Volume 82, no. 9, p. 4235-4249, 2008. Page 4236, column 2, paragraph 3, lines 4 to 9: “To generate BAC36ΔvF, a PCR product was first obtained with the primers 5′-GAGCACCCTGAAATCCAGGCTCTACAGGTAGGCCACATACGCTCGCCACTCTATATGGTGTAGGCTGGAGCTGCTTC-3′ (forward) and 5′-CCGCCCTAAACAAAATCACAAGCTTAATAGCTGTCCAGAATGCGCAGATCAAAGTCCCATATGAATATCCTCCTTAG-3′ (reverse), using plasmid pMS102-Zeocin as a template.” should read “To generate BAC36ΔvF, a PCR product was first obtained with the primers 5′CCTTTGTTTTTCCACATCGGTGCCTTCACATATACAAGCCGGCACCATGGCCACTTACGTGTAGGCTGGAGCTGCTTC-3′ (forward) and 5′-ATTAGCAACAGCTTGTTATCTATGGTGTATGGCGATAGTGTTGGGAGTGTGATGGGCCATATGAATATCCTCCTTAG-3′ (reverse), using plasmid pMS102-Zeocin as a template.”
. 2010 Sep;84(18):9655. doi: 10.1128/JVI.01457-10
Kaposi's Sarcoma-Associated Herpesvirus Latent Gene vFLIP Inhibits Viral Lytic Replication through NF-κB-Mediated Suppression of the AP-1 Pathway: a Novel Mechanism of Virus Control of Latency
Feng-Chun Ye
1, Fu-Chun Zhou
1, Jian-Ping Xie
1, Tao Kang
1, Whitney Greene
1, Kurt Kuhne
1, Xiu-Fen Lei
1, Qui-Hua Li
1, Shou-Jiang Gao
1
Feng-Chun Ye
1Tumor Virology Program, Greehey Children's Cancer Research Institute, and Departments of Pediatrics, Microbiology and Immunology, Molecular Medicine, and Medicine, and Cancer Treatment and Research Center, The University of Texas Health Science Center, San Antonio, Texasand Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
Find articles by Feng-Chun Ye
Fu-Chun Zhou
1Tumor Virology Program, Greehey Children's Cancer Research Institute, and Departments of Pediatrics, Microbiology and Immunology, Molecular Medicine, and Medicine, and Cancer Treatment and Research Center, The University of Texas Health Science Center, San Antonio, Texasand Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
Find articles by Fu-Chun Zhou
Jian-Ping Xie
1Tumor Virology Program, Greehey Children's Cancer Research Institute, and Departments of Pediatrics, Microbiology and Immunology, Molecular Medicine, and Medicine, and Cancer Treatment and Research Center, The University of Texas Health Science Center, San Antonio, Texasand Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
Find articles by Jian-Ping Xie
Tao Kang
1Tumor Virology Program, Greehey Children's Cancer Research Institute, and Departments of Pediatrics, Microbiology and Immunology, Molecular Medicine, and Medicine, and Cancer Treatment and Research Center, The University of Texas Health Science Center, San Antonio, Texasand Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
Find articles by Tao Kang
Whitney Greene
1Tumor Virology Program, Greehey Children's Cancer Research Institute, and Departments of Pediatrics, Microbiology and Immunology, Molecular Medicine, and Medicine, and Cancer Treatment and Research Center, The University of Texas Health Science Center, San Antonio, Texasand Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
Find articles by Whitney Greene
Kurt Kuhne
1Tumor Virology Program, Greehey Children's Cancer Research Institute, and Departments of Pediatrics, Microbiology and Immunology, Molecular Medicine, and Medicine, and Cancer Treatment and Research Center, The University of Texas Health Science Center, San Antonio, Texasand Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
Find articles by Kurt Kuhne
Xiu-Fen Lei
1Tumor Virology Program, Greehey Children's Cancer Research Institute, and Departments of Pediatrics, Microbiology and Immunology, Molecular Medicine, and Medicine, and Cancer Treatment and Research Center, The University of Texas Health Science Center, San Antonio, Texasand Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
Find articles by Xiu-Fen Lei
Qui-Hua Li
1Tumor Virology Program, Greehey Children's Cancer Research Institute, and Departments of Pediatrics, Microbiology and Immunology, Molecular Medicine, and Medicine, and Cancer Treatment and Research Center, The University of Texas Health Science Center, San Antonio, Texasand Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
Find articles by Qui-Hua Li
Shou-Jiang Gao
1Tumor Virology Program, Greehey Children's Cancer Research Institute, and Departments of Pediatrics, Microbiology and Immunology, Molecular Medicine, and Medicine, and Cancer Treatment and Research Center, The University of Texas Health Science Center, San Antonio, Texasand Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
Find articles by Shou-Jiang Gao
1Tumor Virology Program, Greehey Children's Cancer Research Institute, and Departments of Pediatrics, Microbiology and Immunology, Molecular Medicine, and Medicine, and Cancer Treatment and Research Center, The University of Texas Health Science Center, San Antonio, Texasand Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
PMCID: PMC2937618
This corrects the article "Kaposi's Sarcoma-Associated Herpesvirus Latent Gene vFLIP Inhibits Viral Lytic Replication through NF-κB-Mediated Suppression of the AP-1 Pathway: a Novel Mechanism of Virus Control of Latency " in volume 82 on page 4235.
