrying tphR_II in pKT230MC, was introduced into EME010 cells. Complementation of EME010 with tphR_II restored the growth of the mutant on TPA (Fig. 4). These results indicate that tphR_II is essential for the TPA catabolism by EME009 cells.

FIG. 4.

Growth of E6 and EME010 cells on TPA. E6 (open circles), EME010 (open squares), and EME010 cells harboring pKTRII carrying tphR_II (closed squares) were grown in W minimal salt medium containing 10 mM TPA. The results are the means of the representatives of three independent experiments. Error bars are hidden behind the symbols.

In order to confirm whether the tphR_II gene product plays a role in the transcriptional regulation of the tph_II catabolism operon, the tphC_II promoter activity in EME010 cells harboring pZTC was measured. When the cells were grown in the presence or absence of TPA, no activity was observed (Table 3), suggesting that tphR_II encodes a transcriptional activator of the tph_II catabolism operon. On the other hand, the tphR_II promoter activity of EME010 cells harboring pZTR was about 2.5-fold greater than that of cells of E6 and EME009 harboring the same plasmid (Table 3). TphR_II appeared to negatively autoregulate the transcription from its own promoter, regardless of the presence of TPA, similar to that which was previously reported for ITTRs (24).

Binding of His-TphR_II to the tphR_II-tphC_II intergenic region.

The His tag-fused tphR_II gene was expressed in E. coli BL21(DE3) cells harboring pETtprII. Production of a 30-kDa protein in E. coli cells was observed by SDS-PAGE (data not shown). The size of this product was close to the predicted molecular mass of His-TphR_II (M_r, 30,696). EMSAs were carried out using purified His-TphR_II and the DIG-labeled RM149, RM102, RNM67, and RM31 probes covering nucleotide positions −103 to +46, −103 to −2, −21 to +46, and −66 to −36, respectively (position +1 is the tphC_II transcription start site) (Fig. 5 A). The binding experiments showed that the mobilities of the RM149, RM102, and RM31 fragments were retarded upon the addition of TphR_II, whereas no retardation was observed when the RNM67 probe was used (Fig. 5B). In these analyses, multiple complexes were observed. Because His-TphR_II tended to aggregate during desalting, formation of multiple complexes might be related to the nature of His-TphR_II. The retardations were almost completely abolished when a 1,000-fold excess of the same unlabeled probe was added to the reaction mixtures. This confirmed that His-TphR_II directly binds to the region from positions −66 to −36, which contains an inverted repeat sequence, 5′-TTTTTGCGCATAGCGCAAAAA-3′, centered at position −51 from the tphC_II transcription start site. In the case of the binding sites for several ITTRs, including PcaU, PcaR, and PobR, an external direct sequence repetition of the half site of the inverted repeat sequences was observed (7, 11, 16, 28); and this direct sequence repetition was required for the binding of PcaU (28). No such direct repeat sequence was found in the tphR_II-tphC_II intergenic region. In the case of other ITTRs, effector molecules had no effect on the affinity of the protein-DNA interactions (24). TPA also had no obvious effect on the binding of His-TphR_II to the tphR_II-tphC_II intergenic region.

FIG. 5.

Binding of His-TphR_II to the tphR_II-tphC_II intergenic region. (A) Schematic diagrams of the DNA fragments used in EMSAs. The sizes of the DNA probes are indicated in parentheses. The binding (+) and nonbinding (−) of the respective fragments are shown. The transcription start site (position +1) of tphC_II is indicated. (B) EMSAs of the binding of purified His-TphR_II to the tphR_II-tphC_II intergenic region. The positions of the unbound probe (free DNA) and His-TphR_II-DNA complex are shown. His-TphR_II (65 nM monomer), 100 μM TPA, and a 1,000-fold molar excess of the same unlabeled DNA fragment were added as indicated.

Site-directed mutagenesis of the inverted repeat sequence.

The existence of an inverted repeat sequence in the binding sites for PobR, PcaU, PcaR, and CatR has been reported (7, 10, 11, 36). Alignment of the inverted repeat sequences in the binding sites for TphR_II and these ITTRs revealed that T, C, G, A, C, G, and A at positions −57, −55, −54, −50, −48, −47, and −45 from the tphC_II transcriptional start site, respectively, are highly conserved (Fig. 6 A). To investigate the involvement of these conserved nucleotides in the transcriptional activation from the tphC_II promoter, conserved nucleotides T, C, and G, at positions −57, −55, and −54, respectively, were substituted by site-directed mutagenesis (Fig. 6B). The tphC_II promoter activities of E6 cells harboring mutated tphC_II promoter-lacZ fusion plasmid pT5C (T to C at position −57), pCT7 (C to T at position −55), or pG8A (G to A at position −54) and grown in the presence of TPA were only 0.9, 0.4, and 4.7%, respectively, of the activity obtained by E6 cells harboring pZTC grown under the same conditions. On the other hand, a single change from G at position −56, which is not conserved, to A (pG6A) resulted in only a slightly reduced β-galactosidase level (Fig. 6B). These results indicate that the T at residue −57, the C at residue −55, and the G at residue −54, which are conserved in the inverted repeat sequences, are important for TPA-dependent transcriptional activation from the tphC_II promoter.

FIG. 6.

β-Galactosidase activities from the wild-type and mutated tphC_II promoters. (A) Alignment of the inverted repeat sequence of the tphR_II-tphC_II intergenic region with the sequences involved in the binding of other ITTRs. Identical nucleotides are indicated by dark shading. The arrows indicate the inverted repeat sequence. Abbreviations (GenBank accession numbers): tphR_II-tphC_II_E6, the tphR_II-tphC_II intergenic region of E6 (AB238679); pobR-pobA_ADP, the pobR-pobA intergenic region of Acinetobacter baylyi ADP1 (L05770); pcaU-pcaI_ADP, the pcaU-pcaI intergenic region of ADP1 (L05770); pcaI_PRS, the pcaI promoter region of Pseudomonas putida PRS2000 (M88763); pcaK-pcaF_PRS, the pcaK-pcaF intergenic region of PRS2000 (U10895); pcaR_PRS, the pcaR promoter region of PRS2000 (L33795); catR-catA_1CP, the catR-catA intergenic region of Rhodococcus opacus 1CP (X99622); catR-catA_CCM, the catR-catA intergenic region of Rhodococcus erythropolis CCM2595 (AJ605581). (B) Effect of mutations in the inverted repeat sequence on tphC_II promoter activity. Mutated nucleotides are in lowercase. The arrows indicate the inverted repeat sequence. The transcription start site (position +1) of the tphC_II promoter is indicated. E6 cells harboring each plasmid were grown in W minimal salt medium containing 10 mM succinate either with or without 10 mM TPA. Each value is the average ± standard deviation (error bars) based on at least three independent experiments. Asterisks, activities lower than the limit of detection.

To investigate whether these nucleotides play a role in the formation of the His-TphR_II-DNA complex, EMSAs were performed with the mutated tphC_II promoter probes (Fig. 7 A). As shown in Fig. 7B, the C7T (C to T at position −55) probe was not bound by His-TphR_II, and significantly weak bindings were observed for the T5C (T to C at position −57) and G8A (G to A at position −54) probes. On the other hand, His-TphR_II formed high-affinity complexes with the G6A (G to A at position −56) probe, similar to that which was found for the wild-type probe (Fig. 7B). These binding profiles correlated with the tphC_II promoter activities. On the basis of these results, it is concluded that the conserved nucleotides are crucial for the ability to form the His-TphR_II-DNA complex. Furthermore, the binding of TphR_II to the inverted repeat sequence is required for the inducible expression of the tph_II catabolism operon in E6. The promoter region of the TPA catabolism gene cluster of C. testosteroni YZW-D (GenBank accession no. AY923836) showed 100% identity with the promoter regions of the tph_I/II gene clusters, and the deduced amino acid sequences between E6 tphR_II and YZW-D tphR showed 97% identity. These observations suggest that a common regulatory mechanism for the TPA catabolism genes exists in strains E6 and YZW-D.

FIG. 7.

EMSAs of the binding of His-TphR_II to the tphC_II promoter regions containing mutated inverted repeat sequences. (A) Schematic diagrams of the DNA fragments used in EMSAs. Mutated nucleotides are in lowercase. The sizes of the DNA probes are indicated in parentheses. The arrows indicate the inverted repeat sequence. (B) EMSAs of the binding of purified His-TphR_II to the RM149 and RM31 probes and their mutant derivatives. The positions of the unbound probe (free DNA) and His-TphR_II-DNA complex are indicated. His-TphR_II (65 nM monomer) and 100 μM TPA were added as indicated.

Conclusions.

The TPA-induced expression of the tphC_IIA2_IIA3_IIB_IIA1_II operon of Comamonas sp. strain E6 is controlled by TphR_II, which belongs to the ITTR family. His-TphR_II specifically binds to the inverted repeat sequence within the tphC_II-tphR_II intergenic region. The nucleotides in the inverted repeat sequences highly conserved among the promoter regions, which interact with PcaU, PcaR, PobR, and CatR, are essential for the TPA-dependent transcriptional activation from the tphC_II promoter and the formation of the His-TphR_II-DNA complex.