BMPR2 mutation alters the lung macrophage endothelin-1 cascade in a mouse model and patients with heritable pulmonary artery hypertension

Abstract

Macrophage derived-endothelin-1 (ET-1) has been suggested to contribute to a number of chronic lung diseases. Whether the ET-1 cascade from non-vascular sources (inflammatory cells) also contributes to pulmonary artery hypertension (PAH) and in particular to heritable PAH (HPAH) with known bone morphogenetic protein type 2 receptor (BMPR2) mutations is not known. We tested this notion using bone marrow-derived macrophages (BMDM; precursors of tissue macrophages) isolated from ROSA26rtTAXTetO₇-tet-BMPR2^R899X mice (model of PAH with universal expression of a mutated BMPR2 gene) with and without activation by LPS and in human lung tissue from HPAH with BMPR2 mutations and idiopathic PAH (IPAH). At baseline ET_A and ET_B receptors and endothelin converting enzyme (ECE) gene expression was reduced in BMPR2 mutant BMDM compared with controls. In control BMDM, LPS resulted in increased ppET-1 gene expression and ET-1 in culture media, whereas ET_A and ET_B receptor and ECE gene expression was decreased. These findings were more severe in BMPR2 mutant BMDM. Antagonism of the ET_B receptor resulted in increased ET-1 in the media, suggesting that decreased ET-1 uptake by the ET_B receptor contributes to the elevation. While ET-1 expression was demonstrated in lung macrophages from controls and IPAH and HPAH patients, ET_A and ET_B expression was decreased in the HPAH, but not IPAH, patients compared with controls. We conclude that reduced expression of macrophage ET-1 receptors in HPAH increases lung ET-1 and may contribute to the pathogenesis and maintenance of HPAH. This is the first description of protein expression that distinguishes HPAH from IPAH in patients.

pulmonary arterial hypertension (PAH) is a progressive disease in which widespread occlusion of small pulmonary arteries leads to increased pulmonary vascular resistance and subsequent right ventricular failure. PAH can be either heritable (HPAH) or idiopathic (IPAH) in nature. Heterozygous germline mutations in the bone morphogenetic protein type 2 receptor (BMPR2) have been identified as a gene underlying HPAH. BMPR2 mutations have now been identified in ∼70% of families with HPAH and ∼20% in patients with IPAH (21).

Until recently, the clinical course and pathology of HPAH and IPAH have been considered similar (20, 26). However, several papers now point to differences between the heritable and idiopathic forms of the disease. Patients with either HPAH or IPAH with nonsynonymous BMPR2 mutations have been shown to be less vasoreactive than patients without an identifiable BMPR2 mutation (10) and less likely to respond to acute vasodialator testing (24). Furthermore, patients with PAH and a BMPR2 mutation have been reported to present ∼10 years earlier and with more severe disease than patients without a mutation (34). These data suggest that mutations in BMPR2 are associated with distinct disease phenotypes.

The small vasoactive peptide endothelin-1 (ET-1) has been shown to mediate the vascular remodeling of PAH by promoting vasoconstriction, smooth muscle proliferation (43), protein synthesis (5), and production of a variety of cytokines and growth factors (18). ET-1 activates a complex cascade of intracellular events by binding to its specific receptors, endothelin receptor A (ET_A) and endothelin receptor B (ET_B). These receptors are distributed in a variety of cells and tissues in different proportions, suggesting a potential regulatory mechanism.

In patients with PAH, plasma ET-1 is increased (4) and the elevated levels correlate with increased pulmonary vascular resistance and pulmonary arterial pressure, and decreased cardiac output (25, 33). Furthermore, expression of ET-1 is increased in lung vascular endothelial cells of patients with PAH (15). Increased levels of plasma ET-1 and expression of pulmonary ET-1 have also been described in animal models of PAH (32).

Although vascular endothelial cells express and secrete the majority of ET-1, lung macrophages also show increased expression of the ET-1 cascade under various pathological conditions (1, 9, 22, 37, 39). Infiltration of various inflammatory cells, including macrophages, has been found in the plexiform lesions in IPAH (38) and in CD8⁺ lymphocytes in the lung periphery (2). Furthermore, we demonstrated in a mouse model (SM22-rtTA x TetO7-BMPR2^R899X) of HPAH (a BMPR2 mutation expressed in SMC) that large numbers of macrophages and T cells are present in the adventitial layer of the pulmonary arteries (41). A recent study demonstrated that in normotensive human pulmonary artery segments, BMPR2 ligand inhibits contraction in response to ET-1 and thus regulates the effects of ET-1 in the pulmonary circulation suggesting that mutations in BMPR2 have an ability to alter the regulatory mechanisms governing the ET-1 cascade in pulmonary arteries (6). These findings led us to hypothesize that a BMPR2 mutation results in alterations in the ET-1 cascade in lung macrophages. To test this hypothesis, we examined bone marrow-derived macrophages (BMDM), precursors of tissue macrophages isolated from ROSA 26rtTA X TetO₇-tet-BMPR2^R899X mice (a model of HPAH with universal expression of a mutated BMPR2 gene) with and without activation by LPS and paraffin-embedded lung tissue from ROSA 26rtTA X TetO₇-tet-BMPR2^R899X mice and HPAH patients with known BMPR2 mutations and IPAH patients compared with controls. Our results reveal that both ET_A and ET_B receptor gene expression is reduced in BMDM from mice expressing a BMPR2 mutation, a finding that is recapitulated in lung macrophages from ROSA 26rtTA X TetO₇-tet-BMPR2^R899X mice and patients with HPAH but not IPAH. We conclude that the reduction in ET-1 receptors in lung macrophages from HPAH patients leads to increased local levels of ET-1, which have a paracrine effect on cells in the microenvironment. These findings may contribute to the clinical differences seen in patients with HPAH and IPAH.

METHODS

Harvesting and maturation of macrophages from mouse bone marrow-derived cells.

BMDM were cultured from equal numbers of male and female 8-wk-old ROSA 26rtTA X TetO₇-tet-BMPR2^R899X mice (a model of HPAH; BMPR2 mutant mice) and ROSA 26 rtTA mice (controls). First, the skin around the femur was soaked in 70% ethanol, and the femur was exposed. The ends of the femurs were clipped, and the bone was flushed with 3 ml of PBS per femur. The perfusate was then centrifuged for 5 min at 1,000 rpm. The stem cells were resuspended in BMDM media and incubated for 5 days at 37°C. The BMDM media contained 10% FBS, 1% penicillin/streptomycin, 1% l-glutamine, and 10% LCM (supernatant obtained from L929 cells grown for 1 wk in DMEM with 10% FBS, 1% penicillin/streptomycin, and 1% l-glutamine). After 5 days of incubation (0.5 mg/ml doxycycline was added on day 4), the cells were washed with ice-cold PBS, scraped, centrifuged, and counted. The average cell count obtained was 1,500,000/mouse. BMDM were then plated into six-well plates (2.5 × 10⁵ cells/well) containing DMEM, 10% FBS, 1% penicillin/streptomycin, and 1% l-glutamine and incubated overnight to allow the cells to attach to the plate before experimentation. To confirm proper macrophage differentiation of the BMDM, macrophage markers Itgam, Mrc1, and Sfpi1 were assayed by quantitative RT-PCR. All three were strongly expressed, with no significant differences between control (Rosa26-rtTA) and BMPR2 mutant (Rosa26-rtTAxTetO₇-BMPR2^R899X) mice (42). The protocol for mice was approved by Vanderbilt University Institutional Animal Care and Use Committee.

Protocols.

Following maturation of the BMDM from mutant and control mice, the cells were treated with LPS (100 ng/ml, 055:B5; Sigma-Aldrich, St. Louis, MO) for either 4 or 24 h. The cell supernatant was collected at the start of the experiment (time 0) and at 4 and 24 h of LPS stimulation and frozen at −70°C for subsequent measurement of ET-1 levels. After aspiration of the medium, the cells at 0 and 24 h of LPS stimulation were washed with PBS and lysed with 100 μl of lysis buffer (Promega, Madison, WI) for Quantitative Real Time PCR (QRT-PCR).

The effect of ET_A and/or ET_B receptor inhibitor on ET-1 was studied in the culture medium of BMDM obtained only from control mice. Cultured BMDM were incubated in the presence or absence of either 1 μM ET_A receptor antagonist (BQ-123; Alexis Biochemicals, San Diego, CA) or 1 μM ET_B receptor antagonist (BQ-788; Alexis Biochemicals) or both with or without LPS stimulation for 24 h. The cell supernatant was collected at 0 and 4 h following LPS stimulation and frozen at −70°C for subsequent measurement of ET-1 levels by ELISA (Assay Designs, Ann Arbor, MI).

Purity of BMDM.

The purity of BMDM was determined as previously described (19, 30, 31). Briefly, on day 5, the BMDM were incubated with cell dissociation solution (Sigma C-591A) for 10 min at 37°C and resuspended in PBS containing 3% FBS at a cell density of 10⁷ cells/ml. The cells were then permeabilized in 1 M HEPES, 1 M NaCl, 1 M sucrose, 1 M MgCl2, and 1% Nonidet P-40 for 10 min at room temperature followed by incubation with rat anti-mouse CD206:FITC antibody (BD Pharmingen, San Jose, CA) for 45 min at 4°C.

RNA extraction and cDNA preparation.

Total RNA was extracted from cultured BMDM using RNeasy Mini kits (Qiagen, Valencia, CA) according to the manufacturer's instructions. RNA concentration was determined by standard spectrometric techniques. First-stand cDNA synthesis was carried out using Superscript II Reverse Transcriptase system (Applied Biosystems, Foster City, CA).

Expression of the BMPR2^R899X gene in BMDM from ROSA26rtTAxTetO7-tet-BMPR2^R899X mice was confirmed by quantitative real-time PCR (mus-F: ATAGGAGGGAACGGCCATTAG and mus-R: GGTCCCCAAACTCACCCTG). Relative quantification was achieved with the comparative 2^−ΔCt method by normalization with expression of the HPRT gene (mus-147F TGCTCGAGATGTCATGAAGGAG and mus-249R TTTAATGTAATCCAGCAGGTCAGC).

Quantitative RT-PCR using primers for mouse ET-1, ET_A, ET_B, and ECE.

Primers for preproET-1 (ppET-1) were designed using the computer program Primer3 (Primer Express Software; Applied Biosystems, Foster City, CA) [preproET-1F (ppET-1F) ACT TCT GCC ACC TGG ACA TC and ppET-1R GTC TTT CAA GGA ACG CTT GG] and synthesized by Integrated DNA Technologies. ET_A, ET_B, and ECE primers were obtained from SuperArray Bioscience (SABiosciences, Frederick, MD), and β-microglobulin (βMG) primers were obtained from RealTimePrimers.com. All primers were intron-spanning to avoid inappropriate amplification of residual genomic DNA. Quantitative RT-PCR was performed in triplicate on an ABI PRISM 7000 (Applied Biosystems), each tube containing 2.5 μl of SYBR Green PCR Master Mix (Applied Biosystems), 100 nM (each) primer, and 5 μl of diluted template DNA in a total volume of 25 μl. Signal detection and analysis of results were performed with ABI PRISM 7000 sequence detection software (Applied Biosystems). Relative quantification was achieved with the comparative 2^−ΔCt method by normalization with expression of the βMG gene.

Measurement of ET-1 in cell culture fluid.

ET-1 levels in the culture supernatant were measured with a commercial ELISA kit (Assay Designs, Ann Arbor, MI). The intra-assay coefficient of variation was 5.8%, with an inter-assay variation of 4.7%. Cross reactivity to ET-2, ET-3, and Big ET was <0.1%. The ET-1 levels measured in experiments fell within the range of the curve generated by the standard concentrations provided with the ELISA kit. The complete medium alone had undetectable levels of ET-1.

Immunohistochemical analysis of ET_A, ET_B, and ET-1 in human lung.

Immunolocalization of ET_A, ET_B and ET-1 was performed on archival paraffin-embedded human lung tissue obtained from controls and HPAH and IPAH patients (Table 1). Two of the patients with HPAH received ET receptor antagonist therapy. The study protocol was approved by the institutional research and ethics committees of Vanderbilt University Medical Center. Lung samples were obtained after surgical resection or at autopsy (≤10 h postmortem). Lung sections were deparaffinized, rehydrated, and blocked with 5% normal goat serum, followed by overnight incubation with primary antibody (ET_A and ET_B from GeneTex, San Antonio, TX; ET-1 from Novus Biologicals, Littleton, CO) at 4°C. The sections were then incubated with biotinylated secondary antibody followed by incubation with HRP-conjugated streptavidin. Diaminobenzidine (DAB) was used as a substrate for HRP. The sections were dehydrated and mounted in Cytoseal XYL (Richard-Allan Scientific, Kalamazoo, MI) for light microscopic examination. Use of tissue samples was approved by the institutional review board at Vanderbilt University Medical Center, and written informed consent was obtained from all living subjects included in the study. Unique identifiers to conceal identity were assigned to all samples.

Table 1.

Characteristics of patients in study group

Disease	Age	Gender	mPAP	BMPR2 Mutation
HPAH	15	F	100	Exon 3 (T354G)
	36	F	70	Exon 12 (1742-1748delA)
	35	M	80	Exon 8 (C994T)
	16	F	77	Exon 3 (T354G)
IPAH	29	M	80	Negative
	37	F	unknown	Not tested
	32	F	66	Not tested
	34	M	80	Not tested
	24	M	74	Not tested
Controls	62	F
	49	F
	73	M
	49	M
	18	M

Colocalization using ET_A and ET_B in human and mouse lung macrophages.

For colocalization of ET_A and ET_B in human lung macrophages, lung sections were coincubated with either an ET_A or ET_B antibody (GeneTex) with a macrophage antibody (25F9; Santa Cruz Biotechnology) overnight at 4°C. The sections were then incubated with an FITC-labeled secondary antibody for macrophages (Sigma) and a Cy3-labeled secondary antibody for either the ET_A or ET_B receptor (Zymed Laboratories Invitrogen, Carlsbad, CA). The slides were mounted using Vectashield mounting media containing DAPI (Vector Laboratories, Burlingame, CA) for confocal microscopy.

For colocalization of ET_A and ET_B in mouse lung macrophages, 5-mo-old BMPR2^R899X transgenic mice were used. The mice received doxycycline (1 g/kg) in their chow for 8 wk before being euthanized with Beuthanasia-D IP. The lungs were harvested and fixed in 4% paraformaldehyde and embedded in paraffin by standard techniques. Lung sections (5 μm thick) were coincubated either with mouse ET_A (Novus Biologicals, Littleton, CO) or mouse ET_B antibody (Abcam, Cambridge, MA) and a macrophage antibody (Mac3; BD Pharmingen, San Jose, CA) overnight at 4°C. The sections were then incubated with a Cy3-labeled secondary antibody for macrophages (Zymed) and an FITC-labeled secondary antibody for either ET_A (Zymed) or ET_B receptor (Sigma). The slides were mounted using Vectashield mounting media containing DAPI (Vector Laboratories) for confocal microscopy.

To preserve the relative fluorescence variation, the microscopy settings were the same for all the samples. The pictures were digitized, and the fluorescence intensity of ET receptors was assessed by comparing the intensity of the labeled ET_A and ET_B antibodies to the intensity of the labeled macrophage marker using Image J 1.40g software.

Statistical analysis.

Data are expressed as means ± SE. Statistical analyses for quantitative RT-PCR and measurement of ET-1 levels were carried out using a two-way ANOVA with the Bonferroni posttest (GraphPad Prism Software, La Jolla CA). A P < 0.05 was considered significant.

RESULTS

Purity and expression of mutant BMPR2 transgene in BMPR2 mutant BMDM.

The purity of the BMDM cells as determined by flow cytometry was 90.8 ± 3.9% (Fig. 1). The BMPR2^R899X transgene was expressed in BMDM from BMPR2 mutant mice at 17.9 ± 3.6 copies per thousand copies of HPRT when induced with doxycycline, representing an average 37-fold increase in expression compared with those without doxycycline. No expression of the BMPR2^R899X transgene was found in control mice.

Fig. 1.

Expression of BMPR2^R899X transgene compared with HPRT gene expression in bone marrow-derived macrophages (BMDM) from control and mutant mice determined by quantitative RT-PCR (n = 4); *P < 0.001.

ET_A and ET_B gene expression in BMDM.

At baseline, ET_A and ET_B receptor gene expression was significantly greater in control BMDM compared with mutant BMDM. On activation with LPS, expression of the ET_A gene was decreased in both groups compared with baseline (time 0) (n = 6; P < 0.05), although the decrease was most striking in mutant BMDM (n = 6; P < 0.05, Fig. 2A). Expression of the ET_B gene remained unchanged in both groups with LPS stimulation (Fig. 2B).

Fig. 2.

A and B: quantitative real-time RT-PCR analysis of ET_A and ET_B receptor gene expression in BMDM from control (open bars) and BMPR2 mutant mice (solid bars). At baseline, ET_A and ET_B receptor expression was lower in mutant BMDM compared with control cells. In activated BMDM from control and BMPR2 mutant mice, ET_A receptor expression was significantly decreased, whereas ET_B receptor expression remained unchanged. On activation with LPS, ET_A receptor expression was further decreased in BMPR2 mutant BMDM compared with controls. Data are expressed as means ± SE of copy numbers per 200 ng of sample RNA normalized to β-microglobulin (βMG) (n = 6); *P < 0.05.

ppET-1 and ECE gene expression in BMDM.

At baseline, preproET-1 (ppET-1) gene expression was low in control and mutant BMDM. Following LPS stimulation, expression of ppET-1 gene increased 6-fold and 10-fold over baseline in both control and mutant BMDM (n = 6; P < 0.05), respectively (Fig. 3A).

Fig. 3.

Quantitative real-time RT-PCR analysis of ppET-1 and ECE gene expression in BMDM from control (open bars) and BMPR2 mutant mice (solid bars). A: at baseline, ppET-1 expression is negligible in control and BMPR2 mutant BMDM. Following activation with LPS, ppET-1 expression was significantly increased in both groups. B: at baseline, ECE gene was expressed in control and BMPR2 mutant BMDM. Following activation with LPS, ECE expression was significantly decreased in both groups. The decrease was most striking in the BMPR2 mutant mice. Data are expressed as means ± SE of copy numbers per 200 ng of sample RNA normalized to β-MG (n = 6); *P < 0.05; #P < 0.01.

At baseline, relative expression of the ECE gene was similar in control and mutant BMDM. Following LPS stimulation, ECE gene expression decreased significantly in both groups (n = 6; P < 0.05); the decrease was most marked in the mutant BMDM reaching significance compared with control cells (P < 0.01) (Fig. 3B).

Secreted ET-1 levels in BMDM cells.

At baseline, ET-1 levels in the culture medium from BMDM were negligible from both the control (n = 6) and BMPR2 mutant (n = 12) cells. Following activation with LPS for 4 h, levels of ET-1 in the culture media were significantly increased in BMDM from both groups and continued to increase at 24 h (P < 0.001). The increase in secreted ET-1 in the BMPR2 mutant group was significantly greater than the controls at both time points (P < 0.05) (Fig. 4A).

Fig. 4.

A: levels of ET-1 in culture media of control (open bars) and BMPR2 mutant BMDM (solid bars) following LPS stimulation for 4 and 24 h. At baseline, low levels of ET-1 were present in culture media of control and BMPR2 mutant BMDM. These levels increased significantly on activation with LPS (#P < 0.001). Levels of ET-1 were significantly greater in culture media of activated mutant BMDM compared with controls (*P < 0.05). Data are expressed as means ± SE; n = 12. B: levels of ET-1 in culture media of control BMDM in the presence of ET_A and ET_B antagonist (BQ-123 and BQ-788, respectively) at baseline and following LPS stimulation for 4 h. Open bars, no ET-1 receptor antagonists; rightward diagonal bars, presence of ET_A antagonist; leftward diagonal bars, presence of ET_B antagonist; solid bars, both ET-1 receptor antagonists. At baseline, ET_A and ET_B receptor antagonists did not affect levels of ET-1 in culture media. On activation with LPS, levels of ET-1 were significantly higher in culture media of BMDM treated with ET_B receptor antagonist (*P < 0.05) as well as with both ET_A and ET_B receptor antagonists (#P < 0.001). Data are expressed as means ± SE, n = 9.

Effect of ET_A and ET_B receptors on secreted ET-1 levels.

To examine whether the increase in ET-1 was the result of an increase in secretion or reduced clearance, we carried out experiments with ET_A (BQ-123) or ET_B (BQ-788) receptor antagonists in BMDM from control mice (n = 9). At baseline, ET_A and ET_B receptor antagonists did not affect levels of ET-1 in culture media. On activation with LPS, levels of ET-1 were significantly higher in culture media of BMDM treated with ET_B receptor antagonist (P < 0.05) as well as with both ET_B and ET_A receptor antagonists (P < 0.001) (Fig. 4B). The effect with the ET_A receptor did not reach significance. The increase in ET-1 in the presence of the ET_B receptor antagonist suggests that this receptor is responsible for the increased ET-1 in the culture media.

ET-1 localizes in lung macrophages from control, IPAH, and HPAH lungs.

Using immunocytochemical techniques, we demonstrated that ET-1 localized in alveolar macrophages from control, IPAH, and HPAH lungs (Fig. 5, A–C) and that expression of ET-1 was similar in each group; lung tissue macrophages showed similar results (Fig. 5F). ET-1 was also expressed in pulmonary vascular endothelial cells (ECs) and smooth muscle cells (SMCs) from control, IPAH, and HPAH lungs (Fig. 5, D–H).

Fig. 5.

Immunolocalization of ET-1 in control, heritable pulmonary artery hypertension (HPAH), and idiopathic PAH (IPAH) (as a disease control) lungs. ET-1 localizes in alveolar macrophages in control (A), HPAH (B), and IPAH (C) as denoted by arrows. ET-1 also localizes in ECs and SMCs from pulmonary arteries in control (D and E), HPAH with BMPR2 mutation (F and G), and IPAH (H) as denoted by arrows. Magnification, ×400.

Localization of ET_A and ET_B receptors is decreased in alveolar macrophages from HPAH.

In control and IPAH lungs, immunocytochemistry revealed that the ET_A (Fig. 6, IA and IC) and ET_B receptors (Fig. 6, IIA and IIC) were similar in concentration and localized in alveolar macrophages. In contrast, expression of ET_A and ET_B receptor was decreased in HPAH (n = 4) alveolar macrophages compared with both control (n = 5) and IPAH (n = 5) lungs (Fig. 6, IB and IIB). The ET_A receptor also localized in SMCs from control, IPAH, and HPAH lungs (Fig. 6, ID-IH). ET_B was localized in ECs in control, IPAH, and HPAH lungs and in SMCs from IPAH and HPAH lung (Fig. 6, IID-IIH). Localization of ET_B in SMCs from control was undetectable.

Fig. 6.

Immunolocalization of ET_A and ET_B receptors in control, HPAH, and IPAH lungs. I: ET_A receptors localize in alveolar macrophages in control (A) and IPAH (C). In lung, macrophages from HPAH localization of ET_A receptor is decreased (B). Expression of ET_A is denoted by arrows in macrophages. ET_A receptor also localizes in SMCs from pulmonary arteries in control (D and E), HPAH (F and G), and IPAH (H and I) as denoted by arrows. II: ET_B receptor localizes in alveolar macrophages in control (A) and IPAH (C). In macrophages from HPAH, localization of ET_B receptor is decreased (B). Expression of ET_B receptor is denoted by arrows in macrophages. ET_B receptor was also localized in pulmonary artery ECs in control (D and E), HPAH (F and G), and IPAH (H and I) as denoted by arrows and in pulmonary artery SMCs from control (D and E), HPAH (F and G), and IPAH (H and I) as denoted by arrows. Magnification, ×400.

Localization of ET_A and ET_B receptors in macrophages in human and mouse lung by confocal microscopy.

Confocal microscopy was carried out to confirm the reduction of ET_A and ET_B receptors in macrophages from HPAH, IPAH, and control lungs. As shown in Fig. 7, the macrophages in the adventitial layer of large arteries of control and IPAH lungs colocalize both the ET_A receptor (A–D and I–L, respectively) and the ET_B receptor (M–P and U–X, respectively). Macrophages from HPAH cases show little, if any, colocalization of either the ET_A or ET_B receptor (E–H and Q–T, respectively).

Fig. 7.

Confocal microscopy. ET_A and ET_B receptor localization is reduced in the adventitial macrophages surrounding the large blood vessels in HPAH lung compared with controls and IPAH lungs. Macrophages were identified in the adventitia using the macrophage antibody (Ab) 25F9 (FITC labeled), and localization of ET_A and ET_B receptors was identified using either ET_A or ET_B receptors Ab (Cy3 labeled). DAPI was used as the nuclear stain. ET_A and ET_B receptor in adventitial macrophages in control (A–D and M–P) and IPAH (I–L and U–X) lung tissue, respectively. In contrast, ET_A and ET_B receptor localization was reduced in adventitial macrophages in HPAH lung tissue (E–H and Q–T), respectively. Magnification, ×400.

Similarly, the alveolar macrophages and those in close proximity to small arteries of control (A–D and I–L) and IPAH (data not shown) cases demonstrated colocalization of both the ET_A and ET_B receptors, whereas those from HPAH lungs showed little colocalization of either receptor (Fig. 8, E–H and M–P, respectively).

Fig. 8.

Localization of ET_A and ET_B receptors in alveolar macrophages and macrophages in close proximity to small blood vessels in HPAH and control lungs. Lung macrophages were identified using the macrophage antibody (Ab) 25F9 (FITC labeled), and localization of ET_A and ET_B receptors was identified using either ET_A or ET_B receptor Ab (Cy3 labeled). DAPI was used as the nuclear stain. In control lungs, ET_A receptors localize in alveolar macrophages close to small vessels (A–D). In contrast, ET_A receptor localization is reduced in lung macrophages surrounding the small vessels in HPAH lung tissue (E–H). Similarly, ET_B receptors localized to lung macrophages in close proximity to small pulmonary arteries in control lung (I–L), and ET_B expression was reduced in HPAH lungs (M–P). Magnification, ×400.

Confocal microscopy in mouse lungs from BMPR2 mutant mice reiterated the reduction of ET_a and ET_B receptors in lung macrophages compared with control mice (Fig. 9).

Fig. 9.

Localization of ET_A and ET_B receptors in alveolar macrophages and macrophages in close proximity to small blood vessels in BMPR2 mutant and control mouse lungs. Lung macrophages were identified using the macrophage antibody (Ab) Mac3 (Cy3 labeled), and ET_A and ET_B receptors were localized using either FITC-labeled ET_A and ET_B receptor Ab. DAPI was used as the nuclear stain. In control lungs, ET_A receptors localize in alveolar macrophages close to small vessels (A–D). In contrast, ET_A receptor localization in BMPR2 mutant mice is reduced (E–H). Similarly, ET_B receptor localization was reduced in lung macrophages in close proximity to small pulmonary arteries in BMPR2 mutant mice (M–P) compared with controls (I–L). Magnification, ×600.

Quantitation of the ET_A and ET_B receptors.

Quantitation of the intensity of the immunofluorescence of the ET_A and ET_B receptors confirmed a significant reduction in expression in the HPAH cases compared with both the control lungs and those from the IPAH cases (Fig. 10A). The reduction in ET_a and ET_b receptor expression was recapitulated in lung macrophages from the BMPR2 mutant mice compared with controls (Fig. 10B).

Fig. 10.

A: quantitation of the immunofluorescence intensity of ET_A and ET_B (CY3-labeled) receptors to FITC-labeled macrophages in control (open bars), HPAH (solid bars), and IPAH (diagonal bars) lungs. Intensity of immunofluorescence for ET_A and ET_B receptor antibody is significantly reduced in macrophages from HPAH lungs compared with controls and IPAH cases. BMPR2 mutant mice compared with controls. B: ET_A (FITC-labeled) and ET_B (FITC-labeled) receptors in macrophages (Cy3-labeled) from control (open bar) and BMPR2 mutant (solid bar) mice. Intensity of immunofluorescence for ET_A and ET_B receptor antibody is significantly reduced in macrophages from BMPR2 mutant mice compared with controls. *P < 0.001.

DISCUSSION

Our data demonstrate that ET-1 and the ET_A and ET_B receptors are expressed in BMDM (precursors of tissue macrophages) from BMPR2 mutant (ROSA 26-rtTA X TetO₇-BMPR2^R899X mouse model of HPAH) and control (ROSA26-rtTA) mice. On activation with LPS, ppET-1 gene expression and ET-1 secretion into the culture media is increased, whereas ECE gene expression is decreased in control and mutant BMDM. These findings are more severe in the cells from the BMPR2 mutant mice than in controls. The LPS-induced increase in ET-1 in the culture media was further increased in the presence of an ET_B antagonist alone or in conjunction with an ET_A antagonist, suggesting that the additional increase is the result of decreased ET_B receptor expression. Under baseline conditions, levels of ET_A and ET_B receptor gene expression was reduced in BMPR2 mutant BMDM, a change that was confirmed directly in the lungs of these mutant mice. Expression of ET-1 was also found in human lung macrophages from control lungs and those from patients with either IPAH or HPAH. Furthermore, a reduction in ET_A and ET_B receptors was noted in the lungs of patients with HPAH but not those with IPAH compared with controls.

Our current understanding of the role of BMPR2 in adult animals or humans suggests participation in a pathway(s) responsible for resolution of inflammation. BMPR2 regulates cell differentiation and some cytokines through SMAD, glucocorticoid receptor sensitivity through LIMK (7), and ROS and actin organization through an as yet poorly defined mechanism (40). Microarray analysis of whole lung from a transgenic mouse model expressing a dominant negative form of BMPR2 in smooth muscle (SM22-rtTA x TetO₇-BMPR2^delx4+) demonstrated an increase in cytokines and markers of immune response with increased right ventricular systolic pressure (RVSP) (35). Similarly, the transgenic mouse model expressing a smooth muscle-specific BMPR2^R899X transgene demonstrated accumulation of macrophages and T cells in the adventitial layer of pulmonary arteries with an increased RVSP (41). While we believe that complex lesions are a late event in the development of PAH in BMPR2 mutant mouse models, time course studies in Rosa26-rtTA x TetO₇-BMPR2^R899X show early and persistent recruitment of monocytes to the lungs, both by expression studies in whole lung and by histology (unpublished observations). Universal expression of the BMPR2^R899X mutation results in earlier and stronger penetrance than expression in smooth muscle alone, suggesting a contributory role to the mutation in other cell types, including cells of the monocyte lineage whose recruitment is one of the first events in this model. Several lines of evidence thus suggest that suppression of BMPR2 function is proinflammatory through multiple mechanisms, with specific effects depending on cell type (16, 23). Our prior studies thus led us to question the effect of macrophage recruitment within BMPR2 mutants. In the current paper, we chose to focus on the ET-1 cascade in lung macrophages because 1) ET-1 is associated with the pathogenesis of PAH (25) and 2) other lung diseases have highlighted alterations in this pathway in lung macrophages.

A delicate balance between vasoconstrictor and vasodilator agents exists in the small pulmonary arteries and is responsible for normal homeostasis. ET-1 acts as a local autocrine or paracrine agent rather than as a circulating hormone (12, 28). In PAH, it is well established that the endothelial cell is a source of ET-1, but few, if any, studies have addressed the possible contribution of other cells to ET-1 synthesis in the lung. The present study demonstrates that the BMDM from control and BMPR2 mutant mice express ET_A, ET_B, and ECE genes and minimal levels of ppET-1. These results confirm the notion that ET-1 is expressed by macrophages in culture (9), and our immunocytochemical studies confirm that this is also true in control human lung.

Alterations in the ET-1 cascade are described in several lung diseases. For example, ET-1 levels are increased in the plasma of patients with idiopathic pulmonary fibrosis (39) and in bronchoalveolar lavage in pulmonary sarcoidosis (37). In scleroderma-associated fibrotic lung disease, ET-1 immunoreactivity is increased, and a reduction in ET_A with a slight increase in ET_B expression has been noted in the diseased lung (1). Furthermore, in systemic sclerosis, alveolar macrophage ET-1 expression is increased upon stimulation with LPS (22). Thus, it is known that alveolar macrophages from diseased lungs demonstrate alterations in the ET-1 cascade. The current study demonstrates that while ET-1 expression is similar to controls in HPAH and IPAH lung macrophages, ET_A and ET_B receptor expression is reduced in lung macrophages from HPAH but not IPAH. While two of the patients with HPAH received endothelin receptor antagonist therapy, two did not: all four HPAH patients exhibited the reduction in ET_A and ET_B receptor expression. Furthermore, the one IPAH patient receiving the endothelin receptor antagonist did not show this reduction. Thus, it is unlikely that this therapy contributed to this change. This is the first demonstration of a distinct difference in protein expression between lungs of patients with HPAH and those with IPAH and controls.

ET-1 binds to its G-coupled receptors, ET_A and ET_B (3). In control lung, the ET_A receptor is present on vascular SMCs and is responsible for vasoconstriction, whereas ET_B is present on ECs and SMCs and involved in clearance and degradation of ET-1 (13). Our study shows significantly lower expression levels of ET_A and ET_B in the BMDM from BMPR2 mutant mice than in control mice, and our findings following stimulation with LPS show a further reduction in ET_A and ET_B receptor gene expression. These findings suggest a link between a BMPR2 mutation and ET_A and ET_B gene expression. Furthermore, our studies in human lung show a reduction in ET_A and ET_B expression in alveolar macrophages in HPAH but not IPAH, confirming the notion that a BMPR2 mutation modulates gene expression of the ET_A and ET_B receptors.

In humans and rodents, two distinct isozymes of ECE, ECE1 (29) and ECE2 (11), catalyze the rate-limiting step in ET-1 synthesis. In IPAH patients, expression of ECE-1 is augmented in the endothelium of diseased pulmonary arteries (14). Similarly, in rats the immunoreactivity for ECE is increased in the vascular wall of pulmonary veins after exposure to hypoxia (36). In BMDM from control mice, expression of the ECE-1 gene was decreased upon activation with LPS and was further decreased in cells with a mutated BMPR2 phenotype. The decreased level of ECE gene expression in LPS-stimulated BMDM might be expected to result in decreased ET-1 expression. However, ET-1 levels in culture medium were increased in LPS-stimulated BMDM from both control and BMPR2 mutant mice.

In pulmonary hypertension, the increased levels of ET-1 in the pulmonary circulation are due to reduced pulmonary clearance of ET-1 (8). The ET_B receptors play an important role in the clearance of ET-1 from circulation (13). Blockade of the ET_B receptor in rat increases the level of ET-1 in circulation (27), and rats deficient in the ET_B receptor show higher levels of plasma ET-1 (17). Thus, the increased ET-1 in the media of BMDM from BMPR2 mutant mice is likely the result of the decrease in ET_B receptor expression. The striking reduction in ECE gene expression in the hypertensive cells confirms this idea.

In summary, our findings confirm that ET-1 and its receptors are present in lung macrophages. Furthermore, ET_A and ET_B receptor expression is decreased in BMDM from a BMPR2 mutant mouse model of HPAH compared with controls. The increased release of ET-1 into the culture media likely reflects the decrease in ET_b receptor expression. The decreased expression of ET_A and ET_B expression is recapitulated in human lung macrophages from patients with HPAH but not IPAH, suggesting that this change is specific for the hereditary form of the disease. We conclude that local increases in lung macrophage ET-1 may contribute to pulmonary arterial hypertension in HPAH through a paracrine effect. The mechanism through which this effect is mediated is not known and is a fruitful avenue for further research. Whether this effect contributes to the clinical differences reported in patients with HPAH and IPAH requires further study.

GRANTS

This work was supported by grants from Actelion, the Pulmonary Hypertension Breakthrough Initiative (funded by the Cardiovascular Medical Research and Education Fund), and National Heart, Lung, and Blood Institute Grant HL-82694-01.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).