Skip to main content
NCBI home page
Endocrinology logoLink to Endocrinology
. 2010 Jul 7;151(9):4437–4445. doi: 10.1210/en.2010-0296

Modulation of Prohormone Convertase 1/3 Properties Using Site-Directed Mutagenesis

Akihiko Ozawa 1, Juan R Peinado 1, Iris Lindberg 1
PMCID: PMC2940488  PMID: 20610561

Abstract

Prohormone convertase (PC)1/3 and PC2 cleave active peptide hormones and neuropeptides from precursor proteins. Compared with PC2, recombinant PC1/3 exhibits a very low specific activity against both small fluorogenic peptides and recombinant precursors, even though the catalytic domains in mouse PC1/3 and PC2 share 56% amino acid sequence identity. In this report, we have designed PC2-specific mutations into the catalytic domain of PC1/3 in order to investigate the molecular contributions of these sequences to PC1/3-specific properties. The exchange of residues RQG314 with the SY sequence present in the same location within PC2 paradoxically shifted the pH optimum of PC1/3 upward into the neutral range; other mutations in the catalytic domain had no effect. Although none of the full-length PC1/3 mutants examined exhibited increased specific activity, the 66-kDa form of the RQG314SY mutant was two to four times more active than the 66-kDa form of wild-type PC1/3. However, stable transfection of RQG314SY into PC12 cells did not result in greater activity against the endogenous substrate proneurotensin, implying unknown cellular controls of PC1/3 activity. Mutation of GIVTDA243–248 to QPFMTDI, a molecular determinant of 7B2 binding, resulted in increased zymogen expression but no propeptide cleavage or secretion, suggesting that this mutant is trapped in the endoplasmic reticulum due to an inability to cleave its own propeptide. We conclude that many convertase-specific properties are attributable less to convertase-specific catalytic cleft residues than to convertase-specific domain interactions.

Mutation of the PC1/3 catalytic domain affects its pH optimum and secretory properties.

Prohormone convertases (PCs) are processing enzymes responsible for the maturation of precursor proteins, such as peptide hormones, neuropeptides, growth factors, and viral proteins, via proteolytic processing C terminus to single or double basic residues (1,2,3,4). PCs are members of a eukaryotic family of subtilisin-like serine proteases in the secretory pathway (reviewed in Ref. 5). This family contains seven closely related convertases, namely furin, PACE4, PC1/3, PC2, PC4, PC5/6, and PC7/8 and the more distantly related enzyme, proprotein convertase subtilisin/kexin type 9 (5,6). PCs are first synthesized in zymogen form as multidomain proteins consisting of the following: a prodomain, believed to assist in correct protein folding (7); a catalytic domain, with approximately 26% homology to bacterial subtilisin; a P domain (homo B), which is essential to enzyme stability and contributes to the calcium and pH dependence of the enzymes (8); and a C-terminal domain, unique to each enzyme and considerably different among enzymes.

PC1/3 and PC2 are expressed predominantly in neuroendocrine tissues and represent the processing enzymes required to produce active neuropeptides and peptide hormones. PC-derived peptides are generated in the regulated secretory pathway from a host of different neuropeptide precursors, e.g. proopiomelanocortin, proenkephalin, and pro-TRH (9,10,11,12,13). Studies on both PC1/3 and PC2 knockout mice have clearly demonstrated that the production of specific peptides in such animals is decreased or abolished due to lack of processing via PC1/3 or PC2 (14,15,16,17). Although mouse PC1/3 and PC2 exhibit approximately 56% identity in their catalytic domains, they differ considerably from each other in many important biochemical properties, e.g. pH optima and calcium dependence (8,18,19,20). As regards substrate specificities, PC1/3 tends to produce larger intermediates from precursor proteins, whereas PC2 action often generates small peptides from those larger intermediates (21). PC1/3 and PC2 also bind to different partner proteins within the secretory pathway. 7B2 is a neuroendocrine-specific PC2-binding protein that inhibits only PC2 but is also paradoxically required for the formation of activatable proPC2 (18,22). Additionally, a recent study in our laboratory has demonstrated that 7B2 possesses molecular chaperone action toward proPC2 and blocks its aggregation (23). By contrast, proSAAS is a natural PC1/3-specific binding protein and inhibitor (24,25,26).

Like other convertases, PC1/3 is first synthesized as a 97-kDa zymogen, which is rapidly autocatalytically converted to an 87-kDa active form in an intramolecular interaction (27). Via further intermolecular autocatalytic action, the C-terminal region of 87- kDa PC1/3 can be truncated to smaller 74/66-kDa forms (27). Compared with the 87-kDa form, both the 74- and 66-kDa forms are much more active but are less stable (27,28,29). Increased activity of the 66-kDa form has also been observed in in vivo studies (27,28). PC2, on the other hand, is not C-terminally truncated (20) and appears to have no differentially active forms. It is also the only convertase able to exit the endoplasmic reticulum without prior propeptide cleavage, most likely due to its ability to bind its specific chaperone 7B2 (reviewed in Ref. 30).

Previous reports have shown that purified recombinant PC1/3 consistently exhibits approximately 100-fold lower specific activity than recombinant PC2 against fluorogenic substrates (10,18,19,29,31,32). No specific factor has been identified that could result in such a significant difference in specific activity. This difference cannot be due to the use of small synthetic substrates, because PC1/3 is equally inactive when large substrates, such as proenkephalin (10), proghrelin (32), and many other precursors (Ozawa, A., and I. Lindberg, unpublished observations), are used. Our previous mutagenesis work on PC2 has demonstrated that PC2-specific sequences in the catalytic domain are important in regulating enzyme activity and specificity (33,34). To provide information about the molecular contributions of convertase-specific sequences on PC1/3 activity, we have constructed a series of PC1/3 mutants in the vicinity of the substrate-binding pocket that possess the corresponding sequences in PC2.

Materials and Methods

Preparation of PC1/3 mutants

The mutations in PC1/3 shown in Fig. 1A were introduced into mouse PC1/3 cDNA (in the pRC/CMV-PC1/3 plasmid) using the QuickChange II XL site mutagenesis kit (Stratagene, La Jolla, CA). The primers used for mutations are listed in Table 1. After cloning of each mutant, the entire open reading frame was sequenced to confirm that only the desired mutation was obtained.

Figure 1.

Figure 1

Open in a new tab

A, Alignment of PC1/3, PC2, and furin sequences DLTNENK207TDDWFNS (a), GIVTDA248QPFMTDI (b), N271T (c), RQG314SY (d), and YTDQR364NPEAG (e). B, Three-dimensional model of PC1/3. A PC1/3 3D model was calculated using Swiss-Model with Furin 3D structure (1P8J) as template and analyzed with the Swiss-Pdb viewer. The image shows an upper view of PC1/3 with the active site exposed. The catalytic triad is represented in red (asterisk in A). All of the mutations (orange, shaded in A) surround the active site (letters a–e correspond to the different mutations). The quality of the resulting models was verified manually with Swiss-Pdb viewer.

Table 1.

List of primers used to introduce mutations into PC1/3

Mutants Primers (5′–3′)
DLTNENK207TDDWFNS CCGATATGATCTCACATGGTTCAATAGCCATGGAACAGG
CCATTTCCCCGATATACAGATGACTGGTTCAATAGCCATGGAACA
GIVTDA248QPFMTDI GCTGGATGGCATTGTAATGACAGACATCATTGAGGCTAGTTC
CATAAGAATGCTGGATCAGCCTTTTATGACAGACATCATTG
N271T GCTGGGGACCTACTGATGATGGAAAAACTG
RQG314SY GCTTCAGGGAATGGAGGTTCATACGATAACTGTGACTGTGATGGC
YTDQR364NPEAG CTACAGCAGTGGTGATAACCCAGAAGCGGGAATAACAAGCGCTG
RR617KH CAATACAGTCCAGAATGACAAGAGAGGAGTGGAAAAGATGG
CAATACAGTCCAGAATGACAAGCACGGAGTGGAAAAGATGGTGAATG
RR654KA CAGCAGCAATGTGGAGGGTAAAGCGGATGAGCAGGTACAAGGAAC
Open in a new tab

Transient expression of PC1/3 mutants

Two micrograms of plasmids encoding WT PC1/3 or mutant PC1/3s were transfected into HEK293 cells (1 × 106 cells per well in six-well plates) using FuGENE 6 (Roche Applied Science, Indianapolis, IN). After 24 h of incubation, cells were washed with PBS, then 1 ml of Opti-MEM (Invitrogen, Carlsbad, CA) containing 10 μg/ml aprotinin was added to the wells. The cells were further incubated at 37 C under 5% CO2 for 16 h. The conditioned medium was harvested and used for enzyme assay in the presence of protease inhibitors (see below). Additionally, both cell lysate and conditioned medium were subjected to SDS-PAGE followed by Western blot analysis. The blots were visualized using PC1/3 amino-terminal primary antiserum (35), horseradish peroxidase-coupled secondary antiserum, and the SuperSignal West Pico Maximum Sensitivity Substrate kit (Thermo Scientific, Rockford, IL) to obtain quantitative information on the level of expression and secretion of PC1/3s. To normalize the enzymatic activities of PC1/3s in the conditioned medium, the band intensities on the blots were measured using an Alphaimager 3300 (Alpha Innotech Corp., San Leandro, CA), and then the enzyme activity was divided by band intensity.

Enzyme assay

For the measurement of enzyme activity, 50-μl triplicate reaction mixtures containing 200 μm pyr-ERTKR-amc (7-amino-4-methylcoumarin) peptide, 100 mm Bis-Tris (pH 6.0; in the case of the RQG314SY mutant, pH 7.0 buffer was used to correspond with its optimum pH), 5 mm CaCl2, 0.1% Brij 35, 10 μl of conditioned medium from PC1/3-expressing cells, and a protease inhibitor cocktail (final concentrations: 1 μm pepstatin, 0.28 mm tosylphenylalanine chloromethyl ketone, 10 μm E-64, and 0.14 mm tosyllysine chloromethyl ketone) were incubated under kinetic read conditions in a Fluoroskan Ascent fluorometer (Thermo Scientific) at 37 C for 30 min. For the experiment analyzing pH optimum, 100 mm Bis-Tris/100 mm sodium acetate buffer was used at the indicated pHs; the pH was adjusted using acetic acid (Figs. 2 and 3).

Figure 2.

Figure 2

Open in a new tab

The RQG314SY PC1/3 mutant possesses a higher pH optimum than WT PC1/3 and other mutants. HEK 293 cells were transiently transfected with either WT or mutants, and the conditioned media and cells were harvested. The secretion levels of PC1/3s in conditioned media obtained from three separate identical wells were determined by Western blot analysis using PC1/3 amino-terminal antiserum in A. For the GIVTDA248QPFMTDI mutant, both secretion and expression levels are shown. An asterisk indicates the position of the 74-kDa form of PC1/3. Mr indicates molecular weight. B, The pH optima of the various mutants are shown. C, A comparison of the enzyme activity between WT and mutants. PC1/3 activities were measured under standard conditions (except for RQG314SY, measured at its optimum of pH 7.0) using 10 μl of conditioned medium. Activities were then normalized by the band intensity of secreted PC1/3, shown in A. All samples were assayed in triplicate, and the mean and sd are shown.

Figure 3.

Figure 3

Open in a new tab

pH optimum of RQG314SY mutants. A, The alignments of all mutants. SB1, RR617KA; SB2, RR654KH. B, The secretion levels of PC1/3s in conditioned media obtained from two separate identical wells were determined by Western blot analysis using PC1/3 amino-terminal antiserum. An asterisk and triangle indicate the internally cleaved product and the 74-kDa form of RQG314SY. Mr indicates molecular weight. To compare the pH optima of WT, WT 87 kDa DB, RQG314SY, RQG314SY 87 kDa DB and RQG314SY-SB1 and RQG314SY-SB2 (C), and WT 66 kDa and RQG314SY 66 kDa (D), the reactions were carried out for 30 min (2 h for the assay with 66-kDa PC1/3) at the indicated pH values, as described in Materials and Methods. Samples were assayed in triplicate, and the mean and sd are shown.

Transfection of the RQG314SY mutant into PC12 cells

PC12 cells, a rat adrenal medullary cell line, were grown in DMEM-high glucose (4.5 g/liter) medium containing 10% fetal bovine serum and 5% heat-inactivated horse serum on collagen-coated plates. The construction of PC12 cells expressing wild-type (WT) mPC1/3 has been described previously (36). The pRC/CMV-RQG314SY mutant plasmid was transfected into PC12 cells using Lipofectin (Invitrogen). Cells stably expressing the RQG314SY mutant were selected by adding 300 μg/ml of G-418, and the secreted PC1/3 activity was then determined in the conditioned medium using the standard fluorogenic peptide assay, as described above. In addition, the expression of PC1/3s in PC12 cells and medium was confirmed by Western blot analysis using PC1/3 antiserum.

Analysis of neurotensin production

To determine the substrate specificity of WT and RQG314SY, the production of the endogenous substrate neurotensin was measured in PC12 cell extracts by RIA. PC12 cells stably transfected with either WT mPC1/3 or with the RQG314SY mutant were cultured in medium containing 300 μg/ml G-418 in collagen-coated 10-cm dishes. After the cells reached about 70–80% confluence, the synthesis of proneurotensin was induced by culturing in medium containing 1 μm forskolin, 1 μm dexamethasone, 100 ng/ml nerve growth factor (Invitrogen), and 10 mm LiCl (37). Two days after the induction of proneurotensin synthesis, the cells were washed three times with PBS, scraped into 1 ml of cold 0.1 m HCl, and frozen on dry ice. After thawing and centrifugation for 5 min at 21,000 × g, supernatants were transferred to new tubes and lyophilized. The samples were resuspended in 250 μl of 32% acetonitrile in 0.1% trifluoroacetic acid (Thermo Scientific) and centrifuged again for clarification. The concentration of protein contained within the samples was measured using the Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA), and approximately 1 mg of protein (in a volume of ∼100 μl) was injected into a high-pressure gel permeation system equilibrated in 32% acetonitrile in 0.1% trifluoroacetic acid at 0.5 ml/min. Duplicate 100 μl aliquots of each 0.5-ml fraction were then dried by vacuum centrifugation in the presence of 2.5 μg BSA. To liberate cryptic neurotensin immunoreactivity from the neurotensin precursor, pepsin treatment of the dried samples was performed in 50-μl reactions containing 0.5 mg/ml pepsin (Sigma-Aldrich, St. Louis, MO), 0.1% phosphoric acid, and 0.1% acetic acid at 40 C for 90 min. Samples were then boiled for 5 min to stop the reaction, and 100 μl of water were added to each tube to aid in evaporation of the acid during overnight vacuum centrifugation. Dried samples were then resuspended in RIA buffer and subjected to RIA using neurotensin antiserum (Bachem, Torrance, CA). Data were analyzed using GraphPad PRISM 4 (GraphPad, Inc., San Diego, CA), and standard curves were fitted to a sigmoidal dose-response curve.

Results

Rationale of PC1/3 mutation choice

PC1/3 and PC2/furin possess 48/45% identical amino acid sequences overall. When the catalytic domain alone is considered, PC1/3 and PC2/furin then exhibit 56/65% identity. The comparison of the catalytic domain sequences of the three enzymes is shown in Fig. 1A. After the crystal structure of furin was reported (38), modeling of other convertases, including PC1/3, became possible (39,40). We have focused on our interest on the residues/sequences that: 1) are PC1/3-specific, i.e. are not conserved in PC2 and furin; and 2) are located around the binding pocket. Five sequences were replaced with the corresponding sequences in PC2. These sequences are 1) DLTNENK201–207, 2) GIVTDA243–248, 3) N271, 4) RQG312–314, and 5) YTDQR360–364. The corresponding sequences in PC2 are given in Fig. 1. It should be noted that the sequence GIVTDA243–248 is a known binding determinant for the 7B2 C-terminal peptide and is absolutely required for its inhibition of PC2 (41). This sequence is predicted to reside in a canopy region above the P4 site within the binding pocket in the PC1/3 model (40).

The RQG314SY mutant exhibits a neutral pH optimum

Plasmids encoding each PC1/3 mutant were prepared in pRC/CMV using site-directed mutagenesis. These plasmids were then transfected into HEK293 cells, and expression and secretion levels were confirmed by Western blot analysis using amino-terminally directed PC1/3 antiserum (Fig. 2A). Interestingly, the GIVTDA248QPFMTDI mutant, which possesses one of three 7B2-binding domains within PC2 (42,43), exhibited neither zymogen activation or secretion (the zymogen was, however, quite efficiently expressed). Cotransfection of 7B2 with the GIVTDA248QPFMTDI mutant did not improve either its activation or secretion (data not shown). Because a portion of WT proPC1/3 appears to naturally undergo proteasomal degradation in HEK293 cells (44), we investigated whether this mutant proPC1/3 accumulates in the endoplasmic reticulum as a result of misfolding by treating transfected cells with the proteasome inhibitor lactacystin at 5 μm. However, in two independent experiments, lactacystin did not increase the amount of cellular 94-kDa GIVTDA248QPFMTDI proPC1/3, indicating that this mutant precursor is not subject to proteasomal degradation but likely remains in the endoplasmic reticulum (data not shown).

To determine the pH optima of the various secreted mutants, the conditioned medium was assayed for PC1/3 activity at various pHs. These results showed that the RQG314SY mutant possesses a neutral pH optimum, whereas all other mutants exhibit acidic pH optima similar to the WT enzyme (Fig. 2B). These results indicate that the RQG314SY mutant might interact with a domain, such as the P domain, which regulates the pH optimum in PC1/3 (8). Additionally, secreted RQG314SY reproducibly contained much more of the 74/66-kDa form than the WT and other mutants, indicating enhanced autocatalytic cleavage. The activities of all mutants were measured at their optimum pH conditions and then normalized by their secretion levels (as determined by Western blot analysis) to directly compare their specific activities. No significant differences in activity were observed between all mutants and WT PC1/3 (Fig. 2C). In other words, none of the PC2-specific mutations surrounding the catalytic pocket conferred increased PC1/3 activity, indicating that the lower specific activity of PC1/3 cannot be attributed to the presence of these PC1/3-specific residues. No differences in calcium dependency were observed between the mutants and WT enzymes (data not shown).

The neutral pH optimum of the RQG314SY mutant is associated with the presence of the longer 87- and 74-kDa forms

Intermolecular autoproteolytic activity of 87-kDa PC1/3 results in the production of 74/66-kDa forms by cleaving at specific processing sequences at RR617 and RR654. Compared with the other PC1/3 mutants studied, expression of the RQG314SY mutant reproducibly generated a greater proportion of these C-terminally 74/66-kDa forms. We next investigated whether one of these cleaved forms could be responsible for the increased pH optimum observed for the RQG314SY mutant by preparing mutant 87-kDa-blockaded proteins unable to undergo these C-terminal cleavage events, reasoning that this should preclude formation of the 74/66-kDa forms of RQG314SY shown in Fig. 3A. The 87-kDa double blockade, single blockade (SB) and truncated 66-kDa forms of the RQG314SY mutant were obtained by blocking cleavage at either (SB1 and SB2), or both [double blockade (DB)] internal cleavage sites, RR617 and RR654, or by truncating the protein at residue RR617 (66 kDa). The secretion levels of all mutants were confirmed by Western blot analysis using amino-terminally directed PC1/3 antiserum (Fig. 3B). Unexpectedly, the DB, SB1, and SB2 mutations in RQG314SY mutant produced internally cleaved products, whereas the DB mutation in WT PC1/3 generated only 87-kDa DB PC1/3. The DB and SB mutants still exhibited a neutral pH optimum (Fig. 3C), whereas the 66-kDa form exhibited a WT pH optimum (Fig. 3D). Interestingly, a smaller difference in enzyme activities between pH values 6.0 and 7.0 was observed using the RQG314SY and RQG314SY-SB2 mutants, which are both able to generate the 66-kDa form. By contrast, both the RQG314SY-DB and RQG314SY-SB1 mutants, which cannot produce a 66-kDa form due to blockade of this site, showed clear differences in activities at the two pH values from WT PC1/3. These results indicate that the neutral pH optimum of RQG314SY is likely to be generated by the 87- and 74-kDa forms but not by the 66-kDa species. Hence, the C-terminal tail present only in the longer forms appears to be required for the upwards shift in pH optimum. Most interestingly, the 66-kDa form of RQG314SY exhibited 2- to 4-fold the activity of WT 66-kDa PC1/3 in three independent experiments, whereas the mutant and WT 87-kDa forms showed similar activities (Fig. 4). This finding supports the idea that the C-terminal tail of PC1/3 is involved in the regulation of the activity of the RQG314SY mutant. We attempted to confirm whether the C-terminal tail can modulate the pH optimum of the 66-kDa form of RQG314SY by adding recombinant C-terminal tail protein to the enzyme reaction. However, no pH shift was observed (data not shown). These results indicate that the C-terminal tail-induced pH shift requires an intact PC1/3 molecule.

Figure 4.

Figure 4

Open in a new tab

The 66-kDa form of RQG314SY PC1/3 exhibits a higher specific activity than WT PC1/3. A comparison of the enzyme activities of the 87- and 66-kDa forms of WT and RQG314SY PC1/3s was performed. The substrate pyr-ERTKR-amc was incubated for either 30 min (87-kDa forms) or 2 h (for 66-kDa forms) with 10 μl of conditioned medium in reactions containing 100 mm Bis-Tris [pH 6.0 (pH 7.0 for 87-kDa form of RQG314SY)], and the standard concentrations of calcium, protease inhibitors, and detergent (see Materials and Methods). Activities were then normalized by the secretion levels of each PC1/3, as assessed using Western blot analysis and densitometry. Samples were assayed in triplicate, and the mean and sd are shown.

Differential cleavage of proneurotensin by the WT PC1/3 and RQG314SY mutant

PC12 cells, which do not normally express PC1/3 and PC2, can greatly increase their expression of proneurotensin under certain stimulated conditions. In a previous study, we showed that transfection of PC1/3 into PC12 cells can result in increased processing of this induced proneurotensin (45). To obtain information on the cellular activity of the RQG314SY mutant, we compared the maturation of proneurotensin synthesized in PC12 cells stably transfected with the RQG314SY mutant with that in PC12 cells expressing WT PC1/3. The expression of both WT and RQG314SY PC1/3s is shown in Fig. 5A. Interestingly, levels of the C-terminally truncated 74-kDa form of the RQG314SY mutant are much lower in PC12 cells compared with HEK cell medium (compare Figs. 2A and 5A). When transfected cell lines were stimulated to increase the expression level of proneurotensin and examined for processing, cells expressing WT PC1/3 exhibited approximately 95% conversion of precursors to low molecular weight neurotensin-immunoreactive peptides (Fig. 5B). By contrast, RQG314SY PC1/3 was unable to cleave all of the proneurotensin, because approximately one-fifth of the total immunoreactivity remained in the position of precursor protein (Fig. 5B). Two independently derived cell lines gave similar results.

Figure 5.

Figure 5

Open in a new tab

Cleavage of proneurotensin by WT and RQG314SY in PC12 cells. A, Expression of WT and RQG314SY in PC12 cells. C, Cell lysate; M, conditioned medium. B, Size-fractionation of neurotensin-immunoreactivity (Ir) peptides synthesized by WT or RQG314SY in PC12 cells. The void volume was in fraction 22, and the salt volume was in fraction 52. Samples were assayed in duplicate, and the mean and sd are shown. Markers shown include myoglobin (17 kDa) and neurotensin (NT). Similar results were obtained in two independent experiments using two different clones.

Discussion

PCs participate in diverse physiological events through their production of a variety of important bioactive peptide hormones and neuropeptides, e.g. insulin, glucagon, α-MSH, and enkephalins (21). In some cases, PC1/3 and PC2 act on peptide precursors to produce the same product peptides. Often, however, their cleavage specificities differ, with PC2 producing a wider array of peptide products, despite the fact that the catalytic domains of the two enzymes are highly homologous (21). In vitro studies on the enzymatic characterization of PC1/3 and PC2 have shown that these enzymes have quite different biochemical properties, differing, for example, in specific activity, enzyme stability, calcium dependence, and pH optimum (8,18,19,20,29,31). Our previous mutagenesis study has demonstrated that mutations of the PC2 catalytic domain into PC1/3-specific sequences can alter its relative activity on fluorogenic substrates and its inhibition by the 7B2 CT peptide (33,34). However, the contribution of PC1/3-specific sequences within the catalytic domain of PC1/3 to its activity and specificity has not yet been studied.

The specific activities of PC1/3s bearing five different PC2-like mutations (Fig. 1A) in the vicinity of the binding pocket were not significantly different compared with WT PC1/3. These results indicate that these mutated residues are not critical to the general activity of PC1/3. Interestingly, none of the mutations examined conferred PC2-specific properties, e.g. its known acidic pH optimum of 5.0 and low calcium optimum of 100 μm (46). No mutants exhibited altered calcium requirements, and only one mutant exhibited an altered pH optimum, RQG314SY PC1/3. However, unlike WT PC1/3 and all other mutants, RQG314SY PC1/3 exhibited a neutral rather than an acidic pH optimum. We conclude that although the RQG314SY sequence is clearly important to pH optimum determination, other residues/interactions are required for the manifestation of PC1/3-specific properties. Previous studies have implicated the P domain of the PCs, located in close proximity to the catalytic pocket (39), in the regulation of various biochemical properties, including pH optima, calcium dependency, and formation of specific conformation. Indeed, PC1/3 chimeric mutants containing P domains from PC2 and/or furin exhibit significantly increased enzyme activities (3- to 4-fold) and different pH optima compared with WT PC1/3 (8). Interestingly, a chimeric PC1/3 mutant containing the PC2 P domain exhibited a neutral pH optimum, even though WT PC2 possesses an acidic pH optimum (8,18). These results indicate that structural interactions between the P domain and catalytic domain must contribute heavily to the determination of pH optimum and specific activity. Further, in another study of PC1/3 chimeric mutants, a mutant containing the transmembrane/C-terminal domain of peptidylglycine α-amidating monooxygenase exhibited a broad pH optimum rather than an acidic optimum, supporting the idea that the conformation of the catalytic core of PC1/3 can be altered by the addition of the peptidylglycine α-amidating monooxygenase transmembrane/C-terminal domain tether (20). By analogy, the neutral pH optimum of the 87/74-kDa form of our RQG314SY mutant is also likely to result from differences in structural interactions between the P, catalytic, and CT domains than occur within WT PC1/3. Given that the RQG314SY mutant always generated a greater proportion of C-terminally cleaved PC1/3, this mutation may have additional structural changes, which result in a more accessible conformation of C-terminal internal cleavage sites to proteolysis.

To determine the function of the RQG314SY mutation in a cellular context, we also compared the processing profiles of proneurotensin in PC12 cells expressing WT and RQG314SY PC1/3s. Despite similar expression levels of both PC1/3s, and despite the fact that both PC1/3s produced a similar quantity of the 66-kDa form, RQG314SY PC1/3 consistently converted proneurotensin to neurotensin more inefficiently than did WT PC1/3. This is in direct contradiction to the results of our in vitro assay, in which the 66-kDa form of RQG314SY PC1/3 was much more active than WT 66-kDa PC1/3. Potential possibilities to explain these results are that: 1) the conformation of RQG314SY PC1/3 differs between granules and in conditioned medium, generating specificity differences; or 2) the position of the nearby N within the catalytic site is altered in RQG314SY PC1/3, such that the cleavage of small synthetic substrates is favored when compared with larger peptide substrates. Further work is needed to address these possibilities. Our results indicate that caution is needed when extrapolating mutational results obtained in vitro to actual neuroendocrine cell processing events.

We also identified mutation-specific processing of the C-terminal tail of PC1/3. In HEK cell medium, we consistently observed much more of the 74-kDa C-terminally truncated form of RQG314SY PC1/3 (see Fig. 2A). It is interesting to note that double- and single-blockade forms of the RQG314SY PC1/3 mutant were still internally cleaved in HEK cell medium. However a slightly larger cleavage product than 74-kDa form was obtained (see Fig. 3, A and B). Because this unusual cleavage product can only be observed in the conditioned medium of HEK cells rather than in cell lysate (data not shown), and because the identical blockade mutation of RQG314SY in PC12 cells did not produce the variant product (see Fig. 5A), it most likely occurs within the medium by exogenous proteases.

PC1/3 is known to be synthesized as a zymogen that in all convertases except proPC2 is cleaved autocatalytically in the endoplasmic reticulum, a process that occurs rapidly after initial synthesis (47,48,49,50). However, in the GIVTDA248QPFMTDI PC1/3 mutant, in which the canopy region above the P4 subsite in the catalytic cleft is predicted to be altered (40), the 94-kDa zymogen apparently cannot undergo autocatalytic cleavage. Because it has long been known that mutations or deletions within convertase propeptides can block autocatalytic processing within the endoplasmic reticulum (7,48,51,52,53,54), we speculate that the mutant QPFMTDI sequence in the catalytic domain may tightly bind the PC1/3 propeptide in such a manner as to block its movement during autocatalytic activation, perhaps as a result of its more hydrophobic nature (compared with the native GIVTDA sequence normally present at this position). Because PC1/3 absolutely requires this propeptide cleavage event for escape from the endoplasmic reticulum (50,55), uncleaved GIVTDA248QPFMTDI proPC1/3 remains trapped in this compartment. Neither activation nor secretion were improved by cotransfection of the GIVTDA248QPFMTDI mutant cell lines with the proPC2 chaperone 7B2 (data not shown), supporting the idea that the 7B2-convertase interaction requires additional binding determinants (22,34,42).

Taken together with the results of previous studies, especially those of chimeric mutants (8,20,48,53), the data in the present study indicate that the comparatively low activity of PC1/3 vs. PC2 cannot be attributed to enzyme-specific sequences within the catalytic cleft proper, but more likely to interactions of the PC1/3 catalytic domain with its P domain. It is also possible that PC1/3 requires an as yet undescribed endocrine chaperone protein for full activation, which is not proSAAS (43). In addition, the increased specific activity of 66-kDa RQG314SY mutant PC1/3 over WT 66-kDa PC1/3 supports the previously proposed idea that the regulation of PC1/3 activity requires not only the catalytic and P domains but also the C-terminal region (20,56). Further investigation of the complex regulation of this important enzyme would be greatly aided by a crystal structure; such studies are now in progress.

Acknowledgments

We thank T. Mandichak for help with the construction of several mutants of PC1/3.

Footnotes

This work was supported by the National Institutes of Health Grant NIDA05084-22.

Disclosure Summary: The authors have nothing to disclose.

First Published Online July 7, 2010

Abbreviations: DB, Double blockade; PC, prohormone convertase; SB, single blockade; WT, wild type.

References

  1. Bravo DA, Gleason JB, Sanchez RI, Roth RA, Fuller RS 1994 Accurate and efficient cleavage of the human insulin proreceptor by the human proprotein-processing protease furin. Characterization and kinetic parameters using the purified, secreted soluble protease expressed by a recombinant baculovirus. J Biol Chem 269:25830–25837 [PubMed] [Google Scholar]
  2. Inocencio NM, Sucic JF, Moehring JM, Spence MJ, Moehring TJ 1997 Endoprotease activities other than furin and PACE4 with a role in processing of HIV-I gp160 glycoproteins in CHO-K1 cells. J Biol Chem 272:1344–1348 [DOI] [PubMed] [Google Scholar]
  3. Takahashi S, Nakagawa T, Kasai K, Banno T, Duguay SJ, Van de Ven WJ, Murakami K, Nakayama K 1995 A second mutant allele of furin in the processing-incompetent cell line, LoVo. Evidence for involvement of the homo B domain in autocatalytic activation. J Biol Chem 270:26565–26569 [DOI] [PubMed] [Google Scholar]
  4. Miranda L, Wolf J, Pichuantes S, Duke R, Franzusoff A 1996 Isolation of the human PC6 gene encoding the putative host protease for HIV-1 gp160 processing in CD4+ T lymphocytes. Proc Natl Acad Sci USA 93:7695–7700 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Steiner DF 1998 The proprotein convertases. Curr Opin Chem Biol 2:31–39 [DOI] [PubMed] [Google Scholar]
  6. Seidah NG, Benjannet S, Wickham L, Marcinkiewicz J, Jasmin SB, Stifani S, Basak A, Prat A, Chretien M 2003 The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation. Proc Natl Acad Sci USA 100:928–933 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Creemers JW, Vey M, Schäfer W, Ayoubi TA, Roebroek AJ, Klenk HD, Garten W, Van de Ven WJ 1995 Endoproteolytic cleavage of its propeptide is a prerequisite for efficient transport of furin out of the endoplasmic reticulum. J Biol Chem 270:2695–2702 [DOI] [PubMed] [Google Scholar]
  8. Zhou A, Martin S, Lipkind G, LaMendola J, Steiner DF 1998 Regulatory role of the P domain of subtilisin-like prohormone convertases. J Biol Chem 273:11107–11114 [DOI] [PubMed] [Google Scholar]
  9. Nillni EA, Friedman TC, Todd RB, Birch NP, Loh YP, Jackson IM 1995 Pro-thyrotropin-releasing hormone processing by recombinant PC1. J Neurochem 65:2462–2472 [DOI] [PubMed] [Google Scholar]
  10. Peinado JR, Li H, Johanning K, Lindberg I 2003 Cleavage of recombinant proenkephalin and blockade mutants by prohormone convertases 1 and 2: an in vitro specificity study. J Neurochem 868–878 [DOI] [PubMed] [Google Scholar]
  11. Zhou A, Mains RE 1994 Endoproteolytic processing of proopiomelanocortin and prohormone convertases 1 and 2 in neuroendocrine cells overexpressing prohormone convertases 1 or 2. J Biol Chem 269:17440–17447 [PubMed] [Google Scholar]
  12. Friedman TC, Loh YP, Cawley NX, Birch NP, Huang SS, Jackson IM, Nillni EA 1995 Processing of prothyrotropin-releasing hormone (pro-TRH) by bovine intermediate lobe secretory vesicle membrane PC1 and PC2 enzymes. Endocrinology 136:4462–4472 [DOI] [PubMed] [Google Scholar]
  13. Sanchez VC, Goldstein J, Stuart RC, Hovanesian V, Huo L, Munzberg H, Friedman TC, Bjorbaek C, Nillni EA 2004 Regulation of hypothalamic prohormone convertases 1 and 2 and effects on processing of prothyrotropin-releasing hormone. J Clin Invest 114:357–369 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Furuta M, Yano H, Zhou A, Rouille Y, Holst JJ, Carroll R, Ravazzola M, Orci L, Furuta H, Steiner DF 1997 Defective prohormone processing and altered pancreatic islet morphology in mice lacking active SPC2. Proc Natl Acad Sci USA 94 :6646–6651 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Laurent V, Jaubert-Miazza L, Desjardins R, Day R, Lindberg I 2004 Biosynthesis of proopiomelanocortin-derived peptides in prohormone convertase 2 and 7B2 null mice. Endocrinol 145:519–528 [DOI] [PubMed] [Google Scholar]
  16. Zhu X, Zhou A, Dey A, Norrbom C, Carroll R, Zhang C, Laurent V, Lindberg I, Ugleholdt R, Holst JJ, Steiner DF 2002 Disruption of PC1/3 expression in mice causes dwarfism and multiple neuroendocrine peptide processing defects. Proc Natl Acad Sci USA 99:10293–10298 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Berman Y, Mzhavia N, Polonskaia A, Devi LA 2001 Impaired prohormone convertases in cpefat/cpefat mice. J Biol Chem 276:1466–1473 [DOI] [PubMed] [Google Scholar]
  18. Lamango NS, Zhu X, Lindberg I 1996 Purification and enzymatic characterization of recombinant prohormone convertase 2: stabilization of activity by 21 kDa 7B2. Arch Biochem Biophys 330:238–250 [DOI] [PubMed] [Google Scholar]
  19. Zhou Y, Lindberg I 1993 Purification and characterization of the prohormone convertase PC1(PC3). J Biol Chem 268:5615–5623 [PubMed] [Google Scholar]
  20. Bruzzaniti A, Marx R, Mains RE 1999 Activation and routing of membrane-tethered prohormone convertases 1 and 2. J Biol Chem 274:24703–24713 [DOI] [PubMed] [Google Scholar]
  21. Cameron A, Apletalina EV, Lindberg I 2001 The enzymology of PC1 and PC2. In: Dalbey RE, ed. The Enzymes. San Diego, CA: Academic Press; 291–331 [Google Scholar]
  22. Fortenberry Y, Liu J, Lindberg I 1999 The role of the 7B2 CT peptide in the inhibition of prohormone convertase 2 in endocrine cell lines. J Neurochem 73:994–1003 [DOI] [PubMed] [Google Scholar]
  23. Lee SN, Lindberg I 2008 7B2 prevents unfolding and aggregation of prohormone convertase 2. Endocrinology 149:4116–4127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Basak A, Koch P, Dupelle M, Fricker LD, Devi LA, Chretien M, Seidah NG 2001 Inhibitory specificity and potency of proSAAS-derived peptides toward proprotein convertase 1. J Biol Chem 276: 32720–32728 [DOI] [PubMed] [Google Scholar]
  25. Qian Y, Devi LA, Mzhavia N, Munzer S, Seidah NG, Fricker LD 2000 The C-terminal region of proSAAS is a potent inhibitor of prohormone convertase 1. J Biol Chem 275:23596–23601 [DOI] [PubMed] [Google Scholar]
  26. Cameron A, Fortenberry Y, Lindberg I 2000 The SAAS granin exhibits structural and functional homology to 7B2 and contains a highly potent hexapeptide inhibitor of PC1. FEBS Lett 473:135–138 [DOI] [PubMed] [Google Scholar]
  27. Zhou Y, Lindberg I 1994 Enzymatic properties of carboxyl-terminally truncated prohormone convertase 1 (PC1/SPC3) and evidence for autocatalytic conversion. J Biol Chem 269:18408–18413 [PubMed] [Google Scholar]
  28. Boudreault A, Gauthier D, Rondeau N, Savaria D, Seidah NG, Chrétien M, Lazure C 1998 Molecular characterization, enzymatic analysis, and purification of murine proprotein convertase-1/3 (PC1/PC3) secreted from recombinant baculovirus-infected insect cells. Protein Expr Purif 14:353–366 [DOI] [PubMed] [Google Scholar]
  29. Rufaut NW, Brennan SO, Hakes DJ, Dixon JE, Birch NP 1993 Purification and characterization of the candidate prohormone-processing enzyme SPC3 produced in a mouse L cell line. J Biol Chem 268:20291–20298 [PubMed] [Google Scholar]
  30. Muller L, Zhu P, Juliano MA, Juliano L, Lindberg I 1999 A 36-residue peptide contains all of the information required for 7B2-mediated activation of prohormone convertase 2. J Biol Chem 274:21471–21477 [DOI] [PubMed] [Google Scholar]
  31. Johanning K, Juliano MA, Juliano L, Lazure C, Lamango NS, Steiner DF, Lindberg I 1998 Specificity of prohormone convertase 2 on proenkephalin and proenkephalin-related substrates. J Biol Chem 273:22672–22680 [DOI] [PubMed] [Google Scholar]
  32. Ozawa A, Cai Y, Lindberg I 2007 Production of bioactive peptides in an in vitro system. Anal Biochem 366:182–189 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kacprzak MM, Peinado JR, Than ME, Appel J, Henrich S, Lipkind G, Houghten RA, Bode W, Lindberg I 2004 Inhibition of furin by polyarginine-containing peptides: nanomolar inhibition by nona-D-arginine. J Biol Chem 279:36788–36794 [DOI] [PubMed] [Google Scholar]
  34. Apletalina EV, Muller L, Lindberg I 2000 Mutations in the catalytic domain of prohormone convertase 2 result in decreased binding to 7B2 and loss of inhibition with 7B2 C-terminal peptide. J Biol Chem 275:14667–14677 [DOI] [PubMed] [Google Scholar]
  35. Vindrola O, Lindberg I 1992 Biosynthesis of the prohormone convertase mPC1 in AtT-20 cells. Mol Endocrinol 6:1088–1094 [DOI] [PubMed] [Google Scholar]
  36. Zhou Y, Rovere C, Kitabgi P, Lindberg I 1995 Mutational analysis of PC1 (SPC3) in PC12 cells. 66-kDa PC1 is fully functional. J Biol Chem 270:24702–24706 [DOI] [PubMed] [Google Scholar]
  37. Rovere C, De Nadai F, Bidard JN, Cuber JC, Kitabgi P 1993 PC12 cells can be induced to produce, but do not process, the neurotensin/neuromedin N precursor. Peptides 14:983–989 [DOI] [PubMed] [Google Scholar]
  38. Than ME, Henrich S, Bourenkov GP, Bartunik HD, Huber R, Bode W 2005 The endoproteinase furin contains two essential Ca2+ ions stabilizing its N-terminus and the unique S1 specificity pocket. Acta Crystallogr D Biol Crystallogr 61:505–512 [DOI] [PubMed] [Google Scholar]
  39. Henrich S, Cameron A, Bourenkov GP, Kiefersauer R, Huber R, Lindberg I, Bode W, Than ME 2003 The crystal structure of the proprotein processing proteinase furin explains its stringent specificity. Nat Struct Biol 10:520–526 [DOI] [PubMed] [Google Scholar]
  40. Henrich S, Lindberg I, Bode W, Than ME 2005 Proprotein convertase models based on the crystal structures of furin and kexin: explanation of their specificity. J Mol Biol 345:211–227 [DOI] [PubMed] [Google Scholar]
  41. Apletalina EV, Juliano MA, Juliano L, Lindberg I 2000 Structure-function analysis of the 7B2 CT peptide. Biochem Biophys Res Commun 267:940–942 [DOI] [PubMed] [Google Scholar]
  42. Benjannet S, Mamarbachi AM, Hamelin J, Savaria D, Munzer JS, Chrétien M, Seidah NS 1998 Residues unique to the prohormone convertase PC2 modulate its autoactivation, binding to 7B2, and enzymatic activity. FEBS Lett 428:37–42 [DOI] [PubMed] [Google Scholar]
  43. Fortenberry Y, Hwang JR, Apletalina EV, Lindberg I 2002 Functional characterization of proSAAS: similarities and differences with 7B2. J Biol Chem 277:5175–5186 [DOI] [PubMed] [Google Scholar]
  44. Lee SN, Prodhomme E, Lindberg I 2004 Prohormone convertase 1 (PC1) processing and sorting: effect of PC1 propeptide and proSAAS. J Endocrinol 182:353–364 [DOI] [PubMed] [Google Scholar]
  45. Lindberg I, Ahn SC, Breslin MB 1994 Cellular distributions of the prohormone processing enzymes PC1 and PC2. Mol Cell Neurosci 5:614–622 [DOI] [PubMed] [Google Scholar]
  46. Davidson HW, Rhodes CJ, Hutton JC 1988 Intraorganellar calcium and pH control of proinsulin cleavage in the pancreatic β cell via two distinct site-specific endopeptidases. Nature 333:93–96 [DOI] [PubMed] [Google Scholar]
  47. Milgram SL, Mains RE 1994 Differential effects of temperature blockade on the proteolytic processing of three secretory granule-associated proteins. J Cell Sci 107:737–745 [DOI] [PubMed] [Google Scholar]
  48. Zhou A, Paquet L, Mains RE 1995 Structural elements that direct specific processing of different mammalian subtilisin-like prohormone convertases. J Biol Chem 270:21509–21516 [DOI] [PubMed] [Google Scholar]
  49. Lindberg I 1994 Evidence for cleavage of the PC1/PC3 pro-segment in the endoplasmic reticulum. Mol Cell Neurosci 5:263–268 [DOI] [PubMed] [Google Scholar]
  50. Goodman LJ, Gorman CM 1994 Autoproteolytic activation of the mouse prohormone convertase mPC1. Biochem Biophys Res Commun 201:795–804 [DOI] [PubMed] [Google Scholar]
  51. Taylor NA, Shennan KI, Cutler DF, Docherty K 1997 Mutations within the propeptide, the primary cleavage site or the catalytic site, or deletion of C-terminal sequences, prevents secretion of proPC2 from transfected COS-7 cells. Biochem J 321(Pt 2):367–373 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Muller L, Cameron A, Fortenberry Y, Apletalina EV, Lindberg I 2000 Processing and sorting of the prohormone convertase 2 propeptide. J Biol Chem 275:39213–39222 [DOI] [PubMed] [Google Scholar]
  53. Creemers JW, Siezen RJ, Roebroek AJ, Ayoubi TA, Huylebroeck D, van de Ven WJ 1993 Modulation of furin-mediated proprotein processing activity by site-directed mutagenesis. J Biol Chem 268: 21826–21834 [PubMed] [Google Scholar]
  54. Creemers JW, Usac EF, Bright NA, Van de Loo JW, Jansen E, Van de Ven WJ, Hutton JC 1996 Identification of a transferable sorting domain for the regulated pathway in the prohormone convertase PC2. J Biol Chem 271:25284–25291 [DOI] [PubMed] [Google Scholar]
  55. Jackson RS, Creemers JW, Ohagi S, Raffin-Sanson ML, Sanders L, Montague CT, Hutton JC, O'Rahilly S 1997 Obesity and impaired prohormone processing associated with mutations in the human prohormone convertase 1 gene. Nat Genet 16:303–306 [DOI] [PubMed] [Google Scholar]
  56. Dikeakos JD, Di Lello P, Lacombe MJ, Ghirlando R, Legault P, Reudelhuber TL, Omichinski JG 2009 Functional and structural characterization of a dense core secretory granule sorting domain from the PC1/3 protease. Proc Natl Acad Sci USA 106:7408–7413 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES