NtcA Regulates patA Expression in Anabaena sp. Strain PCC 7120

Abstract

patA expression is induced 3 to 6 h after nitrogen step-down. We establish that the transcription of patA is under the positive control of NtcA. The patA promoter region shows two conserved NtcA-binding boxes. These NtcA-binding sites and their interaction with NtcA are key elements for patA expression in heterocysts.

In response to nitrogen deficiency, the filamentous cyanobacterium Anabaena sp. strain PCC 7120 develops the heterocyst, a terminally differentiated cell type, specialized in the fixation of atmospheric nitrogen (9). Two major regulators control this differentiation program (NtcA and HetR) (1, 2). The accumulation of 2-oxoglutarate (2-OG) is the intracellular signal initiating the cell differentiation process; at a threshold concentration of about 0.1 mM, 2-OG stimulates the binding activity of NtcA toward its target promoters (3).

Additional factors are involved to ensure periodic heterocyst patterning (10). Among these factors, PatA has been shown to positively influence heterocyst formation. The patA mutant differentiates heterocysts mostly at the ends of the filaments, suggesting that the PatA protein must be required for the formation of intercalary heterocysts (5). Since the patA gene is transcribed most abundantly when Anabaena copes with combined nitrogen starvation, it has been suggested that its expression may be under the control of a regulator related to the initiation of heterocyst differentiation (4, 5). Here we confirm this assumption and demonstrate that the transcription of patA is under the direct control of NtcA.

Expression of patA and analysis of its promoter organization.

Total RNAs were isolated from Anabaena cells induced for heterocyst formation for 0, 2, 6, 12, and 18 h under nitrogen starvation. Transcription of patA was analyzed by semiquantitative reverse transcription-PCR (RT-PCR) as described previously (9) or by fusion to the green fluorescent protein (GFP). Expression of the rnpB gene was used as a control. RNA preparations were treated with DNase, and the efficiency of this treatment was verified by PCR. The results of RT-PCR analysis indicated that the expression of patA was induced between 2 and 6 h after nitrogen step-down (Fig. 1 A). These results are consistent with those reported previously (5). The induction of patA transcription in the ntcA mutant was abolished (Fig. 1B). The promoter region of the patA gene shows two putative consensus NtcA-binding sites (GTAN8TAC) centered around the positions −249 and −110, according to the translation start codon (Fig. 1C). The data presented in Fig. 1 suggest that the transcription of patA could be under the direct control of NtcA.

FIG. 1.

(A, B) Expression of patA in Anabaena sp. strain PCC 7120. Semiquantitative RT-PCR analysis of patA and rnpB transcripts. Total RNAs were isolated from wild-type (A) or ntcA mutant (B) strains before or after combined nitrogen starvation. A total of 1 μg of RNA was used in each experiment. Samples were collected at the indicated cycles of the exponential phase of the PCR. All experiments were repeated twice, with similar results obtained. Note that the samples were not collected during the same PCR cycles. (C) Representation of patA promoter region. The two putative conservative NtcA-binding boxes are boxed. The numbers are positions relative to the translational start site of patA.

Binding of NtcA on the promoter of patA.

A 430-bp DNA fragment corresponding to the patA promoter region was amplified by PCR using the primers listed in Table 1. The GTA nucleotides of the putative NtcA-binding sites (GTAN8TAC) were substituted for ACG (A₁) and AGC (A₂). The DNA binding of NtcA to these promoter regions, in the presence of various concentrations of 2-OG, was assessed as previously described (3). At a concentration of 0.1 mM 2-OG, the interaction of NtcA with the patA promoter was greatly stimulated (Fig. 2). The mutation of the conserved NtcA-binding sites completely abolished the interaction of this regulator with the patA promoter region. Indeed, the shifted band disappeared when the mutated promoter region was used in the NtcA motility essay (Fig. 2, bottom).

TABLE 1.

Primers used in this study

Primer	Sequence (5′-3′)	Feature
patAp top	AATGAAAGATACAGAAAAGCAACC	Amplifies the patA promoter
patAp bottom	TTGACATCATGAAACTATT
A1 top	CCTGATTTTTGAAAGAATGTTTTCTAACGATCGG	Amplifies the patA promoter mutated in the −249 NtcA site
A1 bottom	TTGACATCATGAAACTATT
A2 top	AATGAAAGATACAGAAAAGCAACC	Amplifies the patA promoter mutated in the −110 NtcA site
A2 bottom	CTGAGAATATATTTACCTAAGTTCAGCAATTGCTAGTTAAG
A1/2 top	CCTGATTTTTGAAAGAATGTTTTCTAACGATCGG	Amplifies the patA promoter mutated in the two NtcA sites
A1/2 bottom	CTGAGAATATATTTACCTAAGTTCAGCAATTGCTAGTTAAG	RT-PCR: rnpB transcript
rnpB top	AGGGAGAGAGTAGGCGTTGG
rnpB bottom	GGTTTACCGAGCCAGTACCTCT
patA top	GTAATAGTTGATAGGCGATCGCTCTGTT	RT-PCR: patA transcript
patA bottom	TTTCTGCAGGGCTGAACCTTTGGGAGTT
PpatA top	GGAATTCCTTCAGGATTGGGGACAAGTGAATC	Amplifies the PA1-gfp fusion mutated in the −249 NtcA site
PA1 bottom	CCGATCGTTAGAAAACATTCTTTCAAAAATCAGG
PA2 top	CTTAACTAGCAATTGCTGAACTTAGGTAAATATATTCTCAGA	Amplifies the PA2-gfp fusion mutated in the −110 NtcA site
PA2 bottom	GGTACCTTCATTATTTGTAGAGCTCATCCA

FIG. 2.

NtcA interaction with the patA promoter. DNA-binding activity of NtcA toward the promoter region of patA, with various concentrations of 2-OG. The NtcA protein was purified as described in reference 6. DNA fragments used in electrophoretic mobility shift assays were obtained by PCR amplification carried out with the primers listed in Table 1. (Top) Assays carried out with the wild-type patA promoter region; (bottom) assays carried out with the patA promoter region bearing mutations in the two consensus NtcA sites. The arrow indicates DNA/protein complexes. All experiments were repeated twice, with similar results obtained.

Role of NtcA-binding sites in the expression of patA in vivo.

In order to better understand the mechanism by which NtcA activates the transcription of patA, we assessed the contributions of both of the NtcA-binding sites in the regulation of patA in vivo. Transcriptional fusions to the gfp reporter gene were constructed with the wild-type patA promoter or with its derivatives bearing mutations in either one or both of the NtcA-binding sites. The constructions were cloned into the replicative plasmid pRL25c and introduced by conjugation into Anabaena. Recombinant clones were grown under combined nitrogen starvation. The transcription from the different patA promoters was analyzed by monitoring the fluorescence emitted by the cells. The gfp fusion with the wild-type patA promoter showed bright fluorescence in heterocysts (Fig. 3). The P_patA-gfp fusion was not expressed in the ntcA mutant (data not shown). The mutation of the two NtcA-binding sites abolished the expression of the gfp fusion (Fig. 3). The binding of NtcA to the A₂ site seems to be essential for patA activation, since its mutation was sufficient to abolish the expression of the gfp fusion (Fig. 3). On the other hand, A₁ mutation reduces only the level of gfp expression. All together, these data establish that NtcA binds directly to the two conserved sites and activates the expression of patA in Anabaena cells challenged with combined nitrogen starvation.

FIG. 3.

Fluorescence micrographs (left), light transmission micrographs (middle), and superposition of the two previously mentioned micrographs (right) of Anabaena sp. strain PCC 7120 bearing P_patA-gfp, P_A1-gfp, P_A2-gfp, or P_A1/2-gfp. The P_patA-gfp fusions were generated from the pHB912/P_patA-gfp plasmid (8). All the primers used to construct the gfp fusions are listed in Table 1. The images were obtained 24 h after combined nitrogen was removed from the culture. The arrows indicate heterocysts.

The expression levels of hetR and ntcA are mutually interdependent (7). It has been suggested that PatA might perceive a signal in developing cells and, in response, stimulates the activity of HetR (1, 7). Our demonstration that patA expression is controlled by NtcA confirms that patA and hetR belong to the same regulatory circuit. The challenge ahead is to elucidate the mechanism whereby PatA perceives its signal and transmits it into HetR activation.