Skip to main content
PLOS ONE logoLink to PLOS ONE
. 2010 Sep 15;5(9):e12778. doi: 10.1371/journal.pone.0012778

Mutations in Wnt2 Alter Presynaptic Motor Neuron Morphology and Presynaptic Protein Localization at the Drosophila Neuromuscular Junction

Faith L W Liebl 1,*, Cassandra McKeown 1, Ying Yao 2, Huey K Hing 3
Editor: Alain Chédotal4
PMCID: PMC2939895  PMID: 20856675

Abstract

Wnt proteins are secreted proteins involved in a number of developmental processes including neural development and synaptogenesis. We sought to determine the role of the Drosophila Wnt7b ortholog, Wnt2, using the neuromuscular junction (NMJ). Mutations in wnt2 produce an increase in the number of presynaptic branches and a reduction in immunolabeling of the active zone proteins, Bruchpilot and synaptobrevin, at the NMJ. There was no change, however, in immunolabeling for the presynaptic proteins cysteine-string protein (CSP) and synaptotagmin, nor the postsynaptic proteins GluRIIA and DLG at the NMJ. Consistent with the presynaptic defects, wnt2 mutants exhibit approximately a 50% reduction in evoked excitatory junctional currents. Rescue, RNAi, and tissue-specific qRT-PCR experiments indicate that Wnt2 is expressed by the postsynaptic cell where it may serve as a retrograde signal that regulates presynaptic morphology and the localization of presynaptic proteins.

Introduction

Synapses are specialized structures that allow neurons to communicate with one another. This communication is achieved by converting the electrical signal of the axon into a chemical signal at structures called active zones (AZs). AZs are made up of a dense protein matrix that collectively participates in synaptic vesicle exocytosis (for reviews see [1], [2]). Important components of this matrix include Ca2+ channels [3], proteins involved in vesicle fusion including SNAP-25, Synaptobrevin, and Syntaxin [4], [5], scaffolding proteins including Bassoon [6], Piccolo [7], CAST/ELKS/Bruchpilot [8], [9], [10], cell adhesion molecules including cadherins [11] and neuroligins [12], [13]. The assembly of AZs is thought to occur quickly after axonal target recognition and contact with the postsynaptic cell. AZ proteins are packaged and transported in vesicles and delivered to synaptic locations [14], [15], [16]. The mechanisms by which AZs are properly localized and maintained are largely unknown but likely involve transsynaptic signaling to coordinate the development of the presynaptic neuron with the postsynaptic cell.

The Wnt family of secreted glycoproteins, well characterized for their roles in several developmental processes including cell fate specification, axis patterning, and neural development (for reviews see [17][19]), also regulate synapse development (for reviews see [20], [21]). For example, mouse Wnt7a regulates the organization of presynaptic microtubules and clustering of the presynaptic proteins synapsin I [22] and synaptophysin [22], [23]. Similarly, the mouse Wnt3 protein increases axon branching, growth cone size, and synapsin I clustering in presynaptic sensory neurons [24]. Wnts 3, 5a, 7a, and 7b are expressed in the hippocampus along with Frizzled receptors where these proteins regulate synapse formation [25]. In Drosophila, Wingless (Wg) governs the development of both pre- and postsynaptic structures [26][28]. Finally, Drosophila Wnt5 positively regulates neuromuscular junction (NMJ) growth and the synaptic localization of active zone proteins [29].

Wnt proteins signal through at least three types of receptors including the Frizzled (Fz) family of receptors [18], [19], the Ryk/Drl family of receptor tyrosine kinases [30][34], and the receptor tyrosine kinase-like orphan receptor (Ror) [35], [36]. Drosophila Wnt5 has been shown to signal via Drl to mediate events such as axon repulsion [34], olfactory map formation [37], [38], and NMJ development [29]. In mammals, Wnt5a signals through Ror2 to regulate morphogenesis [35], [36] and members of the Fz family [39], [40] to promote cytoskeletal remodeling.

The Drosophila larval NMJ is a well-established model system for dissecting the molecular basis of synapse formation, growth, and remodeling. These synapses are similar to mammalian central synapses in that they are glutamatergic and remodel in response to activity [41], [42]. Using this system, we show in vivo for the first time that the Drosophila wnt7b ortholog, wnt2, participates in synapse development. Mutations in wnt2 result in increased branching of NMJ axons, loss of synaptobrevin, and a 50% reduction in evoked release. Rescue and RNAi data indicates that wnt2 may function in the postsynaptic muscle. We postulate that Wnt2 may serve as a postsynaptic signal that regulates the development of the presynaptic neuron.

Results

wnt2 Negatively Regulates Synaptic Growth and Alters the Synaptic Distribution of Brp

We previously found that Wnt5 signals via Drl to promote synaptic growth at the Drosophila NMJ [29]. Further, Drosophila Wg affects synapses both presynaptically by regulating growth of the NMJ [27] and postsynaptically by acting on Fz2 [26]. To investigate whether wnt2 is involved in synapse development, we examined the 6/7 NMJ of wnt2O mutant 3rd instar larvae. The wnt2O mutation introduces a stop codon at residue Q40 likely producing a null mutant. These mutants are viable but male sterile as previously described [43] and exhibit defects in the direct flight muscles due to the requirement of wnt2 in muscle patterning during pupation [44]. Using qRT-PCR, we observed that wnt2 RNA is expressed in the larval ventral body wall muscles (ΔC(t) = 9.63±0.24 cycles, n = 6). Careful examination of the wnt2O mutant larvae showed no visible defects in either the patterning or size of the muscles (Fig. S1: WT = 26180±1987 µm2, n = 6, wnt2O = 27130±1473 µm2, n = 8, p = 0.70). It's possible that, like other Wnts, wnt2 may function in the larval ventral body wall muscles to regulate synapse development.

To examine NMJ morphology, we visualized presynaptic motor neurons with the anti-HRP antibody to label neuronal membranes. Our analysis revealed that wnt2 mutants exhibited an increase in the number of branches compared with controls (Fig. 1A, C; WT = 4.92±0.65 branches, n = 12; wnt2O = 7.40±0.82 branches, n = 10, p = 0.03). Surprisingly, this increase in the number of branches did not produce an increase in the number of boutons (WT = 55.85±3.06 boutons, n = 13; wnt2O = 58.58±3.38 boutons, n = 12, p = 0.55). The size of the presynaptic motor neuron in wnt2 mutants, however, was approximately 44% larger than controls (WT = 348.4±58.89 µm2, n = 7; wnt2O = 501.8±37.78 µm2, n = 6, p = 0.04). These data suggest that wnt2 negatively regulates growth of the presynaptic motor neuron.

Figure 1. wnt2 Regulates Synaptic Growth at the Drosophila NMJ and Organization of the Presynaptic Active Zone.

Figure 1

A: Confocal micrographs of third instar larval NMJs on ventral longitudinal muscles 6 and 7 immunolabeled with α-HRP (magenta), which labels neuronal membranes, and α-Brp (green). Scale bar  = 20 µm. B: High magnification images of NMJ terminals shown in A. C: Quantification of Brp density (Brp puncta/µm2) and the number of branches per NMJ. D: Representative samples of evoked endplate jucntional currents (eEJCs) recorded from muscle 6, which was voltage clamped at −60 mV. (Right) Quantification of EJC amplitudes.

We examined the synaptic localization of the presynaptic protein, Bruchpilot/nc82 (Brp) by immunolabeling. Brp is a coiled-coil domain protein that clusters presynaptic Ca2+ channels and promotes AZ assembly [10], [45]. The total number of Brp puncta per NMJ was not significantly different in wnt2 mutants compared with controls (WT = 178.4±26.32 Brp puncta per NMJ, n = 7; wnt2O = 183.8±11.91 Brp puncta per NMJ, n = 8, p = 0.85). Since the amount of Brp at active zones is variable [46], [47], we quantified the mean fluorescence of Brp at the NMJ and found there was a 32% reduction in Brp immunofluorscence in wnt2 mutants (WT = 1.00±0.05 a.u., n = 7; wnt2O = 0.68±0.09 a.u., n = 7, p = 0.008). We also examined the density of Brp puncta, which is calculated by dividing the total Brp puncta by the area of the presynaptic motor neuron, and found that the density of Brp is slightly but significantly reduced in wnt2 mutants compared with controls (Fig. 1B, C; WT = 0.51±0.02 puncta/µm2, n = 9; wnt2O = 0.42±0.03 puncta/µm2, n = 8, p = 0.03) Our data suggests that, although the total number of Brp puncta are similar in wnt2 mutants and controls, the Brp puncta are more dispersed at the NMJ and may contain less Brp.

To verify that wnt2 is responsible for the observed phenotype, we examined the NMJ of wnt2O/Df(2R)BSC29 and wnt2I [43] mutant animals. The number of NMJ branches (WT = 4.92±0.65 branches, n = 12; wnt2O = 7.40±0.82 branches, n = 10, p = 0.03; wnt2O/Df(2R)BSC29 = 7.75±0.53 branches, n = 8, p = 0.006; wnt2I = 7.83±1.01 branches, n = 6, p = 0.01), density of Brp clusters (WT = 0.51±0.02 puncta/µm2, n = 9; wnt2O = 0.42±0.03 puncta/µm2, n = 8, p = 0.03; wnt2O/Df(2R)BSC29 = 0.38±0.03 puncta/µm2, n = 8, p = 0.01; wnt2I = 0.39±0.03 puncta/µm2, n = 6, p = 0.02), and size of the presynaptic motor neuron (WT = 348.4±58.89 µm2, n = 7; wnt2O = 501.8±37.78 µm2, n = 6, p = 0.04; wnt2O/Df(2R)BSC29 = 520.1 0±40.25 µm2, n = 8, p = 0.03; wnt2I = 539.0±45.19 µm2, n = 6, p = 0.03) exhibited phenotypes similar to the homozygous wnt2O mutant. These data confirm that wnt2 is involved in negatively regulating growth of the presynaptic motor neuron and promotes the synaptic localization of Brp.

To determine whether the reduction in the density of Brp affected synaptic function in wnt2 mutant animals, we recorded ionic currents from postsynaptic muscle. Muscle 6 was voltage clamped at −60 mV and the presynaptic segmental nerve was stimulated (1 Hz, 5 V) to induce synaptic activity. The amplitude of evoked excitatory junctional currents (EJCs) was reduced approximately 50% in wnt2 mutant animals (Fig. 1D, WT = 207.2±18.51 nA, n = 8; wnt2O = 105.3±26.76 nA, n = 7, p = 0.007). Interestingly, neither the frequency nor amplitude of spontaneous miniature excitatory junctional currents (mEJCs) was significantly different than controls (mEJC frequency: WT = 2.10±0.28 Hz, n = 10; wnt2O = 1.82±0.39 Hz, n = 8, p = 0.56; mEJC amplitude: WT = 0.94±0.09 nA, n = 10; wnt2O = 0.84±0.07 nA, n = 8, p = 0.39). These data, coupled with the altered NMJ morphology, indicates that wnt2 directly or indirectly regulates both synaptic structure and function.

Mutations in wnt2 Preferentially Affect Presynaptic Proteins

Our electrophysiological results suggest that spontaneous activity is unaffected in wnt2 mutants. When presented with an evoked stimulus, however, wnt2 mutants exhibit a large reduction in evoked amplitudes. Evoked release requires the binding of Ca2+ to the presynaptic protein synaptotagmin I (Syt) (for reviews see [48], [49]). Therefore, we examined the immunolabeling of Syt and found there was no difference in Syt levels in wnt2 mutants (Fig. 2A; WT = 1.00±0.09 arbitrary units (a.u.), n = 7; wnt2O = 0.96±0.07 a.u., n = 8, p = 0.75). Similarly, there was no difference in the synaptic vesicle protein, cysteine string protein (CSP, [50]; data not shown, WT = 1.00±0.09 a.u., n = 8; wnt2O = 0.86±0.12 a.u., n = 7, p = 0.36). There was, however, a significant difference in immunolabeling for the presynaptic protein Synaptobrevin (Fig. 2B; Syb: WT = 1.00±0.04 a.u., n = 10; wnt2O = 0.69±0.05 a.u., n = 7, p = 0.0002), which mediates vesicle fusion [51].

Figure 2. Mutations in wnt2 Affect Other Presynaptic Proteins.

Figure 2

A–B: Confocal images of third instar 6/7 NMJs immunolabeled with α-synaptotagmin (Syt, A) and α-synaptobrevin (Syb, B)with quantification of fluorescence (right histograms). Scale bar  = 20 µm. C: Relative Brp mRNA levels in 1st instar (left), 2nd instar (middle), and 3rd instar (right) larvae, measured by quantitative RT-PCR.

We also quantified immunoreactivity for the postsynaptic proteins discs large (DLG) and glutamate receptor subunit IIA (GluRIIA). There was no difference in immunoreactivity of either DLG or GluRIIA (; DLG: WT = 1.00±0.06 a.u., n = 8; wnt2O = 0.95±0.08 a.u., n = 7, p = 0.63; GluRIIA: WT = 1.00±0.09 a.u., n = 10; wnt2O = 1.02±0.10 a.u., n = 9, p = 0.87). Further, there was no detectable immunocytochemical difference in the levels of the cell adhesion molecule FasII and the cytoskeletal component acetylated tubulin (FasII: WT = 1.00±0.05 a.u., n = 8; wnt2O = 0.96±0.10 a.u., n = 8, p = 0.71; synaptic acetylated tubulin, Fig. S1: WT = 1.00±0.07 a.u., n = 12; wnt2O = 0.89±0.08 a.u., n = 11, p = 0.31; muscle 6 acetylated tubulin: WT = 1.00±0.10 a.u., n = 12; wnt2O = 0.99±0.06 a.u., n = 11, p = 0.93). Taken together, our electrophysiological and immunocytochemical results suggest that wnt2 is involved in the expression or localization of presynaptic proteins.

The Loss of Brp and Syb is not Due to Transcriptional Mechanisms

The binding of Wnt ligands to their receptors can activate downstream pathways that lead to transcription by the TCF/LEF family of transcription factors [52]. To determine if reduced Brp density and loss of Syb in wnt2 mutants was due to changes in gene transcription, we examined brp and syb mRNA levels in 1st, 2nd, and 3rd instar larvae using quantitative RT-PCR. Surprisingly, there was a significant increase in brp mRNA in 1st instar larvae (Fig. 2C; WT = 1.00±0.09 a.u., n = 6; wnt2O = 1.43±0.07 a.u., n = 6, p = 0.003) consistent with the slight increase in Brp density in 1st instar larvae (see Fig. 3). However, there was no significant difference in brp mRNA levels in either 2nd or 3rd instar larvae (Fig. 2D; WT 2nd instar = 1.00±0.04 a.u., n = 6; wnt2O 2nd instar = 0.88±0.08 a.u., n = 5, p = 0.20; WT 3rd instar = 1.00±0.17 a.u., n = 6; wnt2O 3rd instar = 1.06±0.15 a.u., n = 6, p = 0.81). Nor was there any significant difference in syb mRNA levels between controls and wnt2 mutants at any developmental stage examined (WT 1st instar = 1.00±0.05 a.u., n = 6; wnt2O 1st instar = 0.94±0.07 a.u., n = 6, p = 0.50; WT 2nd instar = 1.00±0.10 a.u., n = 6; wnt2O 2nd instar = 0.98±0.12 a.u., n = 5, p = 0.88; WT 3rd instar = 1.00±0.27 a.u., n = 6; wnt2O 3rd instar = 1.43±0.39 a.u., n = 6, p = 0.39). These data indicate that reduced density of Brp and loss of Syb at the NMJ of wnt2 mutants is not due to changes in brp and syb transcript levels.

Figure 3. The Morphological Change in wnt2 Mutants Occurs Early in Development.

Figure 3

A: Schematic of the 6/7 and neighboring NMJs in pre-3rd instar larvae. B: Confocal fluorescent images showing 1st instar larval NMJs of WT and wnt2O mutants labeled with antibodies against HRP (magenta) and Brp (green). Scale bar  = 5 µm. C: Quantification of the number of branches per NMJ (left) and Brp density (right) in 1st instar larvae.D: Quantification of the number of branches per NMJ (left) and Brp density (right) in 2nd instar larvae. E: Confocal fluorescent images showing 2nd instar larval NMJs labeled with antibodies against HRP (magenta) and nc82 (green). Scale bar: 5 µm.

The Morphological Change in wnt2 Mutants Occurs Early in Development

Growth of the NMJ during larval development (24–120 h AEL) involves the addition of new synaptic boutons, branches, and AZs per bouton [53][55]. The dramatic increase in presynaptic growth attempts to accommodate the rapidly growing larval muscles and requires transsynaptic signaling between cells (for review see [53]). To ascertain whether the increase in branch number and reduction in AZs resulted from a failure to coordinate growth of the presynaptic motor neuron and postsynaptic muscle, we examined wnt2 mutant NMJs during both 1st and 2nd instar larval stages (24 and 48 h AEL, respectively). Figure 3 (A) depicts NMJs on the ventral longitudinal body wall muscles of a single 1st instar hemisegment. The segmental nerve innervates muscles 15, 16, 17, 7, 6, 13, and 12 while the intersegmental nerve innervates muscle 7, 6, 13, and 12. Comparison of wnt2 mutants to this highly stereotyped pattern revealed a significant increase in branch numbers at the 6/7 NMJ during both the 1st and 2nd instar larval stages (Fig. 3B-E, 1st instar: WT = 0.13±0.13 branches, n = 8; wnt2O = 1.38±0.26 branches, n = 8, p = 0.0007; 2nd instar: WT = 0.75±0.25 branches, n = 8; wnt2O = 2.56±0.38 branches, n = 9, p = 0.0015) with no change in bouton numbers (Fig. 3B-E, 1st instar: WT = 11.13±1.09 branches, n = 8; wnt2O = 12.63±0.80 boutons, n = 8, p = 0.29; 2nd instar: WT = 19.44±0.91 boutons, n = 9; wnt2O = 17.11±1.00 boutons, n = 9, p = 0.11). This is similar to the phenotype observed in 3rd instar mutant animals. Interestingly, in contrast to the reduction in Brp density observed during the 3rd instar larval stage, there was no difference in the density of Brp puncta during the 1st and 2nd instar larval stages (1st instar: WT = 0.65±0.05 puncta/µm2, n = 8; wnt2O = 0.81±0.061 puncta/µm2, n = 8, p = 0.08; 2nd instar: WT = 0.56±0.07 puncta/µm2, n = 7; wnt2O = 0.66±0.06 puncta/µm2, n = 9, p = 0.40). These data indicate that the loss of wnt2 affects the growth of the NMJ early in development but does not affect the density of Brp until later in development. This suggests that different mechanisms may govern NMJ structure and function in the wnt2 mutant.

wnt2 May Function in Postsynaptic Muscle to Mediate Brp Density and Structure of the Presynaptic Neuron

Our attempts to make an antibody that specifically recognized the Wnt2 protein were unsuccessful. Thus, we used genetic techniques to delineate the cell type expressing the wnt2 gene. First, we performed cell-type specific gene rescue experiments by expressing the UAS-wnt2 transgene specifically in neurons (using the elav-Gal4 driver), muscle (using the 24B-Gal4 driver), or glial cells (using the repo-Gal4 driver) in the wnt2O mutant background. Expression of wnt2 in muscle rescued the number of branches to near control levels. Conversely, expression of wnt2 in neurons of wnt2O mutants produced a further increase in branch number while expression in glia significantly reduced branch numbers (Fig. 4 A–B; control = 5.88±0.46 branches, n = 16; elav>wnt2 = 8.67±1.11 branches, n = 9, p = 0.01; 24B>wnt2 = 6.25±0.86 branches, n = 12, p = 0.69; repo>wnt2 = 4.30±0.67 branches, n = 10, p = 0.047). Expression of wnt2 in all three cell types rescued Brp density (control = 0.51±0.02 puncta/µm2, n = 9; elav>wnt2 = 0.53±0.03 puncta/µm2, n = 9, p = 0.52; 24B>wnt2 = 0.49±0.04 puncta/µm2, n = 10, p = 0.82; repo>wnt2 = 0.48±0.04 puncta/µm2, n = 8, p = 0.61) suggesting expression of wnt2 in any NMJ cell type is sufficient to rescue the localization of Brp.

Figure 4. Restoration of wnt2 in Postsynaptic Muscle Rescues Presynaptic Morphology and Brp density.

Figure 4

A: wnt2 expression was restored in the wnt2O mutant background using a UAS-wnt2 transgene driven in either neurons (elav), muscle (24B) or glial cells (repo). Representative confocal micrographs show the 6/7 NMJ immunolabeled with HRP (magenta) to visualize neuronal membranes and Brp (green). Scale bar  = 20 µm. B: Quantification of the number of branches per 6/7 NMJ. C: Quantification of Brp density.

Since Wnt2 is a secreted protein, genetic rescue could have occurred by expression from extraneous cell types. To verify and further clarify the above results, we knocked down wnt2 function in neurons or muscle. Expression of a UAS-wnt2RNAi construct within neurons (using the Dcr2;;elav driver) produced no change in either the number of branches or Brp density compared with controls (Fig. 5; branches: UAS-wnt2RNAi/+ = 7.43±1.69, n = 7; Dcr2;;elav = 8.50±0.89, n = 6; Dcr2;;elav >UAS-wnt2RNAi = 7.86±0.86, n = 7, p = 0.61: Brp density: UAS-wnt2RNAi/+ = 0.63±0.04, n = 7; Dcr2;;elav = 0.58±0.03, n = 6; Dcr2;;elav>UAS-wnt2RNAi = 0.58±0.03, n = 6, p = 0.89). Knockdown of wnt2 in postsynaptic muscle, however, produced a Brp phenotype similar to that of the wnt2O mutant (Fig. 5; branches: UAS-wnt2RNAi/+ = 7.43±1.69, n = 7;; Dcr2;;24B = 6.83±1.05 n = 6; Dcr2;;24B>UAS-wnt2RNAi = 8.00±0.82, n = 7, p = 0.39: Brp density: UAS-wnt2RNAi/+  = 0.63±0.04, n = 7; Dcr2;;24B = 0.56±0.05, n = 6; 24B>UAS-wnt2RNAi = 0.39±0.05, n = 7, p = 0.04). To verify the RNAi transgenes reduced the expression of wnt2 and did not affect the levels of brp transcript, we performed qRT-PCR for wnt2 and brp (wnt2: control = 1.00±0.04 a.u., n = 6; Dcr2;;elav>UAS-wnt2RNAi = 0.79±0.01 a.u., n = 6, p = 0.003; Dcr2;;24B>UAS-wnt2RNAi = 0.76±0.01 a.u., n = 6, p<0.0001; brp: control = 1.00±0.04 a.u., n = 6; Dcr2;;24B>UAS-wnt2RNAi = 0.9914±0.027 a.u., n = 6, p = 0.73). Our rescue and RNAi data collectively indicate that wnt2 functions in the postsynaptic muscle to regulate the density of Brp.

Figure 5. Knockdown of wnt2 in Postsynaptic Muscle Mimics the wnt2 Mutant Phenotype.

Figure 5

A: wnt2 function was reduced using a UAS-wnt2RNAi transgene driven in either motor neurons (Dcr2;;elav) or muscle cells (Dcr2;;24B). Representative confocal micrographs show the 6/7 NMJ immunolabeled with HRP (magenta) to visualize neuronal membranes and Brp (green). Scale bar  = 20 µm. B: Quantification of the number of branches per 6/7 NMJ. C: Quantification of Brp density.

Wnt2 does not Likely Exert its Presynaptic Effects via Drl or Fz Receptors

Previous experiments have demonstrated that Wingless utilizes postsynaptic DFz2 receptors to influence Drosophila NMJ morphology [26], [56], [57]. We sought to determine the receptor through which Wnt2 mediated its synaptic effects by examining mutant NMJs of fz and drl mutants (Figure 6). Previous data indicates Wnt2 binds to Fz, Fz2, and Fz3 with similar affinities [58]. If Wnt2 signals via a single receptor or a combination of receptors, then mutants for those receptors should phenocopy wnt2 mutants. fz3G10 null mutant animals [59] most closely resembled the wnt2O NMJ phenotype in terms of morphology (Fig. 6; WT = 4.92±0.66 branches, n = 12; wnt2O = 7.40±0.82 branches, n = 10, p = 0.025; drl2 = 4.17±0.84 branches, n = 12, p = 0.49; fzD21 = 4.33±0.44, n = 9, p = 0.50; fz2C1 = 6.29±0.57, n = 7, p = 0.17; fz3G10 = 7.67±0.41, n = 9, p = 0.004). None of the mutants examined exhibited a significant change in Brp density (Fig. 6; WT = 0.51±0.02 puncta/µm2, n = 9; wnt2O = 0.42±0.03 puncta/µm2, n = 8, p = 0.03; drl2 = 0.47±0.03 puncta/µm2, n = 8, p = 0.46; fzP21 = 0.48±0.02 puncta/µm2, n = 8, p = 0.53; fz2C1 = 0.53±0.03, n = 7 puncta/µm2, p = 0.59; fz3G10 = 0.49±0.03 puncta/µm2, n = 9, p = 0.72).

Figure 6. The Effects of Wnt2 are not likely mediated by Drl or Fz Receptors.

Figure 6

Top panels: Representative confocal micrographs show the 6/7 NMJ immunolabeled with HRP (magenta) to visualize neuronal membranes and Brp (green). Scale bar  = 20 µm. Bottom left: Quantification of the number of branches per 6/7 NMJ. Bottom right: Quantification of Brp density.

The increase in NMJ branch numbers in both wnt2 and fz3 mutants raised the possibility that the two genes may function in the same signaling pathway to regulate synaptic growth. To test this possibility, we constructed double mutants bearing simultaneous wnt2 and fz3 mutations. The NMJ morphology of wnt2O; fz3G10 double mutants was statistically different than WT and of each of the single mutants (Fig. 6, wnt2O = 7.40±0.82 branches, n = 10; fz3G10 = 7.67±0.41, n = 9, p = 0.004; wnt2O; fz3G10 = 9.36±0.59, n = 11, p = 0.04) suggesting that wnt2 and fz3 may each regulate synaptic growth independently of the other. Collectively, our data suggest that Wnt2 is expressed by the postsynaptic muscle and is involved in presynaptic protein localization.

Discussion

Synapse development is a complex process that requires pre- and postsynaptic cells to maintain constant communication with one another via transsynaptic signaling. Molecules with well established roles in this process include cell adhesion molecules [60], Ephrin ligands and Eph receptors [61], and the classical cadherins [62]. We provide evidence that Wnt2 may act as a signaling molecule that is expressed by the postsynaptic muscle where it acts on the presynaptic cell to directly or indirectly regulate size of the presynaptic motor neuron and promote protein localization.

Wnt2 Regulates NMJ Development and Localization of Presynaptic Proteins

We present several pieces of evidence to support our conclusion that Wnt2 regulates development of the NMJ. wnt2 mutations produce overgrown NMJs with an increased number of branches (Fig. 1). The significant increase in NMJ branches is present early in development as both 1st and 2nd instar mutant larvae also exhibit an overgrowth (Fig. 3). This could indicate that wnt2 is required shortly after synapse formation to regulate NMJ growth. Although the NMJ is enlarged in the wnt2 mutant, the number of Brp puncta remained similar to controls. The level of Brp immunfluorescence is reduced, however, suggesting that the amount of Brp protein per punctum is decreased. Since Brp is localized to active zones where it promotes Ca2+ channel clustering [63], reduced staining of Brp puncta may indicate that functioning of the active zones are compromised. A recent paper however, reported that the majority of active zones in Drosophila rab3 mutants do not contain Brp [64].

Electrophysiological recordings from muscle 6 of wnt2 mutants showed that the amplitudes of evoked events were significantly reduced without a reduction in the frequency or amplitude of spontaneous events (Fig. 1). This intriguing finding led us to carefully examine the concentrations of presynaptic proteins including Syt, Syb, CSP, Brp. The levels of Syb and Brp were significantly reduced in the wnt2 mutant as indicated by immunocytochemistry (Fig. 2). Syb is a synaptic vesicle associated protein that assembles with syntaxin and SNAP-25 to form the SNARE complex, which renders vesicles competent for fusion (for reviews see [65], [66]). The electrophysiological phenotype we observed in wnt2 mutants is consistent with both the syb and brp mutant phenotypes. Syb is required for evoked but not spontaneous transmission in Drosophila [67] and knockdown of brp in neurons reduces evoked responses while preserving spontaneous transmission [10]. Thus, our finding that the total number of Brp puncta in wnt2 mutants is unchanged coupled with the significant reduction in evoked responses, suggests that there may be a reduction in the number of functional active zones in the wnt2 mutant. Indeed, we observed that the immunolabeling of Brp puncta is reduced, suggesting that the amount of Brp protein per puncta is decreased.[51]

The reduced labeling of Brp and Syb in the presynaptic motor neuron of wnt2 mutants is not likely due to changes in transcriptional mechanisms. Messenger RNA levels of both brp and syb are similar in mutant and control animals (Fig. 2). It is possible that the observed changes in Brp and Syb are due to mislocalization of mRNA. Another possibility is that the loss of wnt2 leads to mislocalization of presynaptic proteins. Rat Wnt7a, which is 77.1% similar in amino acid sequence to Wnt7b [68], when applied to hippocampal cultures, induces clustering of Syt, SV2, and increases the number of clusters containing synaptophysin [23]. Both Wnt7a and Wnt7b induce clustering of synapsin I in mouse cerebellar granule cell cultures. Treatment of culture medium with Wnt7b increased Bassoon clustering but did not increase total protein levels as indicated by Western Blots [69].

Wnt2 is Expressed by Postsynaptic Muscle

Wnts are secreted glycoproteins. An important aspect of understanding the function of Wnt2 is to determine where at the synapse it functions to regulate presynaptic motor neuron morphology and localization of proteins. Our cell-type specific cDNA expression in wnt2 mutants showed that Wnt2 may function in either presynaptic motor neurons or postsynaptic muscle. Expression in either motor neurons or muscle restored presynaptic Brp density. Expression in postsynaptic muscle also restored NMJ morphology while expression in presynaptic motor neurons caused a further increase in the number of NMJ branches (Fig. 4). Knockdown of wnt2 in muscle produced a phenotype similar to that of null mutant (Fig. 5). Our results collectively suggest that Wnt2 may be expressed by the postsynaptic muscle where it acts as a retrograde signal that negatively regulates NMJ growth and promotes the localization of presynaptic proteins. Based on our data, we cannot conclude whether wnt2 directly or indirectly regulates these synaptic characteristics.

A number of other molecules have been implicated in retrograde synaptic signaling including Ankyrin [70], nitric oxide [71], SAP97 [72], Synaptotagmin 4 [73], and secreted proteins such as Glass Bottom Boat [74], fibroblast growth factors [75], and Wnts [69], [76][78]. Mouse Wnt3 is secreted from motor neurons where it increases the size of growth cones and branching of incoming sensory neurons [24]. Similarly, mouse Wnt7a is expressed by cerebellar granule cells and acts on presynaptic mossy fibers to remodel axons and growth cones [22]. The receptor(s) that mediate the above effects are, as yet, unidentified but Wnt ligand binding to its receptor induces cytoskeletal changes [79], [80].

We sought to determine the receptor through which Wnt2 signaled by examining mutants for drl, fz, fz2, and fz3. None of the mutants exhibited a reduction in the density of Brp. Mutations in fz3, however, led to a significant increase in NMJ branches similar to that of the wnt2 mutant. This raised the possibility that Wnt2 was signaling via Fz3 to negatively regulate NMJ growth. wnt2O; fz3G10 double mutants, however, exhibited a significant increase in NMJ branches greater than that of the single mutants (Fig. 6) suggesting wnt2 and fz3 act independently of one another to regulate synaptic growth. Wnt2 may signal via the Wnt receptors Fz4 or Smo but binding assays indicate there is no detectible binding between Wnt2 and these receptors [58]. It is also possible that we did not detect a phenotype in Frizzled mutants due to functional redundancy of these receptors. Future work will be required to uncover the receptor that mediates Wnt2 signaling.

Materials and Methods

Fly Stocks

All animals were raised at 25°C in standard fly vials with corn meal molasses medium. Wnt2 fly stocks along with the all Gal4 lines were obtained from Bloomington Drosophila Stock Center. fzD21, fz2C1, fz3G10, and drl2 fly stocks were generous gifts from the labs of Roel Nusse, Gary Struhl, Kaoru Saigo, and John Thomas, respectively. The UAS-wnt2RNAi line was provided by the Vienna Drosophila RNAi Center (v38079).

Antibodies and Immunocytochemistry

For staining and microscopy, animals were dissected and fixed for 30–60 min in either Bouin's fixative (when GluRIIA or nc82 antibodies were used), or 4% paraformaldehyde (for all other immunolabeling). First and second instar larvae were dissected and fillet preparations were glued down using Sylgard-coated coverslips. Third instar larvae were dissected and fillet preparations were pinned down in Sylgard lined Petri dishes. All dissections were done in Drosophila standard saline (135 mM NaCl, 5 mM KCl, 4 mM MgCl, 1.8 mM CaCl, 5 mM TES, 72 mM sucrose) with 2 mM glutamate to preserve neuronal morphology [81] at RT.

The following mouse monoclonal antibodies from the Iowa Developmental Hybridoma Bank (Iowa City, IA) were used: anti-Brp (nc82, 1∶50), anti-DLG (1∶1000), anti-GluRIIA (1∶100), anti-FasII (1∶200), anti-CSP (1∶200), and anti-Syt (1∶200). Rabbit polyclonal anti-Syb (1∶1000) was a gift from Hugo Bellen. Mouse monoclonal anti-acetylated tubulin (Sigma) was used at 1∶1000. F-actin was labeled using rhodamine-conjugated phallotoxin at 1∶200 (Invitrogen, Carlsbad, CA). Fluorescently conjugated anti-HRP (Jackson Immunoresearch Labs, West Grove, PA) was used at 1∶100. Goat anti-rabbit or goat anti-mouse fluorescent (FITC or TRITC) secondary antibodies (Jackson Immunoresearch Labs, West Grove, PA) were used at 1∶400. The 6/7 NMJ of abdominal hemisegments A3 or A4 were used for all studies. Confocal images were obtained using a Zeiss LSM 510 laser-scanning confocal microscope. Figure 5 and Figure S1 images were obtained using an Olympus FV1000 laser-scanning confocal microscope. Image analysis and quantification was performed using ImageJ and Adobe Photoshop software.

Electrophysiology

All electrophysiology was performed on ventral body wall muscle 6. Larval recordings were performed on third instar larvae 110–120 hr AEL. Muscle 6 was voltage-clamped at −60 mV. Standard two-electrode voltage clamp techniques were used, as previously described [82]. Data were acquired and analyzed using an Axopatch amplifier and pClamp9 (Axon Instruments, Union City, CA). All dissections and recordings were done in standard Drosophila saline at 19C.

qRT-PCR

wnt2O and control animals were homogenized and RNA was extracted using TRIreagent (Sigma, St. Loius, MO). RNA was obtained from 1st instar (24–26 h after egg laying (AEL)), 2nd instar (48–50 h AEL), and 3rd instar larvae (110–120 h AEL). Reverse transcription of RNA was performed using Qiagen's Quantifast Sybr Green RT-PCR kit (Valencia, CA) with mRNA specific primers for actin (forward primer: GCACCACACCTTCTACAATGAGC, reverse primer: TACAGCGAGAGCACAGCCTGGATG), Brp (forward primer: GCAAGAGGATTAAACGAACGAG, reverse primer: TAGCGGGTTCTTGGATAGTC), Syb (forward primer: GCACATTGTCAAGCAAATTCAC, reverse primer: TGTTGTTCCTGATTTGATGGTC), and Wnt2 (forward primer: ATTGTGGAACTGTGGAACTG, reverse primer: GCTGGACACTAATCTTATTTCC). Primers were designed against exon-intron borders and no primer sets yielded products when DNA was used as a template. qRT-PCR reactions were run using a Stratagene MX3000P. To obtain ΔC(t) values, the cycle threshold (C(t)) for Brp, Syb, and Wnt2 along with an actin control were measured for each sample. The difference between the mRNA-specific primer and the actin C(t) were calculated to determine the ΔC(t) value. ΔC(t) values were normalized to WT by dividing each ΔC(t) value by the mean ΔC(t) value for WT to yield the mRNA levels relative to WT. There was no significant differences in the actin C(t) values between WT and wnt2 mutants. For the qRT-PCR experiments examining wnt2 expression in nervous system and ventral body wall muscles, nervous systems and ventral body wall muscles were extracted from third instar larvae. The brain, ventral nerve cord, and intersegmental nerves were first extracted followed by the ventral body wall muscles. To minimize contamination of other tissue types in the ventral body wall muscles, only ventral body wall muscles between A3-A5 were used for RNA extraction.

Data Acquisition and Statistics

The total number of boutons and branches were acquired from 6/7 NMJs of hemisegments A3 or A4 of all animals. Branches were defined as an extension of the presynaptic motor neuron that included more than one bouton. The density of Brp labeling was quantified by counting the total number of Brp puncta in a projected Z-image and dividing by the total NMJ area as indicated by Brp labeling using ImageJ (NIH) software. We quantified immunoreactivity for all other synaptic proteins by measuring the mean fluorescence intensity of the NMJ using Adobe Photoshop software and subtracting the mean non-NMJ background over an identical area of the neighboring muscle membrane. For DLG and muscle acetylated tubulin, the average background from a non-synaptic, non-muscle area was used.

Statistics were performed using GraphPad Prism (v. 4.01., 5.01). All statistical comparisons were made using unpaired students t-tests. Unless otherwise noted, control animals used were WT-Berlin, elav-Gal4,24B-Gal4, wnt2O;elav/+, wnt2O;24B/+, and wnt2O; UAS-wnt2. There was no significant difference in bouton or branch numbers or Brp puncta density between genotypes. Therefore, the data were combined into one control group where appropriate. Statistical significance in figures is represented as follows: * = p<0.05, ** = p<0.01, and *** = p<0.001. All error bars represent S.E.M.

Supporting Information

Figure S1

Muscle size in wnt2 mutants is similar to that of controls. A: Representative confocal micrographs show the 6/7 NMJ labeled with HRP (green) to visualize neuronal membranes and phallotoxin to label F-actin (magenta). Scale bar  = 20 µm. B: Quantification of muscle sizes in controls and wnt2 mutants. C: Representative confocal micrographs show the 6/7 NMJ immunolabeled with HRP (magenta) and acetylated tubulin (green). Scale bar  = 20 µm.

(0.72 MB TIF)

Acknowledgments

We thank Dave Featherstone for his helpful comments of the manuscript, the Iowa Developmental Hybridoma Bank for antibodies, and the Bloomington Stock Center for fly stocks.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: NIH NRSA (NIH/NIDCD, 1 F32 DC08443-01 to F.L.), http://grants.nih.gov/training/nrsa.htm; NIH Academic Research Enhancement Award (1R15NS063315-01 to F.L.), http://grants.nih.gov/grants/funding/area.htm; NIH/NIDCD (DC5408-01 to H.H.), http://www.nidcd.nih.gov/funding/foa/; Roy J. Carver Charitable Trust (#03-27 to H.H.), https://www.carvertrust.org/. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Schoch S, Gundelfinger ED. Molecular organization of the presynaptic active zone. Cell Tissue Res. 2006;326:379–391. doi: 10.1007/s00441-006-0244-y. [DOI] [PubMed] [Google Scholar]
  • 2.Zhai RG, Bellen HJ. The architecture of the active zone in the presynaptic nerve terminal. Physiology (Bethesda) 2004;19:262–270. doi: 10.1152/physiol.00014.2004. [DOI] [PubMed] [Google Scholar]
  • 3.Stanley EF. The calcium channel and the organization of the presynaptic transmitter release face. Trends Neurosci. 1997;20:404–409. doi: 10.1016/s0166-2236(97)01091-6. [DOI] [PubMed] [Google Scholar]
  • 4.Brunger AT. Structure and function of SNARE and SNARE-interacting proteins. Q Rev Biophys. 2005;38:1–47. doi: 10.1017/S0033583505004051. [DOI] [PubMed] [Google Scholar]
  • 5.Kidokoro Y. Roles of SNARE proteins and synaptotagmin I in synaptic transmission: studies at the Drosophila neuromuscular synapse. Neurosignals. 2003;12:13–30. doi: 10.1159/000068912. [DOI] [PubMed] [Google Scholar]
  • 6.tom Dieck S, Sanmarti-Vila L, Langnaese K, Richter K, Kindler S, et al. Bassoon, a novel zinc-finger CAG/glutamine-repeat protein selectively localized at the active zone of presynaptic nerve terminals. J Cell Biol. 1998;142:499–509. doi: 10.1083/jcb.142.2.499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Fenster SD, Chung WJ, Zhai R, Cases-Langhoff C, Voss B, et al. Piccolo, a presynaptic zinc finger protein structurally related to bassoon. Neuron. 2000;25:203–214. doi: 10.1016/s0896-6273(00)80883-1. [DOI] [PubMed] [Google Scholar]
  • 8.Deguchi-Tawarada M, Inoue E, Takao-Rikitsu E, Inoue M, Ohtsuka T, et al. CAST2: identification and characterization of a protein structurally related to the presynaptic cytomatrix protein CAST. Genes Cells. 2004;9:15–23. doi: 10.1111/j.1356-9597.2004.00697.x. [DOI] [PubMed] [Google Scholar]
  • 9.Ohtsuka T, Takao-Rikitsu E, Inoue E, Inoue M, Takeuchi M, et al. Cast: a novel protein of the cytomatrix at the active zone of synapses that forms a ternary complex with RIM1 and munc13-1. J Cell Biol. 2002;158:577–590. doi: 10.1083/jcb.200202083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wagh DA, Rasse TM, Asan E, Hofbauer A, Schwenkert I, et al. Bruchpilot, a protein with homology to ELKS/CAST, is required for structural integrity and function of synaptic active zones in Drosophila. Neuron. 2006;49:833–844. doi: 10.1016/j.neuron.2006.02.008. [DOI] [PubMed] [Google Scholar]
  • 11.Shapiro L, Colman DR. The diversity of cadherins and implications for a synaptic adhesive code in the CNS. Neuron. 1999;23:427–430. doi: 10.1016/s0896-6273(00)80796-5. [DOI] [PubMed] [Google Scholar]
  • 12.Han K, Kim E. Synaptic adhesion molecules and PSD-95. Prog Neurobiol. 2008;84:263–283. doi: 10.1016/j.pneurobio.2007.10.011. [DOI] [PubMed] [Google Scholar]
  • 13.Davis GW, Schuster CM, Goodman CS. Genetic analysis of the mechanisms controlling target selection: target-derived Fasciclin II regulates the pattern of synapse formation. Neuron. 1997;19:561–573. doi: 10.1016/s0896-6273(00)80372-4. [DOI] [PubMed] [Google Scholar]
  • 14.Ahmari SE, Buchanan J, Smith SJ. Assembly of presynaptic active zones from cytoplasmic transport packets. Nat Neurosci. 2000;3:445–451. doi: 10.1038/74814. [DOI] [PubMed] [Google Scholar]
  • 15.Friedman HV, Bresler T, Garner CC, Ziv NE. Assembly of new individual excitatory synapses: time course and temporal order of synaptic molecule recruitment. Neuron. 2000;27:57–69. doi: 10.1016/s0896-6273(00)00009-x. [DOI] [PubMed] [Google Scholar]
  • 16.Shapira M, Zhai RG, Dresbach T, Bresler T, Torres VI, et al. Unitary assembly of presynaptic active zones from Piccolo-Bassoon transport vesicles. Neuron. 2003;38:237–252. doi: 10.1016/s0896-6273(03)00207-1. [DOI] [PubMed] [Google Scholar]
  • 17.Ille F, Sommer L. Wnt signaling: multiple functions in neural development. Cell Mol Life Sci. 2005;62:1100–1108. doi: 10.1007/s00018-005-4552-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Logan CY, Nusse R. The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 2004;20:781–810. doi: 10.1146/annurev.cellbio.20.010403.113126. [DOI] [PubMed] [Google Scholar]
  • 19.Zou Y. Wnt signaling in axon guidance. Trends Neurosci. 2004;27:528–532. doi: 10.1016/j.tins.2004.06.015. [DOI] [PubMed] [Google Scholar]
  • 20.Korkut C, Budnik V. WNTs tune up the neuromuscular junction. Nat Rev Neurosci. 2009;10:627–634. doi: 10.1038/nrn2681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Salinas PC, Zou Y. Wnt signaling in neural circuit assembly. Annu Rev Neurosci. 2008;31:339–358. doi: 10.1146/annurev.neuro.31.060407.125649. [DOI] [PubMed] [Google Scholar]
  • 22.Hall AC, Lucas FR, Salinas PC. Axonal remodeling and synaptic differentiation in the cerebellum is regulated by WNT-7a signaling. Cell. 2000;100:525–535. doi: 10.1016/s0092-8674(00)80689-3. [DOI] [PubMed] [Google Scholar]
  • 23.Cerpa W, Godoy JA, Alfaro I, Farias GG, Metcalfe MJ, et al. Wnt-7a modulates the synaptic vesicle cycle and synaptic transmission in hippocampal neurons. J Biol Chem. 2008;283:5918–5927. doi: 10.1074/jbc.M705943200. [DOI] [PubMed] [Google Scholar]
  • 24.Krylova O, Herreros J, Cleverley KE, Ehler E, Henriquez JP, et al. WNT-3, expressed by motoneurons, regulates terminal arborization of neurotrophin-3-responsive spinal sensory neurons. Neuron. 2002;35:1043–1056. doi: 10.1016/s0896-6273(02)00860-7. [DOI] [PubMed] [Google Scholar]
  • 25.Davis EK, Zou Y, Ghosh A. Wnts acting through canonical and noncanonical signaling pathways exert opposite effects on hippocampal synapse formation. Neural Dev. 2008;3:32. doi: 10.1186/1749-8104-3-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Mathew D, Ataman B, Chen J, Zhang Y, Cumberledge S, et al. Wingless signaling at synapses is through cleavage and nuclear import of receptor DFrizzled2. Science. 2005;310:1344–1347. doi: 10.1126/science.1117051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Miech C, Pauer HU, He X, Schwarz TL. Presynaptic local signaling by a canonical wingless pathway regulates development of the Drosophila neuromuscular junction. J Neurosci. 2008;28:10875–10884. doi: 10.1523/JNEUROSCI.0164-08.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Packard M, Koo ES, Gorczyca M, Sharpe J, Cumberledge S, et al. The Drosophila Wnt, wingless, provides an essential signal for pre- and postsynaptic differentiation. Cell. 2002;111:319–330. doi: 10.1016/s0092-8674(02)01047-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Liebl FL, Wu Y, Featherstone DE, Noordermeer JN, Fradkin L, et al. Derailed regulates development of the Drosophila neuromuscular junction. Dev Neurobiol. 2008;68:152–165. doi: 10.1002/dneu.20562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Fradkin LG, van Schie M, Wouda RR, de Jong A, Kamphorst JT, et al. The Drosophila Wnt5 protein mediates selective axon fasciculation in the embryonic central nervous system. Dev Biol. 2004;272:362–375. doi: 10.1016/j.ydbio.2004.04.034. [DOI] [PubMed] [Google Scholar]
  • 31.Inoue T, Oz HS, Wiland D, Gharib S, Deshpande R, et al. C. elegans LIN-18 is a Ryk ortholog and functions in parallel to LIN-17/Frizzled in Wnt signaling. Cell. 2004;118:795–806. doi: 10.1016/j.cell.2004.09.001. [DOI] [PubMed] [Google Scholar]
  • 32.Lu W, Yamamoto V, Ortega B, Baltimore D. Mammalian Ryk is a Wnt coreceptor required for stimulation of neurite outgrowth. Cell. 2004;119:97–108. doi: 10.1016/j.cell.2004.09.019. [DOI] [PubMed] [Google Scholar]
  • 33.Schmitt AM, Shi J, Wolf AM, Lu CC, King LA, et al. Wnt-Ryk signalling mediates medial-lateral retinotectal topographic mapping. Nature. 2006;439:31–37. doi: 10.1038/nature04334. [DOI] [PubMed] [Google Scholar]
  • 34.Yoshikawa S, McKinnon RD, Kokel M, Thomas JB. Wnt-mediated axon guidance via the Drosophila Derailed receptor. Nature. 2003;422:583–588. doi: 10.1038/nature01522. [DOI] [PubMed] [Google Scholar]
  • 35.Minami Y, Oishi I, Endo M, Nishita M. Ror-family receptor tyrosine kinases in noncanonical Wnt signaling: Their implications in developmental morphogenesis and human diseases. Dev Dyn. 2009 doi: 10.1002/dvdy.21991. [DOI] [PubMed] [Google Scholar]
  • 36.Oishi I, Suzuki H, Onishi N, Takada R, Kani S, et al. The receptor tyrosine kinase Ror2 is involved in non-canonical Wnt5a/JNK signalling pathway. Genes Cells. 2003;8:645–654. doi: 10.1046/j.1365-2443.2003.00662.x. [DOI] [PubMed] [Google Scholar]
  • 37.Sakurai M, Aoki T, Yoshikawa S, Santschi LA, Saito H, et al. Differentially expressed Drl and Drl-2 play opposing roles in Wnt5 signaling during Drosophila olfactory system development. J Neurosci. 2009;29:4972–4980. doi: 10.1523/JNEUROSCI.2821-08.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Yao Y, Wu Y, Yin C, Ozawa R, Aigaki T, et al. Antagonistic roles of Wnt5 and the Drl receptor in patterning the Drosophila antennal lobe. Nat Neurosci. 2007;10:1423–1432. doi: 10.1038/nn1993. [DOI] [PubMed] [Google Scholar]
  • 39.Kawasaki A, Torii K, Yamashita Y, Nishizawa K, Kanekura K, et al. Wnt5a promotes adhesion of human dermal fibroblasts by triggering a phosphatidylinositol-3 kinase/Akt signal. Cell Signal. 2007;19:2498–2506. doi: 10.1016/j.cellsig.2007.07.023. [DOI] [PubMed] [Google Scholar]
  • 40.Weeraratna AT, Jiang Y, Hostetter G, Rosenblatt K, Duray P, et al. Wnt5a signaling directly affects cell motility and invasion of metastatic melanoma. Cancer Cell. 2002;1:279–288. doi: 10.1016/s1535-6108(02)00045-4. [DOI] [PubMed] [Google Scholar]
  • 41.Collins CA, DiAntonio A. Synaptic development: insights from Drosophila. Curr Opin Neurobiol. 2007;17:35–42. doi: 10.1016/j.conb.2007.01.001. [DOI] [PubMed] [Google Scholar]
  • 42.Gramates LS, Budnik V. Assembly and maturation of the Drosophila larval neuromuscular junction. Int Rev Neurobiol. 1999;43:93–117. doi: 10.1016/s0074-7742(08)60542-5. [DOI] [PubMed] [Google Scholar]
  • 43.Kozopas KM, Samos CH, Nusse R. DWnt-2, a Drosophila Wnt gene required for the development of the male reproductive tract, specifies a sexually dimorphic cell fate. Genes Dev. 1998;12:1155–1165. doi: 10.1101/gad.12.8.1155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kozopas KM, Nusse R. Direct flight muscles in Drosophila develop from cells with characteristics of founders and depend on DWnt-2 for their correct patterning. Dev Biol. 2002;243:312–325. doi: 10.1006/dbio.2002.0572. [DOI] [PubMed] [Google Scholar]
  • 45.Kittel RJ, Wichmann C, Rasse TM, Fouquet W, Schmidt M, et al. Bruchpilot promotes active zone assembly, Ca2+ channel clustering, and vesicle release. Science. 2006;312:1051–1054. doi: 10.1126/science.1126308. [DOI] [PubMed] [Google Scholar]
  • 46.Marrus SB, DiAntonio A. Preferential localization of glutamate receptors opposite sites of high presynaptic release. Curr Biol. 2004;14:924–931. doi: 10.1016/j.cub.2004.05.047. [DOI] [PubMed] [Google Scholar]
  • 47.Schmid A, Hallermann S, Kittel RJ, Khorramshahi O, Frolich AM, et al. Activity-dependent site-specific changes of glutamate receptor composition in vivo. Nat Neurosci. 2008;11:659–666. doi: 10.1038/nn.2122. [DOI] [PubMed] [Google Scholar]
  • 48.Sudhof TC. The synaptic vesicle cycle. Annu Rev Neurosci. 2004;27:509–547. doi: 10.1146/annurev.neuro.26.041002.131412. [DOI] [PubMed] [Google Scholar]
  • 49.Yoshihara M, Montana ES. The synaptotagmins: calcium sensors for vesicular trafficking. Neuroscientist. 2004;10:566–574. doi: 10.1177/1073858404268770. [DOI] [PubMed] [Google Scholar]
  • 50.Bronk P, Nie Z, Klose MK, Dawson-Scully K, Zhang J, et al. The multiple functions of cysteine-string protein analyzed at Drosophila nerve terminals. J Neurosci. 2005;25:2204–2214. doi: 10.1523/JNEUROSCI.3610-04.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Chang WP, Sudhof TC. SV2 renders primed synaptic vesicles competent for Ca2+ -induced exocytosis. J Neurosci. 2009;29:883–897. doi: 10.1523/JNEUROSCI.4521-08.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Clevers H. Wnt/beta-catenin signaling in development and disease. Cell. 2006;127:469–480. doi: 10.1016/j.cell.2006.10.018. [DOI] [PubMed] [Google Scholar]
  • 53.Schuster CM, Davis GW, Fetter RD, Goodman CS. Genetic dissection of structural and functional components of synaptic plasticity. II. Fasciclin II controls presynaptic structural plasticity. Neuron. 1996;17:655–667. doi: 10.1016/s0896-6273(00)80198-1. [DOI] [PubMed] [Google Scholar]
  • 54.Schuster CM, Davis GW, Fetter RD, Goodman CS. Genetic dissection of structural and functional components of synaptic plasticity. I. Fasciclin II controls synaptic stabilization and growth. Neuron. 1996;17:641–654. doi: 10.1016/s0896-6273(00)80197-x. [DOI] [PubMed] [Google Scholar]
  • 55.Zito K, Parnas D, Fetter RD, Isacoff EY, Goodman CS. Watching a synapse grow: noninvasive confocal imaging of synaptic growth in Drosophila. Neuron. 1999;22:719–729. doi: 10.1016/s0896-6273(00)80731-x. [DOI] [PubMed] [Google Scholar]
  • 56.Ataman B, Ashley J, Gorczyca D, Gorczyca M, Mathew D, et al. Nuclear trafficking of Drosophila Frizzled-2 during synapse development requires the PDZ protein dGRIP. Proc Natl Acad Sci U S A. 2006;103:7841–7846. doi: 10.1073/pnas.0600387103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Ataman B, Ashley J, Gorczyca M, Ramachandran P, Fouquet W, et al. Rapid activity-dependent modifications in synaptic structure and function require bidirectional Wnt signaling. Neuron. 2008;57:705–718. doi: 10.1016/j.neuron.2008.01.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Wu CH, Nusse R. Ligand receptor interactions in the Wnt signaling pathway in Drosophila. J Biol Chem. 2002;277:41762–41769. doi: 10.1074/jbc.M207850200. [DOI] [PubMed] [Google Scholar]
  • 59.Sato A, Kojima T, Ui-Tei K, Miyata Y, Saigo K. Dfrizzled-3, a new Drosophila Wnt receptor, acting as an attenuator of Wingless signaling in wingless hypomorphic mutants. Development. 1999;126:4421–4430. doi: 10.1242/dev.126.20.4421. [DOI] [PubMed] [Google Scholar]
  • 60.Gottmann K. Transsynaptic modulation of the synaptic vesicle cycle by cell-adhesion molecules. J Neurosci Res. 2008;86:223–232. doi: 10.1002/jnr.21484. [DOI] [PubMed] [Google Scholar]
  • 61.Klein R. Bidirectional modulation of synaptic functions by Eph/ephrin signaling. Nat Neurosci. 2009;12:15–20. doi: 10.1038/nn.2231. [DOI] [PubMed] [Google Scholar]
  • 62.Kwiatkowski AV, Weis WI, Nelson WJ. Catenins: playing both sides of the synapse. Curr Opin Cell Biol. 2007;19:551–556. doi: 10.1016/j.ceb.2007.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Fouquet W, Owald D, Wichmann C, Mertel S, Depner H, et al. Maturation of active zone assembly by Drosophila Bruchpilot. J Cell Biol. 2009;186:129–145. doi: 10.1083/jcb.200812150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Graf ER, Daniels RW, Burgess RW, Schwarz TL, DiAntonio A. Rab3 dynamically controls protein composition at active zones. Neuron. 2009;64:663–677. doi: 10.1016/j.neuron.2009.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Lang T, Jahn R. Core proteins of the secretory machinery. Handb Exp Pharmacol. 2008:107–127. doi: 10.1007/978-3-540-74805-2_5. [DOI] [PubMed] [Google Scholar]
  • 66.Sorensen JB. SNARE complexes prepare for membrane fusion. Trends Neurosci. 2005;28:453–455. doi: 10.1016/j.tins.2005.06.007. [DOI] [PubMed] [Google Scholar]
  • 67.Deitcher DL, Ueda A, Stewart BA, Burgess RW, Kidokoro Y, et al. Distinct requirements for evoked and spontaneous release of neurotransmitter are revealed by mutations in the Drosophila gene neuronal-synaptobrevin. J Neurosci. 1998;18:2028–2039. doi: 10.1523/JNEUROSCI.18-06-02028.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Kirikoshi H, Sekihara H, Katoh M. Molecular cloning and characterization of human WNT7B. Int J Oncol. 2001;19:779–783. doi: 10.3892/ijo.19.4.779. [DOI] [PubMed] [Google Scholar]
  • 69.Ahmad-Annuar A, Ciani L, Simeonidis I, Herreros J, Fredj NB, et al. Signaling across the synapse: a role for Wnt and Dishevelled in presynaptic assembly and neurotransmitter release. J Cell Biol. 2006;174:127–139. doi: 10.1083/jcb.200511054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Pielage J, Cheng L, Fetter RD, Carlton PM, Sedat JW, et al. A presynaptic giant ankyrin stabilizes the NMJ through regulation of presynaptic microtubules and transsynaptic cell adhesion. Neuron. 2008;58:195–209. doi: 10.1016/j.neuron.2008.02.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Micheva KD, Buchanan J, Holz RW, Smith SJ. Retrograde regulation of synaptic vesicle endocytosis and recycling. Nat Neurosci. 2003;6:925–932. doi: 10.1038/nn1114. [DOI] [PubMed] [Google Scholar]
  • 72.Regalado MP, Terry-Lorenzo RT, Waites CL, Garner CC, Malenka RC. Transsynaptic signaling by postsynaptic synapse-associated protein 97. J Neurosci. 2006;26:2343–2357. doi: 10.1523/JNEUROSCI.5247-05.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Yoshihara M, Adolfsen B, Galle KT, Littleton JT. Retrograde signaling by Syt 4 induces presynaptic release and synapse-specific growth. Science. 2005;310:858–863. doi: 10.1126/science.1117541. [DOI] [PubMed] [Google Scholar]
  • 74.McCabe BD, Marques G, Haghighi AP, Fetter RD, Crotty ML, et al. The BMP homolog Gbb provides a retrograde signal that regulates synaptic growth at the Drosophila neuromuscular junction. Neuron. 2003;39:241–254. doi: 10.1016/s0896-6273(03)00426-4. [DOI] [PubMed] [Google Scholar]
  • 75.Umemori H, Linhoff MW, Ornitz DM, Sanes JR. FGF22 and its close relatives are presynaptic organizing molecules in the mammalian brain. Cell. 2004;118:257–270. doi: 10.1016/j.cell.2004.06.025. [DOI] [PubMed] [Google Scholar]
  • 76.Salinas PC. Retrograde signalling at the synapse: a role for Wnt proteins. Biochem Soc Trans. 2005;33:1295–1298. doi: 10.1042/BST0331295. [DOI] [PubMed] [Google Scholar]
  • 77.Marques G. Morphogens and synaptogenesis in Drosophila. J Neurobiol. 2005;64:417–434. doi: 10.1002/neu.20165. [DOI] [PubMed] [Google Scholar]
  • 78.Burden SJ. Wnts as retrograde signals for axon and growth cone differentiation. Cell. 2000;100:495–497. doi: 10.1016/s0092-8674(00)80685-6. [DOI] [PubMed] [Google Scholar]
  • 79.Ciani L, Krylova O, Smalley MJ, Dale TC, Salinas PC. A divergent canonical WNT-signaling pathway regulates microtubule dynamics: dishevelled signals locally to stabilize microtubules. J Cell Biol. 2004;164:243–253. doi: 10.1083/jcb.200309096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Purro SA, Ciani L, Hoyos-Flight M, Stamatakou E, Siomou E, et al. Wnt regulates axon behavior through changes in microtubule growth directionality: a new role for adenomatous polyposis coli. J Neurosci. 2008;28:8644–8654. doi: 10.1523/JNEUROSCI.2320-08.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Augustin H, Grosjean Y, Chen K, Sheng Q, Featherstone DE. Nonvesicular release of glutamate by glial xCT transporters suppresses glutamate receptor clustering in vivo. J Neurosci. 2007;27:111–123. doi: 10.1523/JNEUROSCI.4770-06.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Liebl FL, Chen K, Karr J, Sheng Q, Featherstone DE. Increased synaptic microtubules and altered synapse development in Drosophila sec8 mutants. BMC Biol. 2005;3:27. doi: 10.1186/1741-7007-3-27. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Muscle size in wnt2 mutants is similar to that of controls. A: Representative confocal micrographs show the 6/7 NMJ labeled with HRP (green) to visualize neuronal membranes and phallotoxin to label F-actin (magenta). Scale bar  = 20 µm. B: Quantification of muscle sizes in controls and wnt2 mutants. C: Representative confocal micrographs show the 6/7 NMJ immunolabeled with HRP (magenta) and acetylated tubulin (green). Scale bar  = 20 µm.

(0.72 MB TIF)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES