Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Sep 15.
Published in final edited form as: J Immunol. 2010 Aug 20;185(6):3504–3513. doi: 10.4049/jimmunol.1000999

Concomitant activation and antigen uptake via human Dectin-1 results in potent antigen-specific CD8+ T cell responses

Ling Ni *, Ingrid Gayet *, Sandra Zurawski *, Dorothee Duluc *, Anne-Laure Flamar *, Xiao-Hua Li *, Amy O’Bar *, Sandra Clayton *, Anna Karolina Palucka *,†,‡, Gerard Zurawski *,†, Jacques Banchereau *,†,‡, SangKon Oh *,†,3
PMCID: PMC2941972  NIHMSID: NIHMS233730  PMID: 20729328

Abstract

Dectin-1, a C-type lectin recognizing fungal and mycobacterial pathogens, can deliver intracellular signals that activate dendritic cells (DCs), resulting in initiation of immune responses and expansion of Th17 CD4+ T cell responses. Here, we studied the roles of human Dectin-1 (hDectin-1) expressed on DCs in the induction and activation of antigen-specific CD8+ T cell responses. We first generated an agonistic anti-hDectin-1 monoclonal antibody (mAb), which recognizes the hDectin-1 Glu143-Ile162 region. It bound to in vitro monocyte-derived DCs and to in vivo CD1c+CD1a+ dermal DCs, but not to epidermal Langerhans cells. Anti-hDectin-1-mediated DC activation resulted in upregulation of costimulatory molecules and secretion of multiple cytokines and chemokines in a Syk-dependent manner. DCs activated with the anti-hDectin-1 mAb could significantly enhance both neo and foreign antigen-specific CD8+ T cell responses by promoting both the expansion of CD8+ T cell and their functional activities. We further demonstrated that delivering antigens to DCs via hDectin-1 using anti-hDectin-1-antigen conjugates resulted in potent antigen-specific CD8+ T cell responses. Thus, hDectin-1 expressed on DCs can contribute to the induction and activation of cellular immunity against intracellular pathogens, such as mycobacteria, that are recognized by DCs via Dectin-1. Vaccines based on delivering antigens to DCs with an agonistic anti-hDectin-1 mAb could elicit CD8+ T cell-mediated immunity.

Keywords: Human, Dendritic cells, T cells, Cytotoxic, Vaccination, Dectin-1


Dendritic cells (DCs) can initiate and control immune responses. DCs express toll-like receptors (TLRs) and C-type lectins, which are crucial for sensing and initiating immune responses against pathogens (1–7).

Dectin-1, a C-type lectin receptor, is highly expressed on DCs (3, 8). It can recognize both fungal and mycobacterial pathogens. It also delivers intracellular signals to activate DCs, resulting in initiation of immune responses to those pathogens (3, 9, 10). Upon recognition of fungal β-glucans, the tyrosine residue within the cytoplasmic immunoreceptor-tyrosine based activation marker (ITAM) motif is phosphorylated (11, 12), followed by recruitment of Syk and Card9 (13–16). These sequential events lead to activation of NFAT (17), MAPK (18), and NF-κB (12, 13, 19, 20). This results in secretion of multiple cytokines (3), including IL-10, IL-6, TNFα, and IL-23 (14, 19), that can directly impact the quantity and quality of antigen-specific adaptive immune responses. Most notably, Dectin-1-mediated DC activation contributes to the expansion of Th17 responses (3, 14, 21, 22). In line with this, human memory T cell responses to Candida albicans are predominantly Th17 (13, 14) and, to a far lesser extent, Th1 (23, 24). Soluble factors, including IL-6 and IL-1β, secreted by antigen-presenting cells (APCs) promote the expansion of Th17 responses (13, 14, 25), which are crucial for mounting protective immunity to intracellular bacterial pathogens, such as mycobacteria (26) and Francisella tularensis (27).

Dectin-1 contains a putative internalization signal sequence for the lysosomal endosome (28, 29), and thus can contribute to pathogen-specific T cell responses. Mouse DCs that take up antigens via Dectin-1 can present antigenic peptides to both CD4+ and CD8+ T cells (21, 22). One recent study showed that ovalbumin (OVA)-transgenic mice immunized with conjugates of anti-Dectin-1 and OVA generated strong CD4+ T cell responses but weak CD8+ T cell responses (22). However, a more recent study (30) showed that mouse DCs activated with β-glucans could prime cytotoxic CD8+ T cell responses. These studies (21, 22) suggested that antigens delivered to DCs via Dectin-1 could result in potent antigen-specific CD8+ T cell responses when DCs were activated by signaling via Dectin-1.

Thus, we hypothesized that antigens delivered to DCs via hDectin-1 with a concomitant activation of the DCs via the same hDectin-1 might result in potent antigen-specific CD8+ T cell responses. This hypothesis was tested using an agonistic anti-hDectin-1 mAb and anti-hDectin-1 mAb-antigen (neo and foreign antigens) conjugates. Our data showed that DCs activated with anti-hDectin-1 mAb resulted in enhanced CD8+ T cell responses. We further demonstrated that anti-hDectin-1 mAb and its conjugates with both neo and non-self antigens could act via DCs to elicit potent antigen-specific CD8+ T cell responses.

Materials and Methods

Antibodies and other reagents

Anti-CD1a (BD Biosciences, CA) and anti-CD1c (Biolegend, CA), and anti-CD207 (BIIR, clone 15B10) antibodies were used in immunofluorescence. Anti-human IgG (Fab) conjugated with alkaline phosphatase (AP) and all other antibodies used for staining cells were purchased from Southern Biotech (CA) and BD Biosciences, respectively. IFNα, IL-4 and GM-CSF were purchased from the pharmacy at Baylor University Medical Center (TX). IL-2 and CFSE were purchased from Peprotech (NJ) and Molecular Probes (CA), respectively. Piceatannol, curdlan, and laminarin were from Sigma (MO). Escherichia coli lipopolysaccharide (LPS) was purchased from Invivogen (CA). HLA-A*0201 tetramers of influenza viral (Flu) M158–66 and MART-126–35 (27L) were purchased from Beckman Coulter (CA). Flu M158–66, MART-126–35, and MART-126–35 (27L) peptides were synthesized by Biosynthesis (TX).

Anti-hDectin-1 monoclonal antibody (mAb)

Receptor ectodomain.hIgG (human IgG1Fc) and AP (human placental alkaline phosphatase) fusion proteins were produced for immunizing mice and screening mAbs, respectively. A mammalian vector for human Fc and AP fusion proteins was engineered, as previously described (31). Fusion proteins were produced using the FreeStyle™ 293 Expression System (Invitrogen, CA), according to the manufacturer’s protocol. Receptor ectodomain.hIgG was purified by 1 ml HiTrap protein A affinity chromatography (GE Healthcare, CA).

Six-week-old BALB/c mice were immunized with the receptor ectodomain.hIgGFc fusion protein with Ribi adjuvant, and then boosted with 20 μg antigen ten days and fifteen days later. Three to four days after a final boosting, mouse B cells were fused with SP2/O-Ag 14 cells. Hybridoma supernatants were screened, as previously described (31). Positive wells were then screened in FACS using 293F cells transiently transfected with expression plasmids encoding full-length human Dectin-1 (hDectin-1) cDNAs. Selected hybridomas were single cell cloned and expanded in CELLine flasks (Integra, CA). mAbs were purified by HPLC using MabSelect resin (GE Healthcare).

Characterization of anti-hDectin-1 mAb

Mock, 293F cells and 293F cells transfected with full length of hDectin-1 were stained with different concentrations of Alexa fluor 488-labeled anti-hDectin-1 or control mAbs. Anti-hDectin-1 mAb was also titrated by ELISA using plates coated with 2 μg/ml recombinant hDectin-1-Fc (BIIR) or hIgG-Fc (BIIR). Anti-human IgG (Fab)-AP was used as detection antibody.

Epitopes of anti-hDectin-1 mAb were characterized by ELISA using polyethylene pins attached with 15-mer peptides overlapping 11 amino acids (Mimotopes, CA). Experiments were performed as per the manufacturer’s protocol. We tested whether β–glucans could inhibit the binding of anti-hDectin-1 mAb to hDectin-1. 100 μg/ml soluble curdlan or 10 mg/ml laminarin were pre-incubated in plates coated with hDectin-1 for 20 min, and then different concentrations of anti-hDectin-1 mAb were added into the plates. Anti-hDectin-1 mAb was detected by anti-human IgG (Fab)-AP in ELISA.

Immunofluorescence

Human abdominal skins were obtained from healthy donors who underwent cosmetic surgeries at Baylor University Medical Center, according to Institutional Review Board guidelines. Cryo-sections were fixed in cold acetone, dried and blocked for non-specific fluorescence with Fc Receptor Block and Background Buster (Innovex, CA). Sections were then incubated in either anti-hDectin-1 or isotype antibodies labeled with Alexa fluor 568 (Molecular Probes). Sections were blocked with mouse serum and incubated in anti-CD1c-Alexa fluor 647, anti-CD1a-FITC, and anti-CD207-Alexa fluor 488, then subsequently stained with DAPI (Molecular Probes). Digital images were taken using an Olympus BX51 with a Planapo20/0.7 or Planapo40/0.95 objective, a Roper Coolsnap HQ camera and Metamorph software (Molecular Devices, CA). Images were acquired using the same exposures for antibody and isotype staining and identical scaling was applied. Confocal images were taken with the Leica SP1 and Planapo63/1.32 objective.

Dendritic cells and T cells

Peripheral blood mononuclear cells (PBMCs) of HLA-A*0201+ healthy volunteers were fractionated by elutriation, according to Institutional Review Board guidelines. IL-4DCs and IFNDCs were prepared from monocytes, as previously described (32). Total CD8+ T cells were purified using enrichment kits (StemCell, CA). Naïve CD8+ T cells (CD45RA+CD45RO−) (purity>99.2%) were purified by FACS Aria (BD Biosciences).

DC activation

For DC activation, 1–2×105 DCs/well in RPMI (Gibco, CA) containing 10% human AB serum (GemCell, CA), penicillin/streptomycin (Gibco), HEPES (Gibco), sodium pyruvate (Sigma), and glutamate (Sigma), were cultured in 96-well plates with anti-hDectin-1 or control IgG mAbs (10 μg/ml) for 18h. DCs were stained with the antibodies indicated and the expression levels of costimulatory molecules were measured by flow cytometry (FACS Calibur, BD Biosciences). 40 μg/ml piceatannol, 100 ng/ml E. coli LPS, or 100 μg/ml curdlan was added into the cultures indicated. For the experiments testing DC activation by combinations of anti-hDectin-1 mAb and LPS, 1 ng/ml LPS from E. coli was used. This concentration of LPS was determined by measuring cytokines and chemokines secreted from DCs cultured with different concentrations of LPS in the presence or absence of 10 μg/ml anti-hDectin-1 mAb. Culture supernatants were quantitated for IL-6, IL-10, IL-12p40, TNFα, IL-1β, and MCP-1 using the BeadLyte cytokine assay kit (Upstate, MA) as per the manufacturer’s protocol.

CD8+ T cell responses

5×103 IFNDCs were co-cultured with 1–2×105 CD8+ T cells for 8–10 days in the presence of IL-2 (20 units/ml). DCs were loaded with recombinant proteins and peptides, as indicated, for at least 6h, and then washed twice. On day 8 or 10, cells were stained with anti-CD8, anti-granzyme B, anti-perforin antibodies, and tetramers. 5h 51Cr release assays were performed using T2 cells loaded with different concentrations of peptides (Flu M158–66 and MART-126–35) (33). The cytotoxicity of MART-1-specific CD8+ T cells was also measured using cell lines (Mel290 and K562) that were grown in RPMI medium containing 10% FCS (GemCell, CA), penicillin/streptomycin, HEPES, sodium pyruvate, and glutamate.

Expression and purification of chimeric mouse/human recombinant mAbs

A chimeric anti-hDectin-1 mAb containing IgG4 heavy (H) chain with two site mutations (S228P and L235E) was generated (34). The presence of the two mutations abrogated residual non-specific binding capacity of mAbs to Fc receptors (34). cDNA from total RNA was synthesized using a SMART RACE kit (BD Biosciences) and amplified with universal 5′ primers and isotype-specific 3′ primers (mIgGκ, 5′ggatggtgggaagatggatacagttggtgcagcatc3′; mIgG2a for mAb clone 15E2, 5 ′ ctggacagggatccagagttccaggtcaaggtcactggc3′; mIgG1 for mAb clone 11 B 6, 5′gtcactggctcagggaaatagcccttgaccaggcatc3′) (Operon Biotechnologies, CA). PCR products were then cloned (pCR2.1 TA kit, Invitrogen) and characterized by DNA sequencing (MC Lab, CA). Using the derived sequences for the mouse H and light (L) chain variable (V)-regions, gene-specific primers were designed with flanking restriction sites (BglII and ApaI for HV and Xho and NotI for LV) and used to PCR amplify the entire V-regions for cloning into expression vectors that were previously engineered to encode constant regions of human IgGκ (aa106–214 of BC095489) or IgG4H (aa126–445 of AAH25985) flanked with Xho I and NotI or ApaI and NotI, respectively. For the L chains the end of the coding sequence was followed immediately by the stop codon/NotI site whereas for the heavy chain an NheI site was inserted before the stop codon/NotI site to facilitate fusion of an antigen cassette that contains SpeI at the 5′ end and a stop codon-NotI at the 3′ end. The control human IgGκ sequence corresponds to gi|49257887| residues 26–85 and gi|21669402| residues 67–709. The control human IgG4 H vector encodes for the full-length protein of AAH25985 with S228P and L235E substitutions (34).

Expression and purification of recombinant fusion proteins

Mammalian cell vectors directing the secretion of chimeric mouse anti-hDectin-1mAb variable regions fused to human IgG4 H and L chain constant regions were engineered with unique Nhe I – Not I sites at the H chain C terminus. Clostridium thermocellum dockerin (Doc) and cohesin (Coh) coding sequences were cloned in frame with the H chain C-terminus, as were several antigen-coding sequences.

Recombinant proteins were produced using the FreeStyle™ 293 Expression System (Invitrogen), according to the manufacturer’s protocol. Culture supernatants were purified via protein A affinity chromatography. Cohesin-antigen fusion proteins (Coh-Flu M1 and Coh-MART-126–35 (27L)) were also expressed using the system described above, but were purified via Q Sepharose chromatography followed by Ni2+ chelating chromatography. Endotoxin levels were less than 0.2 units/ml.

Anti-hDectin-1 mAb and antigen conjugates

Recombinant mAb-antigen conjugates were formed by mixing mAb. Doc fusion proteins with 2 molar equivalents of Coh. antigen fusion proteins in PBS 1X with Ca2+ and Mg2+ (Biosources). The dockerin (Doc) and cohesion (Coh) domains self-associate to form a stable and specific complex.

Statistical Analysis

Statistical significance of the difference between experimental variables was determined using the Student’s t-test and significance was set at P<0.05.

Results

Characterization of anti-hDectin-1 mAb

Anti-hDectin-1 mAb were generated in this study. The specificity of anti-hDectin-1 mAb (clone 15E2 [IgG2aκ]) was tested by staining 293F cells transfected with a full-length hDectin-1 expression vector (Fig. 1A). It did not stain 293F cells transfected with human DC-specific intracellular adhesion molecule-3 grabbing non-integrin (DC-SIGN), DEC- 205, Lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1), or ITIM-containing DC immunoreceptor (DCIR) (data not shown). The binding capacity of anti-hDectin-1 (clone 15E2) was further demonstrated by staining hDectin-1-transfectants with different concentrations of anti-hDectin-1 (15E2) versus isotype control mAb (Fig. 1B). Anti-hDectin-1 mAb (15E2) recognized hDectin-1-Fc, but not IgG-Fc (Fig. 1C).

FIGURE 1.

FIGURE 1

Characterization of anti-hDectin-1 mAb. A, 293F-hDectin-1 transfectants and 293F cells were stained with 1 μg/ml Alexa fluro 488-labeled anti-hDectin-1 mAb (15E2) or isotype control mAb. B, 293F-hDectin-1 transfectants were stained with different concentrations of FITC-labeled anti-hDectin-1 (15E2) or isotype control mAbs. C, Binding capacity of anti-hDectin-1 mAb to soluble hDectin-1 molecules. ELISA was performed in the plates coated with soluble recombinant hDectin-1-Fc or control Fc. D, Epitopes for anti-hDectin-1 mAbs (15E2) were characterized by ELISA using gear-bound peptides (15-mers overlapping by 11 amino acids). E, Amino acid sequence of hDectin-1: transmembrane domain (gray), epitopes of clone 15E2 (red), and a putative β-glucan binding sites (blue). F, Binding capacity of anti-hDectin-1 mAb to soluble hDectin-1 molecules in the presence of 100 μg/ml curdlan or 10 mg/ml laminarin.

Epitopes of anti-hDectin-1 mAb were characterized by using gear-bound peptides (thirty 15-mers overlapping by 11 amino acids) derived from the ectodomain of hDectin-1. Fig. 1D shows that the anti-hDectin-1 recognized two overlapping peptides, pep19143–157 and pep20147–162 that are located within the lectin domain of hDectin-1 mAb (Fig. 1E), but do not overlap with the putative β-glucan binding site (Trp221/His223) (35, 36). Neither curdlan nor laminarin did inhibit the binding of anti-hDectin-1 mAb (15E2) to hDectin-1 molecules (Fig. 1F).

Anti-hDectin-1 mAb binds to both in vitro and in vivo DCs

Peripheral blood mononuclear cells (PBMCs) from healthy donors were stained with anti-hDectin-1 mAb (clone 15E2) and antibodies specific for cell surface markers. Fig. 2A shows that myeloid DCs (mDCs) (Lin-CD123−HLA-DR+CD11c+), CD14+ monocytes, and CD19+ B cells (but not CD3+ cells) expressed Dectin-1. In vitro monocyte-derived IL-4DCs and IFNDCs (32) also expressed Dectin-1 (Fig. 2B).

FIGURE 2.

FIGURE 2

Blood mDCs, in vitro monocyte-derived DCs and skin dermal DCs, but not LCs, express Dectin-1. A, PBMCs from healthy donors were stained with 1 μg/ml FITC- labeled anti-hDectin-1 mAb (15E2) and antibodies specific for cell surface markers. mDCs were gated on Lin-CD123-HLA-DR+CD11c+ cells. B, IL-4DCs and IFNDCs were stained with 1 μg/ml FITC-labeled anti-hDectin-1 mAb. C, Frozen skin sections were stained with anti-Langerin, anti-CD1c, anti-hDectin-1 mAb. D, Skin sections were stained with anti-CD1a, anti-CD1c, and anti-hDectin-1 mAb. Confocal images were acquired with the Leica SP1 and Planapo63/1.32 objective.

We next tested the expression levels of Dectin-1 on human skin DC subsets by immunofluorescent staining. Human abdominal skin sections from healthy donors who underwent cosmetic surgeries were stained with anti-hDectin-1 mAb, anti-CD1c, and anti-Langerin mAbs. Fig. 2C shows that anti-hDectin-1 mAb mainly bound to CD1c+ dermal cells but not to Langerin+ epidermal Langerhans cells (LCs). To further characterize Dectin-1-expressing cells in the skin, sections were stained with combinations of anti-hDectin-1, anti-CD1c, and anti-CD1a mAbs. Fig. 2D demonstrates that CD1a+ cells only in the dermis, but not the epidermis, express Dectin-1. Tissue sections were also stained with DAPI and isotype control antibodies (Supplemental Fig. 1). Thus, we conclude that dermal CD1c+ DCs and CD1a+ DCs, but not epidermal LCs, express significant levels of Dectin-1.

Anti-hDectin-1 mAb activates both IL-4DCs and IFNDCs

Monocyte-derived IL-4DCs cultured with anti-hDectin-1 mAb (15E2) expressed increased levels of costimulatory molecules, CD86, CD80, and CD40, and HLA-DR (upper panels in Fig. 3A). Similar expression levels of these costimulatory molecules were observed on IL-4DCs stimulated with curdlan and LPS from E. coli (middle and lower panels in Fig. 3A). CD137L expression was upregulated by both curdlan and LPS, but not anti-hDectin-1 mAb.

FIGURE 3.

FIGURE 3

Anti-hDectin-1 mAb (15E2) activates monocyte-derived IL-4DCs. A, IL-4DCs were stimulated with 10 μg/ml anti-hDectin-1 mAb or isotype-matched control mAb overnight (upper panel). IL-4DCs were also cultured in the presence of 100 μg/ml curdlan (middle panel) and 100 ng/ml E. coli LPS (lower panel). DCs were stained for CD86, CD80, CD40, HLA-DR, and CD137L. Three independent experiments using cells from different healthy donors gave in similar results. B, Cytokines and chemokines in the culture supernatants were measured by Luminex. Error bars are SD of triplicates in three independent experiments. C, IL-4DCs were stimulated with 10 μg/ml anti-hDectin-1 mAb overnight in the presence of piceatannol (40 μg/ml). Expression levels of CD86 and the amounts of secreted IL-6 and MCP-1 were measured. Error bars are SD of triplicates from two independent experiments using cells from four healthy donors. D, IL-4DCs were cultured overnight in the presence of 10 μg/ml anti-hDectin-1, 1 ng/ml E. coli LPS, or combination of anti-hDectin-1 and LPS from E. coli. Cytokines and chemokines in the culture supernatants were measured. Error bars represent SD of triplicates from two independent experiments using cells from two healthy donors.

IL-4DCs activated with anti-hDectin-1 mAb (15E2) secreted increased amounts of IL-6, IL-10, IL-12p40, IL-1β, and MCP-1 (Fig. 3B). In addition, anti-hDectin-1 mAb alone could induce DCs to secrete significant amount of TNFα. DCs stimulated with curdlan, a polymer of β-glucan, produced higher levels of cytokines and chemokines than DCs activated with anti-hDectin-1 mAb. However, curdlan and anti-hDectin-1 mAb induced DCs to secrete the same cytokines and chemokines (Supplemental Fig. 2). E. coli LPS was used as a control. Curdlan induced higher levels of IL-1β and IL-6 secretion from IL-4DCs than E. coli LPS. 100μg/ml curdlan and 100 ng/ml LPS from E. coli induced DCs to secrete maximum amounts of cytokines and chemokines in dose titration experiments (data not shown).

In the presence of the Syk inhibitor, piceatannol, anti-hDectin-1 mAb (15E2) did not efficiently activate DCs. Fig. 3C (upper panel) presents the expression levels of CD86 on DCs stimulated with anti-hDectin-1 mAb in the presence or absence of piceatannol. Piceatannol also inhibited IL-6 and MCP-1 secretion by DCs activated with anti-hDectin-1 mAb (lower panels in Fig. 3C), suggesting that anti-hDectin-1-mediated DC activation is mainly dependent on the Syk-mediated signaling pathway (3, 12). Control IgG2a resulted in low levels of IL-6 and MCP-1 secretion, presumably through Fc receptors. This was also syk-dependent. However, the activation of DCs by anti-hDectin-1 mAb was mainly through hDectin-1 expressed on DCs.

Anti-hDectin-1 mAb could synergize with E. coli LPS (Fig. 3D). The optimal synergistic concentration of LPS used in this experiment (1 ng/ml) was determined by testing different concentrations of LPS with 10 μg/ml anti-hDectin-1 mAb. Combinations of anti-hDectin-1 mAb and LPS induced IL-4DCs to secrete increased levels of cytokines and chemokines, including IL-10, IL-12p40, TNFα, and IL-1β.

We next tested whether anti-hDectin-1 mAb could further activate IFNDCs that express higher levels of costimulatory molecules than IL-4DCs. Fig. 4A shows that anti-hDectin-1 mAb activated IFNDCs to upregulate the expression levels of costimulatory molecules, CD86, CD80, and CD40, and HLA-DR. IFNDCs stimulated with anti-hDectin-1 mAb also upregulated CD137L (4-1BBL), which is a T cell costimulatory molecule (37). Anti-hDectin-1 mAb induced IFNDCs to secrete IL-6, IL-10, IL-12p40, TNFα, and IL-1β (Fig. 4B). The amounts of cytokines and chemokines secreted from IFNDCs stimulated with curdlan and E. coli LPS are presented in Supplemental Fig. 3. Fig. 4C shows that combinations of anti-hDectin-1 mAb and E. coli LPS stimulated DCs to secrete increased levels of IL-6 and TNFα, but not IL-10 or IL-12p40. Combinations of anti-hDectin-1 mAb and LPS did not further enhance the expression levels of costimulatory molecules in DCs activated with either LPS or anti-hDectin-1 mAb (data not shown).

FIGURE 4.

FIGURE 4

Anti-hDectin-1 mAb (15E2) activates monocyte-derived IFNDCs. A, IFNDCs were stimulated with 10 μg/ml anti-hDectin-1 mAb or isotype control mAb overnight (upper panel). IFNDCs were also cultured overnight in the presence of 100μg/ml curdlan (middle panel) or 100 ng/ml LPS from E. coli (lower panel). DCs were stained for CD86, CD80, CD40, HLA-DR, and CD137L. Three independent experiments using cells from different donors yielded in similar results. B, Cytokines and chemokines in the culture supernatants. Error bars represent SD of three independent experiments with duplicate assays. C, IFNDCs were cultured overnight in the presence of 10 μg/ml anti-hDectin-1, 1 ng/ml LPS from E. coli, or a combination of anti-hDectin-1 and LPS from E. coli. Cytokines and chemokines in the culture supernatants were measured. Error bars represent SD of two independent experiments with triplicate assays using cells from two healthy donors.

Taken together, anti-hDectin-1 mAb (15E2) can activate DCs in a Syk-dependent manner, resulting in the enhanced surface expression of costimulatory molecules and secretion of multiple cytokines and chemokines. Anti-hDectin-1 and E. coli LPS synergize to activate DCs.

IFNDCs activated with anti-hDectin-1 mAb enhance the induction and activation of antigen-specific CD8+ T cell responses

We tested whether DCs activated with anti-hDectin-1 mAb (15E2) could enhance antigen-specific CD8+ T cell responses. We used IFNDCs, which possess a potent capacity for inducing T cell responses (32). IFNDCs also express Langerin, a marker of LCs that possess a specialized function for priming CD8+ T cell responses (38). Fig. 5A shows that IFNDCs stimulated with anti-hDectin-1 mAb (15E2) were more potent than IFNDCs stimulated with control mAb in priming of MART-1-specific CD8+ T cells. Data from two independent experiments using cells from four HLA-A*0201+ healthy donors are summarized in the right panel of Fig. 5A. DCs activated with curdlan or anti-hDectin-1 resulted in similar levels of MART-1-specific CD8+ T cell responses (Supplemental Fig. 4). In addition to the enhanced priming of MART-1-specific CD8+ T cells, IFNDCs activated with anti-hDectin-1 mAb induced greater numbers of MART-1-specific CD8+ T cells that express granzyme B than IFNDCs stimulated with control IgG2a (Fig. 5B). Activation of IFNDCs by anti-hDectin-1 mAb also increased the numbers of tetramer+perforin+ CD8+ T cells. The right panels in Fig. 5B summarize the data from six independent experiments.

FIGURE 5.

FIGURE 5

IFNDCs activated by anti-hDectin-1 mAb resulted in enhanced naïve and memory CD8+ T cell responses. A, IFNDCs stimulated with anti-hDectin-1 mAb (15E2) or control IgG2a were loaded with 10 μM of MART-126–35 (27L) peptide and then co-cultured with purified naïve CD8+ T cells for 10 days in the presence of IL-2 (20 units/ml). Cells were then stained with anti-CD8 and tetramer. Data from two separate experiments using cells from 4 healthy donors are summarized in the right panel. B, Cells from (A) were stained with anti-CD8 mAb and tetramer first, and then with anti-granzyme B and anti-perforin antibodies. 7-AAD+ cells were gated out. Data from six independent experiments using cells from different healthy donors are summarized. C, IFNDCs stimulated with anti-hDectin-1 mAb (15E2) or control IgG2a were loaded with 10 nM of Flu M158–66 peptide for 2h, and then co-cultured with purified autologous CD8+ T cells for 8 days in the presence of IL-2. Cells were then stained with anti-CD8 and tetramer. Data from two independent experiments with five healthy donors are summarized in the right panel. D, A 5h 51Cr release assay was performed using T2 cells loaded with 1 and 10 nM of Flu M158–66 peptide. Cells tested in Fig. 5 were from HLA- A*0201+ healthy donors. P values were tested by the student t-test.

Anti-hDectin-1-mediated activation of IFNDCs also significantly enhanced Flu M158–66 peptide-specific CD8+ T cell responses (Fig. 5C). Data from two independent experiments using cells from five HLA-A*0201+ healthy donors are summarized in the right panel of Fig. 5C. Flu M158–66 peptide-specific CD8+ T cells elicited by IFNDCs activated with anti-hDectin-1 mAb efficiently killed target cells loaded with low concentrations of Flu M158–66 peptides (1 to 10 nM) (Fig. 5D).

Taken together, activation of DCs via Dectin-1 with anti-hDectin-1 mAb significantly enhanced antigen-specific naive and memory CD8+ T cell responses.

IFNDCs loaded with conjugates of anti-hDectin-1-MART-1 peptide cross-prime MART-1-specific CD8+ T cells

Conjugates of mAbs and MART-1 peptide26–35 (27L) were made by employing protein-protein interaction modules from C. thermocellum to link separately expressed recombinant antibodies and antigens. Coh and Doc are cellulosome protein domains that interact non-covalently with high affinity and specificity (39). Anti-hDectin-1 mAb (15E2) was engineered as a chimera containing mouse V-region15 and human IgG4 Fc with two mutations (S228P and L235E) to eliminate residual low-level binding of IgG4 to Fc receptors (34). Conjugates of anti-hDectin-1 mAb and MART-1 also activated DCs to upregulate costimulatory molecules as well as cytokine and chemokine secretion from DCs (data not shown).

Fig. 6A shows that IFNDCs loaded with 1 or 5μg/ml conjugates of anti-hDectin-1-MART-126–35(27L) induced significant numbers of MART-1-specific CD8+ T cells, whereas IFNDCs loaded with the same amounts of IgG4 conjugates resulted in lower levels of MART-1-specific CD8+ T cell responses, especially at the 1 μg/ml dose. This suggests that the conjugates of anti-hDectin-1 mAb can target hDectin-1 molecules expressed on DCs, resulting in enhanced CD8+ T cell responses. Fig. 6B summarizes the data from experiments using cells from ten HLA-A*0201+ healthy donors and also shows that not all the experiments resulted in similar levels of MART-1-specific CD8+ T cell responses. Five experiments resulted in almost no or a little expansion of MART-1- specific CD8+ T cells even when DCs were loaded with 5μg/ml anti-hDectin-1-MART-1 conjugates. This might be related either to the expression levels of hDectin-1 on DCs, or to the frequency of MART-1-specific CD8+ T cell precursors, or to the intrinsic proliferative and effector function of MART-1-specific CD8+ T cells.

FIGURE 6.

FIGURE 6

IFNDCs loaded with conjugates of anti-hDectin-1 and MART-1 peptide26–35 (27L) can cross-prime MART-1-specific CD8+ T cells. A, Purified naïve CD8+ T cells were co-cultured with IFNDCs loaded with conjugates (as indicated) for 10 days in the presence of IL-2 (20 units/ml). Cells from four wells in each group were combined into one well before staining with anti-CD8 antibody and tetramer. B, Data from experiments using cells from ten healthy donors are presented. C, CD8+ T cells were stained with tetramer, anti-granzyme B, and anti-perforin antibodies. D. Data from four independent experiments using cells from four healthy donors are presented. E, A 5h 51Cr-release assay was performed using T2 cells loaded with 10 μM of MART-1 peptide26–35. Error bars are SD of triplicate assays in two independent experiments. F, A 5h 51Cr-release assay using a melanoma cell line (Mel290) and a control cell line (K562). Error bars indicate SD of triplicates. All cells tested in Fig. 6 were from HLA-A*0201+ healthy donors. 7-AAD+ cells were gated out in A and B. P values were calculated by the student t-test.

CD8+ T cells induced by targeting antigens to DCs via hDectin-1 were stained with tetramer, anti-granzyme B, and anti-perforin antibodies. Fig. 6C shows that anti-hDectin- 1-MART-126–35 (27L) conjugates resulted in a higher percentage of tetramer+granzyme B+ CD8+ T cells (1.7%) than IgG4-MART-126–35 (27L) conjugates (0.05%). Anti-hDectin-1 conjugates also induced a higher percentage of tetramer+ perforin+ CD8+ T cells (2.9%) than IgG4 conjugates (0.5%). Fig. 6D summarizes the data from four independent experiments.

Consistent with the increased frequency of MART-1-specific CD8+ T cells and the percentages of granzyme B+CD8+ T cells, CD8+ T cells induced with anti-hDectin-1 conjugates, unlike CD8+ CTLs induced with IgG4 conjugates, efficiently killed MART-1 peptide-loaded target cells (Fig. 6E). Fig. 6F further demonstrates that the MART-1-specific CD8+ T cells induced with anti-hDectin-1 conjugates killed MART-1-expressing tumor cells, Mel 290, but not the control cell line, K562. CD8+ CTL induced by control IgG4 conjugates did not kill Mel290 (data not shown).

Taken together, our data demonstrate that anti-hDectin-1 conjugates target hDectin-1 expressed on DCs, resulting in potent antigen-specific CD8+ T cell responses. Moreover, those CD8+ T cells induced with anti-hDectin-1 conjugates were functional. In consideration of the actual amount of antigens delivered to DCs (less than 10 ng of MART-126–35 (27L) in 1 μg anti-hDectin-1 conjugates), targeting antigens to DCs via hDectin-1 is an efficient way to cross-prime antigen-specific CD8+ T cells.

IFNDCs loaded with conjugates of anti-hDectin-1-Flu M1 protein activate Flu M1-specific CD8+ T cell responses

Conjugates of anti-hDectin-1 and Flu M1 protein were made, as described for MART-1 peptide26–35 (27L) conjugates. Fig. 7A shows that IFNDCs loaded with three different concentrations (0.5, 1, and 10 μg/ml) of anti-hDectin-1-Flu M1 conjugates resulted in significant levels of Flu M1-specific CD8+ T cell responses, as measured by staining cells with anti-CD8 and HLA-A*0201-Flu M158–66 peptide tetramer. In contrast, IFNDCs loaded with the same concentrations of control IgG4-Flu M1 conjugates resulted in lower levels of Flu M158–66 peptide-specific CD8+ T cell responses. This was particularly evident when IFNDCs were loaded with the low concentration (0.5 μg/ml) of IgG4-Flu M1 conjugates. This demonstrates that anti-hDectin-1-Flu M1 can target DCs via hDectin-1, resulting in potent Flu M1-specific CD8+ T cell responses. Fig. 7B summarizes the data from four independent experiments.

FIGURE 7.

FIGURE 7

Conjugates of anti-hDectin-1-Flu M1 protein can elicit potent Flu M1-specific CD8+ T cell responses. A, IFNDCs were loaded with different concentrations of conjugates, as indicated. Purified autologous CD8+ T cells were co-cultured for 8 days in the presence of IL-2 (20 units/ml). Cells were stained with anti-CD8 mAb and tetramer. 7-AAD+ cells were gated out. B, Data from four separate experiments using cells from HLA-A*0201+ healthy donors are summarized (10 μg/ml, P=0.0372; 1 μg/ml, P=0.0423; 0.5μg/ml, P=0.0155). Error bars indicate SD from four separate experiments. C, CD8+ T cells expanded with 1 μg/ml conjugates were stained with tetramer, anti-granzyme B, and anti-perforin antibodies. D, Data from three independent experiments using cells from three healthy donors are summarized. P values were calculated by the student t-test. E, 5h 51 Cr-release assays were performed using T2 cells loaded with different concentrations of Flu M158–66 peptide. All cells tested in Fig. 7 were from HLA-A*0201+ healthy donors.

To further characterize the CD8+ T cells expanded by targeting Flu M1 to DCs via Dectin-1, CD8+ T cells expanded with 1 μg/ml conjugates (actual amount of Flu M1: less than 100 ng) were stained with tetramer, anti-granzyme B, and anti-perforin antibodies (Fig. 7C). Anti-hDectin-1-Flu M1 resulted in a higher frequency of tetramer+granzyme B+ CD8+ T cells (3%) than IgG4-Flu M1 (1.3%). Anti-hDectin-1 conjugates also resulted in a higher frequency of tetramer+perforin+ CD8+ T cells (4.4%) than IgG4 conjugates (2.1%). Fig. 7D summarizes the data from three independent experiments.

Fig. 7E shows that Flu M158–66 peptide-specific CD8+ T cells expanded with either anti-hDectin-1-Flu M1 or IgG4-Flu M1 conjugates could kill 10 nM Flu M158–66 peptide-loaded target cells. However, only CD8+ T cells activated with anti-hDectin-1-Flu M1, but not with IgG4-Flu M1 conjugates, efficiently killed 1 nM peptide-loaded target cells. This suggests that CD8+ T cells activated with anti-hDectin-1 conjugates have higher functional avidity than those activated by IgG4 conjugates.

Taken together, our data demonstrate that IFNDCs captured antigens via hDectin-1 and that they can efficiently cross-present antigenic peptides to elicit functionally active antigen-specific CD8+ T cell responses.

Discussion

Generation of an agonistic anti-hDectin-1 mAb allowed us to test the intrinsic capacity of hDectin-1 expressed on DCs to induce and activate antigen-specific CD8+ T cell responses. We first characterized the biochemical and immunological functions of the agonistic anti-hDectin-1 mAb, and then further demonstrated that concomitant activation and antigen uptake via hDectin-1 could elicit potent antigen-specific CD8+ T cell responses.

Anti-hDectin-1 mAb (15E2) bound to both in vitro and in vivo DCs. It recognized the lectin domain of hDectin-1 (Glu143-Ile162 region), which is different from the binding site of β-glucans or that of the previously known mAb 4B2 (36, 40). Anti-Dectin-1 (4B2) does not activate APCs, inhibit β-glucan binding to Dectin-1 (36, 40). However, β-glucans did not inhibit the binding of anti-hDectin-1 mAb (15E2) to hDectin-1, suggesting that the pep19/20147–157 region within the lectin domain does not directly contribute to the ability of 8–10 unit polymeric β-glucans to bind hDectin-1 (35, 36).

As previously reported (41, 42), monocytes, blood mDCs, and B cells expressed significant levels of hDectin-1. Considering the functional specialty of DC subsets in eliciting different qualities of host immune responses (38, 43–46), we characterized in vivo DC subsets that express hDectin-1. A previous study performed by immunohistochemistry of mouse skin sections (22), showed that Dectin-1 was expressed on mouse dermal DCs, but not LCs. In contrast, another study (47) showed that epidermal CD1a+ cells in human skin expressed Dectin-1. However, our study demonstrated that CD1a+ cells in the dermis, but not the epidermis, express significant levels of hDectin-1. Furthermore, CD207+ LCs in the epidermis of healthy human skin did not express significant levels of hDectin-1. The majority of hDectin-1 expressing cells were dermal CD1c+, consistent with the data observed in mouse skin (22).

Anti-hDectin-1 mAb (15E2) activated DCs in a Syk-dependent manner. Both IL-4DCs and IFNDCs stimulated with anti-hDectin-1 mAb upregulated surface expression levels of costimulatory molecules and HLA-DR. Interestingly, only IFNDCs upregulated CD137L expression when they were stimulated with anti-hDectin-1 mAb. Although E. coli LPS and curdlan induced DCs to secrete higher levels of cytokines and chemokines than anti-hDectin-1 mAb, both IL-4DCs and IFNDCs expressed similar levels of costimulatory molecules and HLA-DR when they were stimulated with these three stimulators. In addition to IL-6, IL-10, IL-12p40, and MCP-1, anti-hDectin-1 mAb induced human monocyte-derived DCs to secrete significant amounts of TNFα. This is also seen in DCs stimulated with β-glucans (48). Cross-talk between different classes of pattern recognition receptors (PRRs) is a major component of signal integration for eliciting immune responses (49). Interactions of Dectin-1 with TLR2 were tested in murine models by zymosan (3), which contains both β-glucans and TLR2 ligands. In addition, synergistic effects of Dectin-1 and TLR4 were demonstrated in human primary monocytes and macrophages (50). Our data also demonstrated that hDectin-1 expressed on DCs cooperates with TLR4 to activate DCs. However, the results of IL-4DC activation by the combinations of anti-hDectin-1 mAb and LPS were not the same as those of IFNDC activation by the same combinations, suggesting that these signaling pathways are integrated differently in these DC subtypes. For example, the combination of anti-hDectin-1 mAb and LPS induced IL-4DCs to secrete increased levels of IL-1β, IL-10, IL-12p40, and TNFα. However, the same combination activated IFNDCs to secrete increased amounts of IL-6 and TNFα.

One of the major outcomes of DC activation by anti-hDectin-1 mAb was the enhancement of antigen-specific CD8+ T cell responses. IFNDCs activated with anti-hDectin-1 mAb (15E2) resulted in enhanced antigen-specific naïve and memory CD8+ T cell responses. This enhancement was due to both increased expansion of antigen-specific CD8+ T cells and increased functional activity of antigen-specific CD8+ T cells. This is consistent with the increased expression of granzyme B in CD8+ T cells that are induced with anti-hDectin-1-activated DCs. In addition, our data (Fig. 7E) demonstrated that anti-hDectin-1 conjugates elicit high avidity CD8+ T cells. Functional avidity of effector CD8+ T cells is one of the major factors that could determine the efficacy of vaccines against cancers and infections (51, 52).

A previous study has shown that mice immunized with conjugates of anti-Dectin-1 and OVA generated strong CD4+ T cell responses but weak CD8+ T cell responses (22). In contrast, another study showed that mouse DCs activated with β-glucans resulted in CD8+ T cell priming (30). Data from those two studies suggested that antigens delivered to DCs via hDectin-1 could efficiently induce and activate antigen-specific CD8+ T cell responses when the DCs are properly activated. In this study, we demonstrated that delivering antigens to IFNDCs via hDectin-1 with concomitant activation of DCs could efficiently induce and activate functionally active antigen-specific CD8+ T cells. The immense potential of DC-targeting vaccines has been well described (53). Our data suggest that the agonistic anti-hDectin-1 mAb tested in this study could be useful for generating future human vaccines.

Combination of anti-hDectin-1 and TLR agonists further enhanced the activation of DCs, but it did not result in enhanced antigen-specific CD8+ T cell responses (data not shown). Blocking IL-10 with anti-IL-10 and anti-IL-10R antibodies did not enhance anti-hDectin-1-mediated MART-1-specific CD8+ T cell responses (data not shown), in agreement with a previous study (54). Considering the potential roles of Dectin-1-mediated signaling in the expansion of Th17 cells (3, 14, 21, 22, 48, 55) and the beneficial roles of Th17 cells in cellular immunity (27, 56–63), CD8+ T cell responses elicited by DCs activated with combinations of anti-hDectin-1 and TLR agonists need to be further tested in the context of antigen-specific CD4+ T cell responses. Recent studies have shown that Th17 CD4+ T cells play significant roles in mounting CD8+ T cell-mediated immunity (27, 56–63).

In conclusion, this study demonstrates that Dectin-1 expressed on human DCs possesses a potent capacity for enhancing antigen-specific CD8+ T cell responses. Data from this study will help us not only to understand the mechanisms of host immune defense against fungal and mycobacterial infections but also to design new vaccine strategies against those infections.

Supplementary Material

Supp. Figures

Acknowledgments

We thank Elizabeth Kowalski and Sebastien Coquery in the FACS Core, Lynnette Walters in the Cell Processing Core, and Cindy Samuelsen in Administration Office at BIIR. We thank Drs. Carson Harrod (BIIR) and Maryna Eichelberger (FDA, USA) for critical reading of this manuscript. We also thank Dr. Michael Ramsay for supporting this study.

This work was supported by U19 AI057234 (NIH), RO1 CA078846 (NIH) and BHCS Foundation. JB holds the W.W. Caruth, Jr. Chair for Transplantation Immunology Research.

Abbreviations in this paper

mAb

monoclonal Ab

DCs

dendritic cells

PBMCs

peripheral blood mononuclear cells

Syk

spleen tyrosine kinase

LCs

Langerhans cells

References

  • 1.Pulendran B, Palucka K, Banchereau J. Sensing pathogens and tuning immune responses. Science. 2001;293:253–256. doi: 10.1126/science.1062060. [DOI] [PubMed] [Google Scholar]
  • 2.Kawai T, Akira S. Innate immune recognition of viral infection. Nat Immunol. 2006;7:131–137. doi: 10.1038/ni1303. [DOI] [PubMed] [Google Scholar]
  • 3.Brown GD. Dectin-1: a signalling non-TLR pattern-recognition receptor. Nat Rev Immunol. 2006;6:33–43. doi: 10.1038/nri1745. [DOI] [PubMed] [Google Scholar]
  • 4.Steinman RM, Banchereau J. Taking dendritic cells into medicine. Nature. 2007;449:419–426. doi: 10.1038/nature06175. [DOI] [PubMed] [Google Scholar]
  • 5.Geijtenbeek TB, Gringhuis SI. Signalling through C-type lectin receptors: shaping immune responses. Nat Rev Immunol. 2009;9:465–479. doi: 10.1038/nri2569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.van Vliet SJ, den Dunnen J, Gringhuis SI, Geijtenbeek TB, van Kooyk Y. Innate signaling and regulation of Dendritic cell immunity. Curr Opin Immunol. 2007;19:435–440. doi: 10.1016/j.coi.2007.05.006. [DOI] [PubMed] [Google Scholar]
  • 7.Tacken PJ, Torensma R, Figdor CG. Targeting antigens to dendritic cells in vivo. Immunobiology. 2006;211:599–608. doi: 10.1016/j.imbio.2006.05.021. [DOI] [PubMed] [Google Scholar]
  • 8.Taylor PR, Brown GD, Reid DM, Willment JA, Martinez-Pomares L, Gordon S, Wong SY. The beta-glucan receptor, dectin-1, is predominantly expressed on the surface of cells of the monocyte/macrophage and neutrophil lineages. J Immunol. 2002;169:3876–3882. doi: 10.4049/jimmunol.169.7.3876. [DOI] [PubMed] [Google Scholar]
  • 9.Taylor PR, Tsoni SV, Willment JA, Dennehy KM, Rosas M, Findon H, Haynes K, Steele C, Botto M, Gordon S, Brown GD. Dectin-1 is required for beta-glucan recognition and control of fungal infection. Nat Immunol. 2007;8:31–38. doi: 10.1038/ni1408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Rothfuchs AG, Bafica A, Feng CG, Egen JG, Williams DL, Brown GD, Sher A. Dectin-1 interaction with Mycobacterium tuberculosis leads to enhanced IL-12p40 production by splenic dendritic cells. J Immunol. 2007;179:3463–3471. doi: 10.4049/jimmunol.179.6.3463. [DOI] [PubMed] [Google Scholar]
  • 11.Herre J, Marshall AS, Caron E, Edwards AD, Williams DL, Schweighoffer E, Tybulewicz V, Reis e Sousa C, Gordon S, Brown GD. Dectin-1 uses novel mechanisms for yeast phagocytosis in macrophages. Blood. 2004;104:4038–4045. doi: 10.1182/blood-2004-03-1140. [DOI] [PubMed] [Google Scholar]
  • 12.Rogers NC, Slack EC, Edwards AD, Nolte MA, Schulz O, Schweighoffer E, Williams DL, Gordon S, Tybulewicz VL, Brown GD, Reis e Sousa C. Syk-dependent cytokine induction by Dectin-1 reveals a novel pattern recognition pathway for C type lectins. Immunity. 2005;22:507–517. doi: 10.1016/j.immuni.2005.03.004. [DOI] [PubMed] [Google Scholar]
  • 13.Gross O, Gewies A, Finger K, Schafer M, Sparwasser T, Peschel C, Forster I, Ruland J. Card9 controls a non-TLR signalling pathway for innate anti-fungal immunity. Nature. 2006;442:651–656. doi: 10.1038/nature04926. [DOI] [PubMed] [Google Scholar]
  • 14.Leibundgut-Landmann S, Gross O, Robinson MJ, Osorio F, Slack EC, Tsoni SV, Schweighoffer E, Tybulewicz V, Brown GD, Ruland J, Reis ESC. Syk- and CARD9-dependent coupling of innate immunity to the induction of T helper cells that produce interleukin 17. Nat Immunol. 2007;8:630–638. doi: 10.1038/ni1460. [DOI] [PubMed] [Google Scholar]
  • 15.Hara H, Ishihara C, Takeuchi A, Imanishi T, Xue L, Morris SW, Inui M, Takai T, Shibuya A, Saijo S, Iwakura Y, Ohno N, Koseki H, Yoshida H, Penninger JM, Saito T. The adaptor protein CARD9 is essential for the activation of myeloid cells through ITAM-associated and Toll-like receptors. Nat Immunol. 2007;8:619–629. doi: 10.1038/ni1466. [DOI] [PubMed] [Google Scholar]
  • 16.Goodridge HS, Shimada T, Wolf AJ, Hsu YM, Becker CA, Lin X, Underhill DM. Differential use of CARD9 by dectin-1 in macrophages and dendritic cells. J Immunol. 2009;182:1146–1154. doi: 10.4049/jimmunol.182.2.1146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Goodridge HS, Simmons RM, Underhill DM. Dectin-1 stimulation by Candida albicans yeast or zymosan triggers NFAT activation in macrophages and dendritic cells. J Immunol. 2007;178:3107–3115. doi: 10.4049/jimmunol.178.5.3107. [DOI] [PubMed] [Google Scholar]
  • 18.Dillon S, Agrawal S, Banerjee K, Letterio J, Denning TL, Oswald-Richter K, Kasprowicz DJ, Kellar K, Pare J, van Dyke T, Ziegler S, Unutmaz D, Pulendran B. Yeast zymosan, a stimulus for TLR2 and dectin-1, induces regulatory antigen-presenting cells and immunological tolerance. J Clin Invest. 2006;116:916–928. doi: 10.1172/JCI27203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Dennehy KM, Ferwerda G, Faro-Trindade I, Pyz E, Willment JA, Taylor PR, Kerrigan A, Tsoni SV, Gordon S, Meyer-Wentrup F, Adema GJ, Kullberg BJ, Schweighoffer E, Tybulewicz V, Mora-Montes HM, Gow NA, Williams DL, Netea MG, Brown GD. Syk kinase is required for collaborative cytokine production induced through Dectin-1 and Toll-like receptors. Eur J Immunol. 2008;38:500–506. doi: 10.1002/eji.200737741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Slack EC, Robinson MJ, Hernanz-Falcon P, Brown GD, Williams DL, Schweighoffer E, Tybulewicz VL, Reis e Sousa C. Syk-dependent ERK activation regulates IL-2 and IL-10 production by DC stimulated with zymosan. Eur J Immunol. 2007;37:1600–1612. doi: 10.1002/eji.200636830. [DOI] [PubMed] [Google Scholar]
  • 21.Weck MM, Appel S, Werth D, Sinzger C, Bringmann A, Grunebach F, Brossart P. hDectin-1 is involved in uptake and cross-presentation of cellular antigens. Blood. 2008;111:4264–4272. doi: 10.1182/blood-2006-10-051375. [DOI] [PubMed] [Google Scholar]
  • 22.Carter RW, Thompson C, Reid DM, Wong SY, Tough DF. Preferential induction of CD4+ T cell responses through in vivo targeting of antigen to dendritic cell-associated C-type lectin-1. J Immunol. 2006;177:2276–2284. doi: 10.4049/jimmunol.177.4.2276. [DOI] [PubMed] [Google Scholar]
  • 23.Acosta-Rodriguez EV, Rivino L, Geginat J, Jarrossay D, Gattorno M, Lanzavecchia A, Sallusto F, Napolitani G. Surface phenotype and antigenic specificity of human interleukin 17-producing T helper memory cells. Nat Immunol. 2007;8:639–646. doi: 10.1038/ni1467. [DOI] [PubMed] [Google Scholar]
  • 24.Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, Vega F, Yu N, Wang J, Singh K, Zonin F, Vaisberg E, Churakova T, Liu M, Gorman D, Wagner J, Zurawski S, Liu Y, Abrams JS, Moore KW, Rennick D, de Waal-Malefyt R, Hannum C, Bazan JF, Kastelein RA. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity. 2000;13:715–725. doi: 10.1016/s1074-7613(00)00070-4. [DOI] [PubMed] [Google Scholar]
  • 25.Acosta-Rodriguez EV, Napolitani G, Lanzavecchia A, Sallusto F. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Nat Immunol. 2007;8:942–949. doi: 10.1038/ni1496. [DOI] [PubMed] [Google Scholar]
  • 26.Khader SA, Bell GK, Pearl JE, Fountain JJ, Rangel-Moreno J, Cilley GE, Shen F, Eaton SM, Gaffen SL, Swain SL, Locksley RM, Haynes L, Randall TD, Cooper AM. IL-23 and IL-17 in the establishment of protective pulmonary CD4+ T cell responses after vaccination and during Mycobacterium tuberculosis challenge. Nat Immunol. 2007;8:369–377. doi: 10.1038/ni1449. [DOI] [PubMed] [Google Scholar]
  • 27.Lin Y, Ritchea S, Logar A, Slight S, Messmer M, Rangel-Moreno J, Guglani L, Alcorn JF, Strawbridge H, Park SM, Onishi R, Nyugen N, Walter MJ, Pociask D, Randall TD, Gaffen SL, Iwakura Y, Kolls JK, Khader SA. Interleukin-17 is required for T helper 1 cell immunity and host resistance to the intracellular pathogen Francisella tularensis. Immunity. 2009;31:799–810. doi: 10.1016/j.immuni.2009.08.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ariizumi K, Shen GL, Shikano S, Xu S, Ritter R, 3rd, Kumamoto T, Edelbaum D, Morita A, Bergstresser PR, Takashima A. Identification of a novel, dendritic cell-associated molecule, dectin-1, by subtractive cDNA cloning. J Biol Chem. 2000;275:20157–20167. doi: 10.1074/jbc.M909512199. [DOI] [PubMed] [Google Scholar]
  • 29.Engering A, Geijtenbeek TB, van Vliet SJ, Wijers M, van Liempt E, Demaurex N, Lanzavecchia A, Fransen J, Figdor CG, Piguet V, van Kooyk Y. The dendritic cell-specific adhesion receptor DC-SIGN internalizes antigen for presentation to T cells. J Immunol. 2002;168:2118–2126. doi: 10.4049/jimmunol.168.5.2118. [DOI] [PubMed] [Google Scholar]
  • 30.Leibundgut-Landmann S, Osorio F, Brown GD, Reis e Sousa C. Stimulation of dendritic cells via the dectin-1/Syk pathway allows priming of cytotoxic T-cell responses. Blood. 2008;112:4971–4980. doi: 10.1182/blood-2008-05-158469. [DOI] [PubMed] [Google Scholar]
  • 31.Bates EE, Fournier N, Garcia E, Valladeau J, Durand I, Pin JJ, Zurawski SM, Patel S, Abrams JS, Lebecque S, Garrone P, Saeland S. APCs express DCIR, a novel C-type lectin surface receptor containing an immunoreceptor tyrosine-based inhibitory motif. J Immunol. 1999;163:1973–1983. [PubMed] [Google Scholar]
  • 32.Blanco P, Palucka AK, Gill M, Pascual V, Banchereau J. Induction of dendritic cell differentiation by IFN-alpha in systemic lupus erythematosus. Science. 2001;294:1540–1543. doi: 10.1126/science.1064890. [DOI] [PubMed] [Google Scholar]
  • 33.Oh S, Terabe M, Pendleton CD, Bhattacharyy A, Bera TK, Epel M, Reiter Y, Phillips J, Linehan WM, Kasten-Sportes C, Pastan I, Berzofsky JA. Human CTL to wild type and enhanced epitopes of a novel prostate and breast tumor-associated protein, TARP, lyse human breast cancer cells. Cancer Research. 2004;64:2610–2618. doi: 10.1158/0008-5472.can-03-2183. [DOI] [PubMed] [Google Scholar]
  • 34.Reddy MP, Kinney CA, Chaikin MA, Payne A, Fishman-Lobell J, Tsui P, Dal Monte PR, Doyle ML, Brigham-Burke MR, Anderson D, Reff M, Newman R, Hanna N, Sweet RW, Truneh A. Elimination of Fc receptor-dependent effector functions of a modified IgG4 monoclonal antibody to human CD4. J Immunol. 2000;164:1925–1933. doi: 10.4049/jimmunol.164.4.1925. [DOI] [PubMed] [Google Scholar]
  • 35.Brown J, O’Callaghan CA, Marshall AS, Gilbert RJ, Siebold C, Gordon S, Brown GD, Jones EY. Structure of the fungal beta-glucan-binding immune receptor dectin-1: implications for function. Protein Sci. 2007;16:1042–1052. doi: 10.1110/ps.072791207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Adachi Y, Ishii T, Ikeda Y, Hoshino A, Tamura H, Aketagawa J, Tanaka S, Ohno N. Characterization of beta-glucan recognition site on C-type lectin, dectin 1. Infect Immun. 2004;72:4159–4171. doi: 10.1128/IAI.72.7.4159-4171.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Watts TH. TNF/TNFR family members in costimulation of T cell responses. Annu Rev Immunol. 2005;23:23–68. doi: 10.1146/annurev.immunol.23.021704.115839. [DOI] [PubMed] [Google Scholar]
  • 38.Klechevsky E, Morita R, Liu M, Cao Y, Coquery S, Thompson-Snipes L, Briere F, Chaussabel D, Zurawski G, Palucka AK, Reiter Y, Banchereau J, Ueno H. Functional Specializations of Human Epidermal Langerhans Cells and CD14(+) Dermal Dendritic Cells. Immunity. 2008 doi: 10.1016/j.immuni.2008.07.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Carvalho AL, Dias FM, Prates JA, Nagy T, Gilbert HJ, Davies GJ, Ferreira LM, Romao MJ, Fontes CM. Cellulosome assembly revealed by the crystal structure of the cohesin-dockerin complex. Proc Natl Acad Sci U S A. 2003;100:13809–13814. doi: 10.1073/pnas.1936124100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Bozzacco L, Trumpfheller C, Siegal FP, Mehandru S, Markowitz M, Carrington M, Nussenzweig MC, Piperno AG, Steinman RM. DEC-205 receptor on dendritic cells mediates presentation of HIV gag protein to CD8+ T cells in a spectrum of human MHC I haplotypes. Proc Natl Acad Sci U S A. 2007;104:1289–1294. doi: 10.1073/pnas.0610383104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Marshall AS, Willment JA, Lin HH, Williams DL, Gordon S, Brown GD. Identification and characterization of a novel human myeloid inhibitory C-type lectin-like receptor (MICL) that is predominantly expressed on granulocytes and monocytes. J Biol Chem. 2004;279:14792–14802. doi: 10.1074/jbc.M313127200. [DOI] [PubMed] [Google Scholar]
  • 42.Meyer-Wentrup F, Benitez-Ribas D, Tacken PJ, Punt CJ, Figdor CG, de Vries IJ, Adema GJ. Targeting DCIR on human plasmacytoid dendritic cells results in antigen presentation and inhibits IFN-alpha production. Blood. 2008;111:4245–4253. doi: 10.1182/blood-2007-03-081398. [DOI] [PubMed] [Google Scholar]
  • 43.Caux C, Vanbervliet B, Massacrier C, Dezutter-Dambuyant C, de Saint-Vis B, Jacquet C, Yoneda K, Imamura S, Schmitt D, Banchereau J. CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to GM-CSF+TNF alpha. J Exp Med. 1996;184:695–706. doi: 10.1084/jem.184.2.695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Maldonado-Lopez R, De Smedt T, Michel P, Godfroid J, Pajak B, Heirman C, Thielemans K, Leo O, Urbain J, Moser M. CD8alpha+ and CD8alpha-subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J Exp Med. 1999;189:587–592. doi: 10.1084/jem.189.3.587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Pulendran B, Smith JL, Caspary G, Brasel K, Pettit D, Maraskovsky E, Maliszewski CR. Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc Natl Acad Sci. 1999;96:1036–1041. doi: 10.1073/pnas.96.3.1036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Soares H, Waechter H, Glaichenhaus N, Mougneau E, Yagita H, Mizenina O, Dudziak D, Nussenzweig MC, Steinman RM. A subset of dendritic cells induces CD4+ T cells to produce IFN-gamma by an IL-12-independent but CD70-dependent mechanism in vivo. J Exp Med. 2007;204:1095–1106. doi: 10.1084/jem.20070176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Yokota K, Takashima A, Bergstresser PR, Ariizumi K. Identification of a human homologue of the dendritic cell-associated C-type lectin-1, dectin-1. Gene. 2001;272:51–60. doi: 10.1016/s0378-1119(01)00528-5. [DOI] [PubMed] [Google Scholar]
  • 48.Carmona EM, Vassallo R, Vuk-Pavlovic Z, Standing JE, Kottom TJ, Limper AH. Pneumocystis cell wall beta-glucans induce dendritic cell costimulatory molecule expression and inflammatory activation through a Fas-Fas ligand mechanism. J Immunol. 2006;177:459–467. doi: 10.4049/jimmunol.177.1.459. [DOI] [PubMed] [Google Scholar]
  • 49.Underhill DM. Collaboration between the innate immune receptors dectin-1, TLRs, and Nods. Immunol Rev. 2007;219:75–87. doi: 10.1111/j.1600-065X.2007.00548.x. [DOI] [PubMed] [Google Scholar]
  • 50.Ferwerda G, Meyer-Wentrup F, Kullberg BJ, Netea MG, Adema GJ. Dectin-1 synergizes with TLR2 and TLR4 for cytokine production in human primary monocytes and macrophages. Cell Microbiol. 2008;10:2058–2066. doi: 10.1111/j.1462-5822.2008.01188.x. [DOI] [PubMed] [Google Scholar]
  • 51.Alexander-Miller MA, Leggatt GR, Sarin A, Berzofsky JA. Role of antigen, CD8, and cytotoxic T lymphocyte (CTL) avidity in high dose antigen induction of apoptosis of effector CTL. J Exp Med. 1996;184:485–492. doi: 10.1084/jem.184.2.485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Oh S, Hodge JW, Ahlers JD, Burke DS, Schlom J, Berzofsky JA. Selective induction of high avidity CTL by altering the balance of signals from antigen presenting cells. J Immunol. 2003;170:2523–2530. doi: 10.4049/jimmunol.170.5.2523. [DOI] [PubMed] [Google Scholar]
  • 53.Steinman RM. Dendritic cells in vivo: a key target for a new vaccine science. Immunity. 2008;29:319–324. doi: 10.1016/j.immuni.2008.08.001. [DOI] [PubMed] [Google Scholar]
  • 54.Yang G, Hellstrom KE, Mizuno MT, Chen L. In vitro priming of tumor-reactive cytolytic T lymphocytes by combining IL-10 with B7-CD28 costimulation. J Immunol. 1995;155:3897–3903. [PubMed] [Google Scholar]
  • 55.Yoshitomi H, Sakaguchi N, Kobayashi K, Brown GD, Tagami T, Sakihama T, Hirota K, Tanaka S, Nomura T, Miki I, Gordon S, Akira S, Nakamura T, Sakaguchi S. A role for fungal {beta}-glucans and their receptor Dectin-1 in the induction of autoimmune arthritis in genetically susceptible mice. J Exp Med. 2005;201:949–960. doi: 10.1084/jem.20041758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Curtis MM, Way SS. Interleukin-17 in host defence against bacterial, mycobacterial and fungal pathogens. Immunology. 2009;126:177–185. doi: 10.1111/j.1365-2567.2008.03017.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Woodworth JS, Behar SM. Mycobacterium tuberculosis-specific CD8+ T cells and their role in immunity. Crit Rev Immunol. 2006;26:317–352. doi: 10.1615/critrevimmunol.v26.i4.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Lazarevic V, Flynn J. CD8+ T cells in tuberculosis. Am J Respir Crit Care Med. 2002;166:1116–1121. doi: 10.1164/rccm.2204027. [DOI] [PubMed] [Google Scholar]
  • 59.Bermejo-Martin JF, Ortiz de Lejarazu R, Pumarola T, Rello J, Almansa R, Ramirez P, Martin-Loeches I, Varillas D, Gallegos MC, Seron C, Micheloud D, Gomez JM, Tenorio-Abreu A, Ramos MJ, Molina ML, Huidobro S, Sanchez E, Gordon M, Fernandez V, Del Castillo A, Marcos MA, Villanueva B, Lopez CJ, Rodriguez-Dominguez M, Galan JC, Canton R, Lietor A, Rojo S, Eiros JM, Hinojosa C, Gonzalez I, Torner N, Banner D, Leon A, Cuesta P, Rowe T, Kelvin DJ. Th1 and Th17 hypercytokinemia as early host response signature in severe pandemic influenza. Crit Care. 2009;13:R201. doi: 10.1186/cc8208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.McKinstry KK, Strutt TM, Buck A, Curtis JD, Dibble JP, Huston G, Tighe M, Hamada H, Sell S, Dutton RW, Swain SL. IL-10 deficiency unleashes an influenza-specific Th17 response and enhances survival against high-dose challenge. J Immunol. 2009;182:7353–7363. doi: 10.4049/jimmunol.0900657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Chandran SS, Verhoeven D, Teijaro JR, Fenton MJ, Farber DL. TLR2 engagement on dendritic cells promotes high frequency effector and memory CD4 T cell responses. J Immunol. 2009;183:7832–7841. doi: 10.4049/jimmunol.0901683. [DOI] [PubMed] [Google Scholar]
  • 62.Hamada H, Garcia-Hernandez Mde L, Reome JB, Misra SK, Strutt TM, McKinstry KK, Cooper AM, Swain SL, Dutton RW. Tc17, a unique subset of CD8 T cells that can protect against lethal influenza challenge. J Immunol. 2009;182:3469–3481. doi: 10.4049/jimmunol.0801814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Martin-Orozco N, Muranski P, Chung Y, Yang XO, Yamazaki T, Lu S, Hwu P, Restifo NP, Overwijk WW, Dong C. T helper 17 cells promote cytotoxic T cell activation in tumor immunity. Immunity. 2009;31:787–798. doi: 10.1016/j.immuni.2009.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp. Figures

RESOURCES