Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2010 Jul 14;48(10):3614–3623. doi: 10.1128/JCM.00157-10

Genomic Signatures of the Haarlem Lineage of Mycobacterium tuberculosis: Implications of Strain Genetic Variation in Drug and Vaccine Development▿

Andrés Cubillos-Ruiz 1,†, Andrea Sandoval 1,†, Viviana Ritacco 2, Beatriz López 2, Jaime Robledo 3,4, Nidia Correa 3,4, Iván Hernandez-Neuta 1, Maria Mercedes Zambrano 1, Patricia Del Portillo 1,4,*
PMCID: PMC2953103  PMID: 20631099

Abstract

Tuberculosis is the world's leading cause of death due to a single infectious agent, and efforts aimed at its control require a better understanding of host, environmental, and bacterial factors that govern disease outcome. Growing evidence indicates that certain Mycobacterium tuberculosis strains of distinct phylogeographic lineages elicit unique immunopathological events. However, identifying the genetic basis of these phenotypic peculiarities has proven difficult. Here we report the presence of six large sequence polymorphisms which, together with two single-nucleotide changes previously described by our group, consistently differentiate Haarlem strains from the remaining M. tuberculosis lineages. The six newly found Haarlem-specific genetic events are four deletions, which altogether involve more than 13 kb, and two intragenic insertions of the element IS6110. The absence of the genes involved in these polymorphisms could have an important physiological impact on Haarlem strains, i.e., by affecting key genes, such as Rv1354c and cyp121, which have been recently proposed as plausible drug targets. These lineage-specific polymorphisms can serve as genetic markers for the rapid PCR identification of Haarlem strains, providing a useful tool for strain surveillance and molecular epidemiology studies. Strain variability such as that described here underscores the need for the definition of a core set of essential genes in M. tuberculosis that are ubiquitously present in all circulating lineages, as a requirement in the development of effective antituberculosis drugs and vaccines.


Mycobacterium tuberculosis is the causative agent of tuberculosis, the leading cause of death by a single bacterial agent in the world (36). Infection with M. tuberculosis has historically shown to result in a variety of clinical outcomes that are usually associated with host inherited susceptibility and environmental risk factors (2, 31, 32). Moreover, increasing evidence suggests that genetic variation in the tubercle bacilli also plays an important role in the outcome of the disease (4, 19, 33). Due to the absence of exchange of genetic material with a global microbial gene pool, M. tuberculosis had long been considered to have a clonal population structure. However, a significant strain-to strain genetic variation within M. tuberculosis has recently been unveiled (11, 19).

Changes in neutral regions of the chromosome, such as the direct repeat (DR) locus, and in the mycobacterial interspersed repetitive units (MIRUs) are useful in epidemiological and phylogenetic analyses and in describing the most conspicuous M. tuberculosis lineages (3, 21). In addition to the variation in neutral regions, genetic polymorphisms involving coding regions have been described to occur through single-nucleotide changes and through deletion and insertion events, the latter mediated mainly by the IS6110 element (23, 30). Although these genomic alterations are thought to be among the principal sources of phenotypic variation in M. tuberculosis, the specific genomic changes that define each lineage have not yet been fully defined.

There are currently six phylogeographic lineages that make up the M. tuberculosis global population (10). One is the Euro-American group, which includes all the spoligotype families predominating in the Western world, such as Haarlem, LAM, and the ill-defined T group (3). In particular, the Haarlem genotype is ubiquitous worldwide (15) and represents about 25% of the isolates in Europe, Central America, and the Caribbean, suggesting a link with the post-Columbus European colonization (8). Haarlem strains are actively transmitted in urban settings in Colombia, causing major public health problems (N. E. Correa, E. Zapata, V. Gómez, G. E. Mejia, A. Restrepo, J. Robledo, and CCITB, presented at the 107th General Meeting of the American Society for Microbiology, Toronto, Canada, 2007) and have also been responsible for a prolonged outbreak of multidrug-resistant tuberculosis in Argentina (26, 29).

An intriguing question is whether M. tuberculosis strains differ in terms of pathogenic characteristics as a consequence of long-standing interactions of particular lineages with specific human populations. Animal models that take advantage of an identical genetic background, and therefore a uniform host immune response, have given insight regarding the contribution of strain genetic diversity to the outcome of the infectious process (7, 20). It is currently accepted that genetically different M. tuberculosis strains produce markedly different immunopathological events in isogenic mice (4, 18). Thus, understanding genotypic differences and mechanisms underlying infection variability and identifying specific changes or genes associated with both virulence and immunopathogenicity of the different M. tuberculosis lineages have important implications for the future effective control of tuberculosis (7, 33).

In a recent bioinformatic study using multiple genome alignments of six fully sequenced M. tuberculosis strains belonging to different lineages, we showed a trend toward accumulation of a limited number of genome-specific polymorphisms preferentially associated with circulating strains and underrepresented in laboratory strains. This suggests that such polymorphisms arise as active mechanisms of adaptation to the human host (5). We speculated that some of these genome-specific polymorphisms might be common to strains of a particular lineage rather than being an exclusive property of the isolate examined. To test this, in the present study we examined whether genome-specific polymorphisms previously identified in fully sequenced strains were present in a broader group of strains and could thus represent a lineage-wide condition. In particular, we explored whether polymorphisms identified as specific to the sequenced M. tuberculosis Haarlem strain (5) were prevalent in additional members of the Haarlem lineage and absent from other lineages. In the present paper, we report the presence of eight genomic signatures highly exclusive to the M. tuberculosis Haarlem lineage that can prove important for the rapid identification of these strains and also contribute to our understanding of the genetic variations underlying phenotypic differences among the various lineages of the tubercle bacilli.

MATERIALS AND METHODS

M. tuberculosis isolates.

A set of 40 M. tuberculosis clinical isolates belonging to the Haarlem lineage and 62 non-Haarlem isolates, including LAM, S, T, X, EIA, and Beijing, were selected from the collection of the Instituto Nacional de Enfermedades Infeccciosas ANLIS “Carlos G. Malbrán” in Buenos Aires, Argentina, and from the collection of the Centro Colombiano de Investigación en Tuberculosis (CCITB) held at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. Isolates were selected based on different IS6110 restriction fragment length polymorphism (RFLP) patterns to ensure that they represented the most conspicuous patterns of strains circulating in both settings between 1997 and 2005. Laboratory strain H37Rv was also included in the non-Haarlem group (see Fig. 2). DNA was obtained from culture lysates as described previously (25).

IS6110 RFLP typing and phylogenetic analysis.

IS6110 RFLP and spoligotype patterns (14, 35) were available at genotype databases in Buenos Aires and Medellin laboratories. Computer-assisted analysis of IS6110 RFLP patterns was performed with the software BioNumerics 5.1 (Applied Maths, Sint-Martens-Latem, Belgium) as described previously (12). Similarity between patterns was calculated using the Dice coefficient with 1% band position tolerance and 1% optimization. Cluster analysis was performed using the unweighted pair group method with arithmetic averages (UPGMA). Phylogenetic lineages and spoligo-international shared types (SITs) were assigned according to SpolDB4, available at www.pasteur-guadeloupe.fr/tb/bd_myco.htlm (3).

Primers and PCR assays.

Two sets of primers were designed for each polymorphic region to determine the presence or absence of a specific deletion in each M. tuberculosis isolate. IS6110 insertions were detected using primers that annealed with the IS6110 flanking regions, generating bands that differed in size (1,362 bp) depending on whether the IS6110 element was present or absent. Table 1 summarizes the sequences of the primers and the expected amplification products for each region. All PCRs were performed in a iCycler DNA thermal cycler (Bio-Rad) in a final volume of 50 μl containing 2.5 units of TucanTaq DNA polymerase (Corpogen, Bogotá, Colombia), 1× TucanTaq amplification buffer, 1.5 mM MgCl2, 0.5 μM each primer, 0.3 mM deoxynucleoside triphosphates (dNTPs), and 2 μl of DNA from culture lysate extracts. For detection of deletions, PCRs were carried out for 35 cycles consisting of 45 s of denaturation at 94°C, 45 s of annealing at 64°C, and 120 s of extension at 72°C. For detection of insertions, PCRs were carried out for 35 cycles consisting in 45 s of denaturation at 94°C, 45 s of annealing at 66°C for HSI1 and 71°C for HSI2, and 120 s of extension at 72°C. PCR products were verified by 1.5% agarose gel electrophoresis for the presence of a single amplification band. Five randomly chosen products for each region were sequenced using the BigDye terminator cycling conditions (Macrogen, South Korea) in order to confirm that the target region was amplified. For the detection of single-nucleotide polymorphisms (SNPs) in the ogt and ung genes, the primers and conditions reported previously for allelic discriminatory PCR were used (25).

TABLE 1.

Primers used in this study for the identification of the Haarlem-specific polymorphisms

Region or locus Lineage Primer Sequence Product Size (bp) Reference
HSD1 Haarlem hsd1 A(f) 5′ CGCTCCGTCGACAAGAGAG 2,230 This study
hsd1 B(r) 5′ TATCCTGGCGAGAATGCTGA
Non-Haarlem hsd1 C(f) 5′ ACGCGGCCCTACATCCT 1,786 This study
hsd1 B(r) 5′ TATCCTGGCGAGAATGCTGA
HSD2 Haarlem hsd2 A(f) 5′ TTGCGCGAATGTGCTTTCTC 1,840 This study
hsd2 B(r) 5′ CCGGCCGGCTCTTGTC
Non-Haarlem hsd2 A(f) 5′ TTGCGCGAATGTGCTTTCTC 3,507 This study
hsd2 C(r) 5′ CTTCGGGCCGTCTTCTTGC
HSD3 Haarlem hsd3 A(f) 5′ TAAGCCCTCAACGCGCCACC 831 This study
hsd3 B(r) 5′ GCGCTCGATCCCACGTTGT
Non-Haarlem hsd3 A(f) 5′ TAAGCCCTCAACGCGCCACC 1,737 This study
hsd3 C(r) 5′ CACACCGTCGGACCTCCTGC
HSD4 Haarlem hsd4 A(f) 5′ AACACGCCGATACCTATTTGGTC 849 This study
hsd4 B(r) 5′ CGTGAGGGCATCGAGGTGGC
Non-Haarlem hsd4 A(f) 5′ AACACGCCGATACCTATTTGGTC 1,287 This study
hsd4 B(r) 5′ CGTGAGGGCATCGAGGTGGC
HSI1 Haarlem hsi1 A(f) 5′ AATGCCGTCGTGGTCAA 2,381 This study
hsi1 B(r) 5′ CGGTTTCTCGGGTGCTAC
Non-Haarlem hsi1 A(f) 5′ AATGCCGTCGTGGTCAA 1,019 This study
hsi1 B(r) 5′ CGGTTTCTCGGGTGCTAC
HSI2 Haarlem hsi2 A(f) 5′ GGTCAGGCTGCGGGATGTT 2,280 This study
hsi2 B(r) 5′ AGCGTTGCGGGATACTCTGG
Non-Haarlem hsi2 A(f) 5′ GGTCAGGCTGCGGGATGTT 918 This study
hsi2 B(r) 5′ AGCGTTGCGGGATACTCTGG
HSSNP1 Haarlem ogt F-M(f) 5′ CCCCATCGGGCCATTAAG 545 25
ogt R(r) 5′ ACTCAGCCGCTCGCGAGC
Non-Haarlem ogt F-W(f) 5′ CCCCATCGGGCCATTAAC 545 25
ogt R(r) 5′ ACTCAGCCGCTCGCGAGC
HSSNP2 Haarlem ung F-M(f) 5′ GCTGGTGGCGATCCTA 287 25
ung R(r) 5′ GGCAACAAGAAGCGACTC
Non-Haarlem ung F-W(f) 5′ GCTGGTGGCGATCCTG 287 25
ung R(r) 5′ GGCAACAAGAAGCGACTC
DR Haarlem hsd4 IS7(f) 5′ AACACGCCGATACCTATTTGGTC This study
hsd4 INS1(r) 5′ CGTGAGGGCATCGAGGTGGC
hsd4 DR30(r) 5′ GAAACTCTTGACGATGCGGTTG

Statistical analysis.

The Fisher exact test was applied to determine significant associations between polymorphisms and M. tuberculosis lineages.

RESULTS

Specific polymorphisms in strains of the Haarlem lineage of M. tuberculosis.

Of 12 deletions and 6 insertions identified in a previous bioinformatic study as unique to the sequenced Haarlem strain (5) (www.broadinstitute.org/), we selected the most conspicuous to investigate if they were lineage-wide mutations. Specifically, the IS6110 insertions and the largest deletion polymorphisms were chosen for a preliminary analysis using PCR with four Haarlem strains. Polymorphisms spanning repetitive regions, such as Pro-Pro-Glu (PPE) family genes, were excluded from the present analysis in order to avoid possible misinterpretation. Likewise, polymorphisms of ≤200 bp were excluded because they cannot be unequivocally differentiated from intrinsic errors occurred during sequencing and finishing of the Haarlem strain genome. Results from this preliminary analysis indicated that only six polymorphisms were in fact present in the four analyzed Haarlem strains (Table 2). The occurrence of these mutations was therefore further inspected using a larger panel of epidemiologically unrelated isolates from Argentina and Colombia. For this analysis we used these six large-sequence polymorphisms and two additional SNPs located in the ogt and ung DNA repair genes previously reported by our group as specific to the Haarlem lineage (25).

TABLE 2.

Identification of indels in four M. tuberculosis Haarlem strains

Deletion or insertiona Position Size (bp) Gene product Presence in Haarlem strain:
PCR primers
1 2 3 4
HSDs
    1 912152 92 Rv0823c (Possible transcriptional regulatory protein) NDb ND ND ND
    2 965426 481 PE-PGRS15 ND ND ND ND
    3 1451173 115 Intergenic region between ThrB (threonine synthetase) and ThrC (homoserine kinase) ND ND ND ND
    4 1521604 4,753 Rv1353c (probable transcriptional regulatory protein)-Rv1354c (diguanylate cyclase protein)-MoeY (molybdopterin biosynthesis protein)-Rv1356c (hypothetical protein) + + + + 5′TAAGCCCTCAACGCGCCACC, 5′GCGCTCGATCCCACGTTGT
    5 2060412 643 PE-PGRS33 ND ND ND ND
    6 2365930 1,774 HelZ (Helicase)-Rv2102 (conserved hypothetical protein) + + + + 5′CGCTCCGTCGACAAGAGAG, 5′TATCCTGGCGAGAATGCTGA
    7 2546849 6,480 Rv2271 (hypothetical protein)-Rv2272 (probable conserved transmembrane protein)-Rv2273 (probable conserved transmembrane protein)-Rv2274c (hypothetical protein)-Rv2275 (hypothetical protein)-Cyp121 (cytochrome P450)-Rv2
     277c (probable glycerolphosphodiesterase) + + + + 5′TTGCGCGAATGTGCTTTCTC, 5′CCGGCCGGCTCTTGTC
    8 2792261 170 PE-PGRS42 ND ND ND ND
    9 3117314 439 Repeat region (DR) intergenic between Rv2813 and Rv2814 + + + + 5′CGTGAGGGCATCGAGGTGGC, 5′AACACGCCGATACCTATTTGGTC
    10 3192481 87 IS1539 Transposase contained in repeat region ND ND ND ND
    11 4033587 616 Rv3600c (conserved hypothetical protein)-PanD (aspartate decarboxylase precursor) (−) + (−) + 5′CGGGTGTTCTTCTTGGAG, 5′CGACGTGCCAGCTTAAATGA
    12 4365135 84 PPE69 and intergenic region with PE36 ND ND ND ND
HSIs
    1 2606037-2607396 1,359 Insertion of the IS6110 element on Rv2336 (hypothetical protein) + + + + 5′AATGCCGTCGTGGTCAA, 5′CGGTTTCTCGGGTGCTAC
    2 1071617-1072976 1,359 Insertion of the IS6110 element on Rv0963c (conserved hypothetical protein) + + + + 5′GGTCAGGCTGCGGGATGTT, 5′AGCGTTGCGGGATACTCTGG
    3 1714841-1716200 1,359 Insertion of the IS6110 element on Mmpl12 (transmembrane protein)c − − − − 5′CGGCGAGAAAGATGTGC, 5′TTGAGGGCGTTGACCATAG
    4 1834511-1834569 58 Rv1637c (hypothetical protein) ND ND ND ND
    5 1973210-1973436 226 PPE24 ND ND ND ND
    6 4144939-4144997 58 LeuA (2-isopropylmalate synthetase) ND ND ND ND
a

HSD, Haarlem strain deletion; HSI, Haarlem strain insertion.

b

ND, not done.

c

No amplification.

The analysis of the 102 strains indicated that the presence of all eight studied polymorphisms correlated highly with the Haarlem lineage (Table 3). For this reason, the regions displaying deletions were designated Haarlem-specific deletions (HSD1 to HSD4), and the two IS6110 element insertions were named Haarlem-specific insertions (HSI1 and HSI2). Likewise, SNPs present in genes ogt and ung were named Haarlem-specific SNPs (HSSNP1 and HSSNP2, respectively). When analyzed individually, each of these genetic events showed a highly significant association with the Haarlem lineage: HSD1 was found in 37/40 Haarlem versus 1/62 non-Haarlem strains (P < 0.00001), HSD2 and HSD3 were found in 38/40 Haarlem versus 1/62 non-Haarlem isolates (P < 0.00001), and HSD4 was found in 38/40 Haarlem versus 2/62 non-Haarlem isolates (P < 0.00001). The two insertions of the IS6110 element also correlated highly with the Haarlem lineage: HSI1 was present in 38/40 Haarlem versus 4/62 non-Haarlem isolates (P < 0.00001), and HSI2 was present 38/40 Haarlem versus 0/62 non-Haarlem strains (P < 0.00001). Lastly, and commensurate with previous reports, HSSNP1 in ogt and HSSNP2 in ung both were present in 38/40 Haarlem versus 1/62 non-Haarlem isolates (P < 0.00001).

TABLE 3.

Presence of Haarlem-specific polymorphisms in a set of 102 M. tuberculosis strains (40 belonging to the Haarlem lineage and 62 non-Haarlem)a

Lineage No. (%) of:
Isolates Deletions
Insertions
SNPs
HSD1 HSD2 HSD3 HSD4 HSI1 HSI2 HSSNP1 HSSNP2
Haarlem
    H1 17 17 17 17 17 17 17 17 17
    H2 10 10 10 10 10 10 10 10 10
    H3 12 10 11 11 11 11 11 11 11
    H4 1 0 0 0 0 0 0 0 0
    Total 40 (100) 37 (92.5) 38 (95.0) 38 (95.0) 38 (95.0) 38 (95.0) 38 (95.0) 38 (95.0) 38 (95.0)
Non-Haarlem
    LAM 28 0 0 1 0 3 0 0 0
    LAM3/S convergent 1 0 0 0 1 0 0 0 0
    S 3 0 0 0 0 0 0 0 0
    T 20 0 0 0 0 0 0 0 0
    Undetermined 4 1 1 0 1 1 0 1 1
    X 3 0 0 0 0 0 0 0 0
    EAI 1 0 0 0 0 0 0 0 0
    Beijing 1 0 0 0 0 0 0 0 0
    H37Rv 1 0 0 0 0 0 0 0 0
    Total 62 (100) 1 (1.6) 1 (1.6) 1 (1.6) 2 (3.2) 4 (6.5) 0 (0) 1 (1.6) 1 (1.6)
a

Abbreviations: H, Haarlem; LAM, Latin America and Mediterranean; EAI, East African and Indian; HSD, Haarlem-specific deletion; HSI, Haarlem-specific insertion; SNP, single-nucleotide polymorphism; HSSNP, Haarlem-specific single-nucleotide polymorphism.

Genes involved in the deletions and insertions.

The genes involved in large Haarlem-specific polymorphisms are depicted in Fig. 1. HSD1 is a 1,774-bp deletion that removes most of genes helZ and Rv2102, HSD2 is a 6,480-bp deletion that removes genes Rv2271 through Rv2278 and partially truncates lppN, HSD3 is a 4,753-bp deletion that affects genes Rv1353c through Rv1356c, and HSD4 is a 439-bp deletion within the DR locus between genes Rv2813 and Rv2814c. Insertions HSI1 and HSI2 interrupt genes Rv2336 and Rv0963c, respectively.

FIG. 1.

FIG. 1.

Haarlem-specific polymorphisms. Genes involved in four Haarlem-specific deletions (HSD1 to HSD4) and two Haarlem-specific insertions (HSI1 and HSI2) are shown. The upper part of each horizontal panel represents the wild-type sequence, and the lower part represents the Haarlem genotype.

Detailed examination of the Haarlem isolates in the set showed that every strain classified within the H1 and the H2 subfamilies consistently displayed all polymorphisms, as did 10 out of 12 strains classified within the H3 subfamily (Table 3). Another H3 strain (isolate no. 1511) displayed seven of the eight analyzed polymorphisms. In contrast, two isolates (no. 1633 and 1089, of the H3 and H4 subfamilies, respectively), did not have any of these polymorphisms. Consistently, these two isolates did not fit within the Haarlem branch in the IS6110 RFLP dendrogram constructed with the whole set of M. tuberculosis strains used in this study (Fig. 2). On the other hand, the large majority of isolates belonging to non-Haarlem lineages did not contain these polymorphic regions (Table 3). More importantly, only 6 out of 62 non-Haarlem strains displayed some of these polymorphisms, and none of these six strains harbored all of them. Five of them belonged to the LAM lineage and carried only one Haarlem-specific polymorphism each, suggesting a certain relationship with the Haarlem lineage or, alternatively, an evolutionary process involving similar selection pressures (Table 3 and Fig. 2, DNA numbers UT89, UT272, 1632, 1506, and 1516). The sixth strain, which had an undefined (U) lineage, appeared to be fairly close to the Haarlem family by both IS6110 pattern and spoligotype, and its relatedness to this lineage was confirmed by its displaying six out of the eight Haarlem-specific polymorphisms (Fig. 2, DNA UT148).

FIG. 2.

FIG. 2.

Dendrogram of clinical isolates. IS6110 RFLP and spoligopatterns of 101 clinical isolates from Colombia (CO) and Argentina (AR), obtained between 1997 and 2005, and of laboratory strain H37Rv are shown. The IS6110 RFLP dendrogram was constructed using arithmetic average linkages and the Dice coefficient with the software BioNumerics v 5.1 (Applied Maths, St-Martens-Latem, Belgium). Spoligo-shared types (SITs) and lineages were assigned according to the SITVIT database (http://www.pasteur-guadeloupe.fr:8081/SITVITDemo/). The 38 isolates sharing all eight polymorphisms here postulated as Haarlem specific are indicated with arrows, two isolates displaying six or seven of these polymorphisms are marked with stars, two isolates classified as Haarlem according to SITVIT and lacking these polymorphisms are indicated with crossed squares, and the five isolates marked with dots displayed only one of the eight Haarlem-specific polymorphisms.

Genomic organization of the DR locus in Haarlem strains.

The HSD4 deletion mapped to the DR region and eliminated spacers 26 to 31. PCR was positive for this deletion in all Haarlem 1 and 2 subfamilies and in 11 out of 12 strains belonging to Haarlem 3 subfamily (Fig. 2). This deletion explains clearly the spoligotype observed in M. tuberculosis strains of the Haarlem 1 and 2 subfamilies, which are characterized by the absence of those six spacers. However, most strains of the H3 subfamily lack only spacer 31 in the spoligotyping despite the presence of spacers 26 through 30. In order to understand the DR organization in H3, we designed primers to amplify the DR locus between spacers 30 to 32 and between the IS6110 and these spacers in strains belonging to Haarlem subfamilies 1, 2, and 3. Figure 3 shows a schematic representation of the DR locus organization in the Haarlem lineage in the H1, H2, and H3 subfamilies. A deletion of spacers 26 to 31 was confirmed by sequencing in all six analyzed strains belonging to H1 and H2. The sequence of H3 showed a different DR locus organization. We identified the presence of spacers 26 to 31 downstream of the ancestral IS6110 insertion, followed by an extra copy of the insertion element together with spacers 25 and 32. This organization was further confirmed by comparison with the Haarlem strain sequenced by the Broad Institute (www.broadinstitute.org/). The identity was 100%, indicating that the sequenced strain belongs to the Haarlem 3 subfamily.

FIG. 3.

FIG. 3.

Proposed evolution of the Haarlem DR locus. A schematic representation of hypothetical changes in the direct repeat (DR) locus of Mycobacterium tuberculosis Haarlem strains is shown. H3 probably arose due to a duplication of IS6110, together with spacer 25. A deletion, probably mediated by IS6110 recombination, including 25 to 31 spacers generated H1. H2 could be the result of an ulterior large deletion of all spacers upstream of IS6110. Insertion of IS6110 is shown as a triangle. Partial deletion of IS6110 is shown as an arrow. Numbered bars represent consecutive spacers between DRs.

DISCUSSION

The Haarlem family was described in the Netherlands in 1999 (15). The family is highly diverse and has been amply studied to better understand its evolutionary history. In previous work, we identified two SNPs in DNA repair genes, ung and ogt, present in all analyzed Haarlem strains (25). In the present study we report additional markers that can constitute a genomic signature of the Haarlem family. These genomic markers include six specific large polymorphisms (four deletions and two IS6110 insertions) along with the two previously described SNPs in ung and ogt. Three of the deletions involved in these specific polymorphisms have been previously reported in 5 out of 100 clinical isolates analyzed by microarray technology from a collection of epidemiologically well-characterized isolates from San Francisco (34). Four of these strains belong to the Haarlem family and the other one to the U lineage (M. Kato-Maeda, personal communication), reinforcing the idea that these are Haarlem-specific polymorphisms. The fact that strains from different geographical origins such as Argentina, Colombia, and the United States share the same specific polymorphisms prompts us to propose that these mutations are widely distributed.

The high frequency of these polymorphisms within one of the most widespread and successful genotypes can have key biological significance. In particular, these Haarlem-specific polymorphisms may have important functional consequences for the tubercle bacilli and be relevant in terms of strategies for disease control. This is especially evident with respect to the validity of some recently proposed drug targets. Gene Rv1354c, for example, which codes for the only identified putative diguanylate cyclase in the genome, is associated with the inner membrane (22) and thought to be involved in the turnover of cyclic-di-GMP, a multifunctional second-messenger molecule exclusive of the bacterial domain. Based on this, Rv1354c has been recently proposed as an ideal target for the design of new drugs (6). However, gene Rv1354c is completely deleted in our Haarlem strains as part of HSD3, indicating that strains with this genotype can dispose of this protein and signaling pathway without losing their capacity to infect and cause disease. Thus, gene Rv1354c cannot be considered a suitable antituberculosis drug target (6). Similarly, the cytochrome P450 gene cyp121 was shown to be essential for M. tuberculosis H37Rv viability and was proposed as a novel target for azole drugs (24). This gene, however, is also deleted in Haarlem strains as part of HSD2, making necessary a reevaluation of the antimicrobial activity in circulating strains. The results obtained here underscore the importance of strain diversity and the need to identify a core set of genes common to all M. tuberculosis lineages as a crucial step in the development of new antituberculosis drugs.

Likewise, genetic variation can reflect differences in antigenic repertoire composition among the different lineages of M. tuberculosis, as pointed out previously (34) and exemplified here by deletion of the transmembrane proteins Rv2272 and Rv2273 as part of HSD2. Consequently, vaccine candidates should be effective against challenge not only with laboratory strains but also with strains representative of the major lineages of the global population of M. tuberculosis.

In addition to these, other genes affected in Haarlem strains could result in important phenotypic changes. Genes Rv2274c and Rv2274A, absent due to HSD2, have been annotated among the 38 toxin-antitoxin (TA) operons present in the M. tuberculosis genome (1, 27). It has been proposed that these systems can fulfill a variety of roles associated with retardation of cell growth and persistence in stressful environments (1). The IS6110 element insertion in HSI1 interrupts Rv2336, a gene that has been implicated in virulence because it is downregulated in the attenuated strain H37Ra (28). No obvious phenotypic effects can be inferred from the other specific polymorphisms identified here, i.e., HSD1, HSI2, HSSNP1, and HSSNP2, and additional functional analysis of these mutations would be required.

A striking result of our analysis is that the lineage classification given by spoligotyping matches almost perfectly with the one resulting from the presence of these Haarlem-specific polymorphisms and also with the Haarlem branch in the RFLP IS6110 dendrogram (Fig. 2). HSI1 and HSI2 result from the integration of the IS6110 element and are proposed to be the categorical markers of the RFLP IS6110 pattern observed in the Haarlem lineage; likewise, HSD4 encompasses the deletion of the DR spacers that give Haarlem strains their unique spoligotyping pattern. This observation demonstrates that the classification given by the polymorphisms reported here is linked with the most commonly used genotyping methods, showing the usefulness of these new markers in phylogenetic studies. The results presented here reinforce the idea that Haarlem is indeed a distinct phylogenetic group.

Another interesting result comes from the analysis of the DR region in Haarlem family strains. Based on our findings and the spoligotyping patterns, we propose the following scenario for the evolution of the Haarlem DR region (Fig. 3). The organization seen in H3 most probably arose due to a duplication of IS6110, together with spacer 25. The insertion of an extra copy of IS6110 was previously described (9, 16). A deletion, possibly mediated by IS6110 recombination, could then generate the observed distribution of the locus in H1, and finally, the H2 DR organization could have arisen as the result of a spacer-mediated recombination that eliminated the 5′ region of the DR encompassing the first spacers up to the IS6110. An alternative explanation for the H3 DR locus organization could be that it resulted from a recombination event between different strains, as was previously suggested for M. tuberculosis (17). In addition to contributing to understanding the organization of the DR locus, our results also indicate that changes in this region, which is the basis for spoligotyping lineage assignment, correlate with changes in other regions of the genome, some of which may affect the physiology of the tubercle bacilli and contribute to the establishment and worldwide spread of successful lineages.

Increased resolution of the phylogeny of Euro-American lineages is needed to provide more accurate data for evolutionary, epidemiological, and public health applications. In this respect, our findings fully support results of a recent SNP study (Christophe Sola, personal communication) indicating that some spoligotypes classified as Haarlem in SpolDB4 (3), especially those defined as H4, are not related to this family and that a more stringent definition is needed for this group. The Haarlem-specific mutations described here may be used to optimize a single-target PCR and/or to include the best-fitted target in multiplex assays aimed to classify strains into the main strain families. Indeed, studies associating distinct lineages with patient clinical and epidemiologic traits will improve our understanding of disease pathogenesis and improve current control measures, thus preventing further spread of epidemic strains.

A recent analysis of M. tuberculosis complex strains indicated that much of the observed genetic diversity has phenotypic consequences and that purifying selection is severely reduced in this highly clonal population, which suffers constant bottlenecks, produced when a single cell is enough to establish an infection (13). In this respect, the identification of genomic changes unique to the Haarlem lineage can provide a basis from which to begin to unravel some of the specific phenotypic characteristics that distinguish this particular genotype from the rest of the M. tuberculosis lineages.

Acknowledgments

This work was supported by Colciencias grant 431-2004, the Colombian Center for Excellence in Tuberculosis Research (CCITB), CYTED grant 207RT0311, and grant FP7-HEALTH-2007-A-201690 from the EC.

Footnotes

▿

Published ahead of print on 14 July 2010.

REFERENCES

  • 1.Arcus, V. L., P. B. Rainey, and S. J. Turner. 2005. The PIN-domain toxin-antitoxin array in mycobacteria. Trends Microbiol. 13:360-365. [DOI] [PubMed] [Google Scholar]
  • 2.Berrington, W. R., and T. R. Hawn. 2007. Mycobacterium tuberculosis, macrophages, and the innate immune response: does common variation matter? Immunol. Rev. 219:167-186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Brudey, K., J. R. Driscoll, L. Rigouts, W. M. Prodinger, A. Gori, S. A. Al-Hajoj, C. Allix, L. Aristimuno, J. Arora, V. Baumanis, L. Binder, P. Cafrune, A. Cataldi, S. Cheong, R. Diel, C. Ellermeier, J. T. Evans, M. Fauville-Dufaux, S. Ferdinand, D. Garcia de Viedma, C. Garzelli, L. Gazzola, H. M. Gomes, M. C. Guttierez, P. M. Hawkey, P. D. van Helden, G. V. Kadival, B. N. Kreiswirth, K. Kremer, M. Kubin, S. P. Kulkarni, B. Liens, T. Lillebaek, M. L. Ho, C. Martin, I. Mokrousov, O. Narvskaia, Y. F. Ngeow, L. Naumann, S. Niemann, I. Parwati, Z. Rahim, V. Rasolofo-Razanamparany, T. Rasolonavalona, M. L. Rossetti, S. Rusch-Gerdes, A. Sajduda, S. Samper, I. G. Shemyakin, U. B. Singh, A. Somoskovi, R. A. Skuce, D. van Soolingen, E. M. Streicher, P. N. Suffys, E. Tortoli, T. Tracevska, V. Vincent, T. C. Victor, R. M. Warren, S. F. Yap, K. Zaman, F. Portaels, N. Rastogi, and C. Sola. 2006. Mycobacterium tuberculosis complex genetic diversity: mining the fourth international spoligotyping database (SpolDB4) for classification, population genetics and epidemiology. BMC Microbiol. 6:23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Caws, M., G. Thwaites, S. Dunstan, T. R. Hawn, N. T. Lan, N. T. Thuong, K. Stepniewska, M. N. Huyen, N. D. Bang, T. H. Loc, S. Gagneux, D. van Soolingen, K. Kremer, M. van der Sande, P. Small, P. T. Anh, N. T. Chinh, H. T. Quy, N. T. Duyen, D. Q. Tho, N. T. Hieu, E. Torok, T. T. Hien, N. H. Dung, N. T. Nhu, P. M. Duy, N. van Vinh Chau, and J. Farrar. 2008. The influence of host and bacterial genotype on the development of disseminated disease with Mycobacterium tuberculosis. PLoS Pathog. 4:e1000034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cubillos-Ruiz, A., J. Morales, and M. M. Zambrano. 2008. Analysis of the genetic variation in Mycobacterium tuberculosis strains by multiple genome alignments. BMC Res. Notes 1:110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cui, T., L. Zhang, X. Wang, and Z. G. He. 2009. Uncovering new signaling proteins and potential drug targets through the interactome analysis of Mycobacterium tuberculosis. BMC Genomics 10:118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Dormans, J., M. Burger, D. Aguilar, R. Hernandez-Pando, K. Kremer, P. Roholl, S. M. Arend, and D. van Soolingen. 2004. Correlation of virulence, lung pathology, bacterial load and delayed type hypersensitivity responses after infection with different Mycobacterium tuberculosis genotypes in a BALB/c mouse model. Clin. Exp. Immunol. 137:460-468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Duchene, V., S. Ferdinand, I. Filliol, J. F. Guegan, N. Rastogi, and C. Sola. 2004. Phylogenetic reconstruction of Mycobacterium tuberculosis within four settings of the Caribbean region: tree comparative analyse and first appraisal on their phylogeography. Infect. Genet. Evol. 4:5-14. [DOI] [PubMed] [Google Scholar]
  • 9.Filliol, I., C. Sola, and N. Rastogi. 2000. Detection of a previously unamplified spacer within the DR locus of Mycobacterium tuberculosis: epidemiological implications. J. Clin. Microbiol. 38:1231-1234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gagneux, S., K. DeRiemer, T. Van, M. Kato-Maeda, B. C. de Jong, S. Narayanan, M. Nicol, S. Niemann, K. Kremer, M. C. Gutierrez, M. Hilty, P. C. Hopewell, and P. M. Small. 2006. Variable host-pathogen compatibility in Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U. S. A. 103:2869-2873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gagneux, S., and P. M. Small. 2007. Global phylogeography of Mycobacterium tuberculosis and implications for tuberculosis product development. Lancet Infect. Dis. 7:328-337. [DOI] [PubMed] [Google Scholar]
  • 12.Heersma, H. F., K. Kremer, and J. D. van Embden. 1998. Computer analysis of IS6110 RFLP patterns of Mycobacterium tuberculosis. Methods Mol. Biol. 101:395-422. [DOI] [PubMed] [Google Scholar]
  • 13.Hershberg, R., M. Lipatov, P. M. Small, H. Sheffer, S. Niemann, S. Homolka, J. C. Roach, K. Kremer, D. A. Petrov, M. W. Feldman, and S. Gagneux. 2008. High functional diversity in Mycobacterium tuberculosis driven by genetic drift and human demography. PLoS Biol. 6:e311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kamerbeek, J., L. Schouls, A. Kolk, M. van Agterveld, D. van Soolingen, S. Kuijper, A. Bunschoten, H. Molhuizen, R. Shaw, M. Goyal, and J. van Embden. 1997. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J. Clin. Microbiol. 35:907-914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kremer, K., D. van Soolingen, R. Frothingham, W. H. Haas, P. W. Hermans, C. Martin, P. Palittapongarnpim, B. B. Plikaytis, L. W. Riley, M. A. Yakrus, J. M. Musser, and J. D. van Embden. 1999. Comparison of methods based on different molecular epidemiological markers for typing of Mycobacterium tuberculosis complex strains: interlaboratory study of discriminatory power and reproducibility. J. Clin. Microbiol. 37:2607-2618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Legrand, E., I. Filliol, C. Sola, and N. Rastogi. 2001. Use of spoligotyping to study the evolution of the direct repeat locus by IS6110 transposition in Mycobacterium tuberculosis. J. Clin. Microbiol. 39:1595-1599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Liu, X., M. M. Gutacker, J. M. Musser, and Y. X. Fu. 2006. Evidence for recombination in Mycobacterium tuberculosis. J. Bacteriol. 188:8169-8177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lopez, B., D. Aguilar, H. Orozco, M. Burger, C. Espitia, V. Ritacco, L. Barrera, K. Kremer, R. Hernandez-Pando, K. Huygen, and D. van Soolingen. 2003. A marked difference in pathogenesis and immune response induced by different Mycobacterium tuberculosis genotypes. Clin. Exp. Immunol. 133:30-37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Malik, A. N., and P. Godfrey-Faussett. 2005. Effects of genetic variability of Mycobacterium tuberculosis strains on the presentation of disease. Lancet Infect. Dis. 5:174-183. [DOI] [PubMed] [Google Scholar]
  • 20.Marquina-Castillo, B., L. Garcia-Garcia, A. Ponce-de-Leon, M. E. Jimenez-Corona, M. Bobadilla-Del Valle, B. Cano-Arellano, S. Canizales-Quintero, A. Martinez-Gamboa, M. Kato-Maeda, B. Robertson, D. Young, P. Small, G. Schoolnik, J. Sifuentes-Osornio, and R. Hernandez-Pando. 2009. Virulence, immunopathology and transmissibility of selected strains of Mycobacterium tuberculosis in a murine model. Immunology 128:123-133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Mathema, B., N. E. Kurepina, P. J. Bifani, and B. N. Kreiswirth. 2006. Molecular epidemiology of tuberculosis: current insights. Clin. Microbiol. Rev. 19:658-685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mawuenyega, K. G., C. V. Forst, K. M. Dobos, J. T. Belisle, J. Chen, E. M. Bradbury, A. R. Bradbury, and X. Chen. 2005. Mycobacterium tuberculosis functional network analysis by global subcellular protein profiling. Mol. Biol. Cell 16:396-404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.McEvoy, C. R., A. A. Falmer, N. C. Gey van Pittius, T. C. Victor, P. D. van Helden, and R. M. Warren. 2007. The role of IS6110 in the evolution of Mycobacterium tuberculosis. Tuberculosis (Edinb.) 87:393-404. [DOI] [PubMed] [Google Scholar]
  • 24.McLean, K. J., P. Carroll, D. G. Lewis, A. J. Dunford, H. E. Seward, R. Neeli, M. R. Cheesman, L. Marsollier, P. Douglas, W. E. Smith, I. Rosenkrands, S. T. Cole, D. Leys, T. Parish, and A. W. Munro. 2008. Characterization of active site structure in CYP121. A cytochrome P450 essential for viability of Mycobacterium tuberculosis H37Rv. J. Biol. Chem. 283:33406-33416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Olano, J., B. Lopez, A. Reyes, M. P. Lemos, N. Correa, P. Del Portillo, L. Barrera, J. Robledo, V. Ritacco, and M. M. Zambrano. 2007. Mutations in DNA repair genes are associated with the Haarlem lineage of Mycobacterium tuberculosis independently of their antibiotic resistance. Tuberculosis (Edinb.) 87:502-508. [DOI] [PubMed] [Google Scholar]
  • 26.Palmero, D., V. Ritacco, M. Ambroggi, N. Marcela, L. Barrera, L. Capone, A. Dambrosi, M. di Lonardo, N. Isola, S. Poggi, M. Vescovo, and E. Abbate. 2003. Multidrug-resistant tuberculosis in HIV-negative patients, Buenos Aires, Argentina. Emerg. Infect. Dis. 9:965-969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Pandey, D. P., and K. Gerdes. 2005. Toxin-antitoxin loci are highly abundant in free-living but lost from host-associated prokaryotes. Nucleic Acids Res. 33:966-976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Rindi, L., N. Lari, and C. Garzelli. 1999. Search for genes potentially involved in Mycobacterium tuberculosis virulence by mRNA differential display. Biochem. Biophys. Res. Commun. 258:94-101. [DOI] [PubMed] [Google Scholar]
  • 29.Ritacco, V., M. Di Lonardo, A. Reniero, M. Ambroggi, L. Barrera, A. Dambrosi, B. Lopez, N. Isola, and I. N. de Kantor. 1997. Nosocomial spread of human immunodeficiency virus-related multidrug-resistant tuberculosis in Buenos Aires. J. Infect. Dis. 176:637-642. [DOI] [PubMed] [Google Scholar]
  • 30.Sampson, S. L., R. M. Warren, M. Richardson, G. D. van der Spuy, and P. D. van Helden. 1999. Disruption of coding regions by IS6110 insertion in Mycobacterium tuberculosis. Tuber. Lung Dis. 79:349-359. [DOI] [PubMed] [Google Scholar]
  • 31.Schmidt, C. W. 2008. Linking TB and the environment: an overlooked mitigation strategy. Environ. Health Perspect. 116:A478-A485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Suchindran, S., E. S. Brouwer, and A. Van Rie. 2009. Is HIV infection a risk factor for multi-drug resistant tuberculosis? A systematic review. PLoS One 4:e5561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Thwaites, G., M. Caws, T. T. Chau, A. D'Sa, N. T. Lan, M. N. Huyen, S. Gagneux, P. T. Anh, D. Q. Tho, E. Torok, N. T. Nhu, N. T. Duyen, P. M. Duy, J. Richenberg, C. Simmons, T. T. Hien, and J. Farrar. 2008. Relationship between Mycobacterium tuberculosis genotype and the clinical phenotype of pulmonary and meningeal tuberculosis. J. Clin. Microbiol. 46:1363-1368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tsolaki, A. G., A. E. Hirsh, K. DeRiemer, J. A. Enciso, M. Z. Wong, M. Hannan, Y. O. Goguet de la Salmoniere, K. Aman, M. Kato-Maeda, and P. M. Small. 2004. Functional and evolutionary genomics of Mycobacterium tuberculosis: insights from genomic deletions in 100 strains. Proc. Natl. Acad. Sci. U. S. A. 101:4865-4870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.van Embden, J. D., M. D. Cave, J. T. Crawford, J. W. Dale, K. D. Eisenach, B. Gicquel, P. Hermans, C. Martin, R. McAdam, T. M. Shinnick, et al. 1993. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J. Clin. Microbiol. 31:406-409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.WHO. 2008. Global tuberculosis control. Surveillance, planning, financing. WHO report 2008. WHO, Geneva, Switzerland.

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES