Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2010 Aug 18;84(21):11407–11417. doi: 10.1128/JVI.01159-10

RNA Structures Required for Production of Subgenomic Flavivirus RNA▿

Anneke Funk 1, Katherine Truong 1, Tomoko Nagasaki 1, Shessy Torres 1, Nadia Floden 1, Ezequiel Balmori Melian 1, Judy Edmonds 1, Hongping Dong 2, Pei-Yong Shi 2, Alexander A Khromykh 1,*
PMCID: PMC2953152  PMID: 20719943

Abstract

Flaviviruses are a group of single-stranded, positive-sense RNA viruses causing ∼100 million infections per year. We have recently shown that flaviviruses produce a unique, small, noncoding RNA (∼0.5 kb) derived from the 3′ untranslated region (UTR) of the genomic RNA (gRNA), which is required for flavivirus-induced cytopathicity and pathogenicity (G. P. Pijlman et al., Cell Host Microbe, 4: 579-591, 2008). This RNA (subgenomic flavivirus RNA [sfRNA]) is a product of incomplete degradation of gRNA presumably by the cellular 5′-3′ exoribonuclease XRN1, which stalls on the rigid secondary structure stem-loop II (SL-II) located at the beginning of the 3′ UTR. Mutations or deletions of various secondary structures in the 3′ UTR resulted in the loss of full-length sfRNA (sfRNA1) and production of smaller and less abundant sfRNAs (sfRNA2 and sfRNA3). Here, we investigated in detail the importance of West Nile virus Kunjin (WNVKUN) 3′ UTR secondary structures as well as tertiary interactions for sfRNA formation. We show that secondary structures SL-IV and dumbbell 1 (DB1) downstream of SL-II are able to prevent further degradation of gRNA when the SL-II structure is deleted, leading to production of sfRNA2 and sfRNA3, respectively. We also show that a number of pseudoknot (PK) interactions, in particular PK1 stabilizing SL-II and PK3 stabilizing DB1, are required for protection of gRNA from nuclease degradation and production of sfRNA. Our results show that PK interactions play a vital role in the production of nuclease-resistant sfRNA, which is essential for viral cytopathicity in cells and pathogenicity in mice.


Arthropod-borne flaviviruses such as West Nile virus (WNV), dengue virus (DENV), and Japanese encephalitis virus (JEV) cause major outbreaks of potentially fatal disease and affect over 50 million people every year. The highly pathogenic North American strain of WNV (WNVNY99) has already claimed more than 1,000 lives with over 27,000 cases reported since its emergence in New York in 1999 and has raised global public health concerns (9). In contrast, the closely related Australian strain of WNV, WNVKUN, is highly attenuated and does not cause overt disease in humans and animals (11). WNVKUN has been used extensively as a model virus to study flavivirus replication and flavivirus-host interactions (13, 14, 16-19, 26, 38, 39).

The ∼11-kb positive-stranded, capped WNV genomic RNA (gRNA) lacks a poly(A) tail and consists of 5′ and 3′ untranslated regions (UTRs) flanking one open reading frame, which encodes the viral proteins required for the viral life cycle (6, 15, 38, 39). Flavivirus UTRs are involved in translation and initiation of RNA replication and likely determine genome packaging (13, 14, 16, 21, 30, 39-41). Both the 5′ UTR (∼100 nucleotides [nt] in size) and the 3′ UTR (from ∼400 to 700 nucleotides) can form secondary and tertiary structures which are highly conserved among mosquito-borne flaviviruses (1, 8, 10, 14, 29, 32, 34). More specifically, the WNVKUN 3′ UTR consists of several conserved regions and secondary structures (Fig. 1A) which were previously predicted or shown to exist in various flaviviruses by computational and chemical analyses, respectively (4, 10, 25, 26, 29-32). The 5′ end of the 3′ UTR starts with an AU-rich region which can form stem-loop structure I (SL-I) followed by SL-II, which we previously showed to be vitally important for subgenomic flavivirus RNA (sfRNA) production (26; see also below). SL-II is followed by a short, repeated conserved hairpin (RCS3) and SL-III (26). Further downstream of SL-III are the SL-IV and CS3 structures, which are remarkably similar to the preceding SL-II-RCS3 structure (26, 29). Further downstream of the SL-IV-CS3 structure are dumbbells 1 and 2 (DB1 and DB2, respectively) followed by a short SL and the 3′ SL (25, 26).

FIG. 1.

FIG. 1.

(A) Model of the WNVKUN 3′ UTR RNA structure. Highlighted in bold are the secondary structures investigated here. Dashed lines indicate putative PKs. The two sites of the putative PK interactions are shown in open boxes. sfRNA1, -2, -3, and -4 start sites are indicated by arrows. (R)CS, (repeated) conserved sequence; DB, dumbbell structure; PK, pseudoknot; SL, stem-loop. (B) Structural model of PK1 in SL-II with disruptive mutations. Nucleotide numbering is from the end of the 3′ UTR. The sfRNA1 start is indicated by an arrow. Nucleotides forming PK1 are on a gray background, and mutated nucleotides are white on a black background. (C) Sequences mutated in the different constructs. Nucleotides in the wt PK sequences used for mutations are bold and underlined. Introduced mutations are shown under the corresponding nucleotides in the wt sequence.

The described structures have been investigated in some detail for their requirement in RNA replication and translation. Generally, a progressive negative effect on viral growth was shown with progressive deletions into the 3′-proximal region of the JEV 3′ UTR (41). However, only a relatively short region of the JEV 3′ UTR, consisting of the 3′-terminal 193 nt, was shown to be absolutely essential for gRNA replication (41). The minimal region for DENV replication was reported to be even shorter (23). Extensive analysis has shown that the most 3′-terminal, essential regions of the 3′ UTR include the cyclization sequence and 3′ SL, which are required for efficient RNA replication (2, 14, 16, 23, 35). As we showed, deletion of SL-II or SL-I did not overtly affect WNVKUN replication (26). However, deletion of CS2, RCS2, CS3, or RCS3 in WNV replicon RNA significantly reduced RNA replication but not translation (20), indicating that these elements facilitate but are not essential for RNA replication. In addition, it was shown that deletion of DB1 or DB2 resulted in a viable mutant virus that was reduced in growth efficiency, while deletion of both DB structures resulted in a nonviable mutant (23).

In addition to the above-mentioned secondary stem-loop structures, computational and chemical analysis of the flavivirus 3′ UTR suggested the presence of 5 pseudoknot (PK) interactions (Fig. 1A) (25, 26, 32). A PK is a structure formed upon base pairing of a single-stranded region of RNA in the loop of a hairpin to a stretch of complementary nucleotides elsewhere in the RNA chain (Fig. 1B). These structures are referred to as hairpin type (H-type) PKs (3), and they usually stabilize secondary RNA structures. Typically, the final tertiary structure does not significantly alter the preformed secondary structure (5). In general, PK interactions have been shown to be important in biological processes such as initiation and/or elongation of translation, initiation of gRNA replication, and ribosomal frameshifting for a number of different viruses, including flaviviruses (reviewed in references 3 and 22). The first PK in the WNV 3′ UTR was predicted to form in SL-II, followed by a similar PK in SL-IV (26) (PK1 and PK2 in Fig. 1A). For the DENV, yellow fever virus (YFV), and JEV subgroup of flaviviruses, two PKs further downstream were predicted to form between DB1 and DB2 and corresponding single-stranded RNA regions located further downstream (25) (PK3 and PK4 in Fig. 1A). The formation of these structures is supported by covariations in the WNV RNAs. In addition, a PK was proposed to form between a short SL and the 3′ SL at the 3′ terminus of the viral genome (32) (PK5 in Fig. 1A).

Importantly, in addition to its role in viral replication and translation, we have shown that the WNVKUN 3′ UTR is important for the production of a small noncoding RNA fragment designated sfRNA (26). This short RNA fragment of ∼0.5 kb is derived from the 3′ UTR of the gRNA and exclusively produced by the members of the Flavivirus genus of the Flaviviridae family, where it is required for efficient viral replication, cytopathicity, and pathogenicity (26). Our studies suggested that sfRNA is a product of incomplete degradation of the gRNA presumably by the cellular 5′-3′ exoribonuclease XRN1, resulting from XRN1 stalling on the rigid secondary/tertiary structures located at the beginning of the 3′ UTR (26). XRN1 is an exoribonuclease which usually degrades mRNA from the 5′ to the 3′ end as part of cellular mRNA decay and turnover (33), and it was shown previously that XRN1 can be stalled by SL structures (28). Mutations or deletions of WNV 3′ UTR secondary structures resulted in the loss of full-length sfRNA (sfRNA1) and production of smaller and less abundant sfRNAs (sfRNA2 and sfRNA3) (26). In particular, SL-II (Fig. 1A) was shown to be important for sfRNA1 production; deletion of this structure either alone or in conjunction with other structures located downstream of SL-II abolished sfRNA1 production, leading to the production of the smaller RNA fragments sfRNA2 and sfRNA3.

Here, we extended our investigation and studied the importance of several predicted 3′ UTR secondary structures and PK interactions for the production of sfRNA. To further understand the generation mechanism of sfRNA and its requirements, we deleted or mutated a number of RNA structures in the WNVKUN 3′ UTR and investigated the size and amount of sfRNA generated from these mutant RNAs. The results show that not only SLs but also PK interactions play a vital role in stabilizing the 3′ UTR RNA and preventing complete degradation of viral gRNA to produce nuclease-resistant sfRNA, which is required for efficient virus replication and cytopathicity in cells and virulence in mice.

MATERIALS AND METHODS

Plasmid construction.

Mutagenesis of the WNVKUN 3′ UTR was done in the subclone pBS-3′XX containing the 3′ UTR in the pBluescript II KS vector by using PCR site-directed mutagenesis. Mutated 3′ UTR fragments were then cloned into the replicon Sp6KUNrep3βgal and full-length clone FLSDX (pro)_HDVr (designated FLSDX) as described previously (26). Plasmid Sp6rep3βgalΔSL-II was described previously (26). Primers used for mutagenesis are listed in Table 1, and PCR conditions are available on request.

TABLE 1.

Primers used in this study

Name Sequence (5′-3′) Construct
PK1F GAAGCTCACTAGACGGTGC PK1′
PK1R CTAGTGAGCTTCCGGTGG PK1′
PK1′F GCGAGTGAGCCCCAGGAG PK1″
PK1′R GGCTCACTCGCAGGCAGCA PK1″
PK2F TCTCGCGAGAGTGCAGTC PK2′
PK2R CTCGCGAGAGTGGCAC PK2′
PK2′F CAGGCGCCCAGGAGGAC PK2″
PK2′R TGGGCGCCTGTCGCAGACT PK2″
PK3 F CAATCCTCTTAACCAGAGTGAA PK3′
PK3 R GGTTAAGAGGATTGCCAGAG PK3′
PK3′ F CAAAAGAGGACAACAACACAGC PK3″
PK3′ R TTGTCCTCTTTTGCGGCA PK3″
dSL-IV F GTGCCCCAGGAGGACTGGGTGAACAA ΔSL-IV
dSL-IV R GTCCTCCTGGGGCACACGCGTTTGGGCCTTGAAGCT ΔSL-IV
dDB1 F TCTGAAGTGCACGGCCCAGCCTG ΔDB1
dDB1 R GCCGTGCACTTCAGAACGCGTACGTTGATTCGCCTT ΔDB1

Investigation of replicon RNA replication and sfRNA formation.

BHK-21, Vero, and C6/36 cells were grown as described previously (26). RNA in vitro transcription and electroporation into BHK-21 cells to investigate replicon RNA replication and sfRNA formation were done essentially as described previously (26). As a marker for RNA replication, the amount of β-galactosidase was quantified 72 h after electroporation using the β-galactosidase enzyme assay system from Promega according to the manufacturer's protocol. Each experiment was independently repeated 3 times, mock values were subtracted, and the standard deviation (SD) was calculated. To investigate sfRNA formation, RNA from electroporated BHK-21 cells was isolated 72 h after electroporation or at the indicated time points after infection of C6/36 or Vero cells using Trizol (Invitrogen). Northern blotting of isolated RNA using a 3′-UTR-specific probe was then performed as described previously (26). The blots were scanned in a Typhoon 9400 phosphorimager (GE Healthcare), and the ratio of gRNA to sfRNA was calculated using ImageQuant 5.2 software (Molecular Dynamics) based on density readings of gRNA bands and bands for sfRNAs (combined if more than 1) from scanned images.

Virus production, viral growth kinetics, and plaque assay.

Virus production, viral growth kinetics, and plaque assays were all performed essentially as described previously (26). Briefly, in vitro-transcribed RNA was electroporated into BHK-21 cells, and cell culture supernatants were harvested after 3 days. Viral titers were determined by standard plaque assay on BHK-21 cells. For viral growth curves, C6/36 or Vero cells were infected at a multiplicity of infection (MOI) of 1 and supernatant and cells were harvested at the indicated time points. Each experiment was independently repeated at least 3 times, and the SD was calculated.

RNase probing.

The RNA structure representing SL-II, PK1, and RCS3 of the WNVKUN genome was analyzed by RNase structure probing. The details of RNA preparation and RNase analysis were described previously (7). Briefly, the RNA, spanning nucleotides −527 to −448 of the 3′ terminus of the viral genome, was in vitro transcribed from a PCR-generated DNA template containing a T7 promoter. The RNA was 5′ end labeled with [α-32P]GTP using a vaccinia virus capping enzyme (Epicentre). The resulting G*pppA-RNA (the asterisk indicates that the following phosphate is 32P labeled) was purified through an 8% polyacrylamide denaturing gel. For structure probing, approximately 4 × 105 cpm of labeled RNA and 10 μg yeast carrier RNA were diluted in 20 μl structure probing buffer (Ambion). The RNA structure was formed in solution by heating at 85°C for 1 min followed by slow cooling to room temperature. The RNA was digested with 0.8 U of RNase V1 (Ambion) and 20 U of RNase I (Ambion) at room temperature for 10 min. For preparation of G ladder, 4 × 105 cpm of labeled RNA and 10 μg yeast RNA in 10 μl sequencing buffer (Ambion) were digested with 1 U RNase T1 (Ambion) at room temperature for 10 min. The OH hydrolysis ladder was generated by incubation of 4 × 105 cpm of RNA and 10 μg yeast RNA in alkaline hydrolysis buffer (Ambion) at 95°C for 8 min. All reactions were stopped by addition of denaturing loading buffer (Ambion), and reaction mixtures were heated at 95°C for 1 min and analyzed on 6% (to detect the digestions of the 3′-terminal nucleotides of the RNA) and 20% (to detect the digestions of the 5′-terminal nucleotides of the RNA) polyacrylamide denaturing gels. The gels were dried and subjected to autoradiography.

Cytopathicity assay.

To assess the cytopathicity of the mutant viruses, Vero cells were infected with an MOI of 1 and cytopathicity was investigated 2, 5, and 8 days after infection by staining cells with crystal violet as previously described (19).

Mouse virulence, antibody response, and WNVNY99 challenge.

Swiss outbred mice (18 to 19 days old) in groups of 5 were inoculated intraperitoneally with 104 PFU, monitored for the signs of infection as described previously (26) to assess the virulence of the mutated viruses, and sacrificed when signs of encephalitis became apparent. To investigate whether inoculation with the PK mutant viruses would induce a protective immune response against WNVNY99 challenge in mice, 5-week-old mice in groups of 5 were inoculated intraperitoneally with 104 PFU of FLSDX, FL-PK1′2′, FL-PK1′2′3′, or FL-IRAΔCS3. As a control, mice were mock injected with medium. Two weeks after this, serum samples were collected to assess the production of WNV-specific antibodies by enzyme-linked immunosorbent assay (ELISA). Four weeks after immunization, mice were challenged intraperitoneally with 103 PFU of WNVNY99. Mice were then monitored as described above. All mice were bled, and serum was analyzed for the presence of WNV-specific antibodies by ELISA on fixed WNVKUN-infected cells as described previously (12).

The experiments were conducted with approval from the University of Queensland Animal Experimentation Ethics Committee in accordance with the guidelines for animal experimentation as set out by the National Health and Medical Research Council, Australia.

RESULTS

Stem-loops II and IV contribute to resistance of gRNA to RNase degradation and generation of smaller sfRNA species.

We have previously shown that mutations which destabilize or eliminate SL-II resulted in a dramatic decrease in the amount or disappearance of full-length sfRNA1 and appearance of a smaller RNA species, termed sfRNA2 (26). Mutations in conjunction with SL-II mutations further downstream led to the production of an even smaller sfRNA, termed sfRNA3 (26). We then postulated that nuclease digestion of WNVKUN RNA can be stalled at at least 3 rigid secondary or tertiary structures, leading to the production of three sfRNAs of different sizes. One of these structures was shown to be SL-II, and the other two were proposed to be SL-IV and DB1 (Fig. 1A) (26).

To further investigate the structural requirements for sfRNA generation, we deleted SL-IV and DB1 in a WNVKUN replicon and electroporated in vitro-transcribed RNA into BHK-21 cells. At 72 h after electroporation, RNA was isolated and sfRNA production was investigated by Northern blotting using a 3′-UTR-specific probe. As shown previously, when SL-II was deleted, an RNA (sfRNA2) smaller than the wild-type (wt) sfRNA1 was formed (Fig. 2A) (26). Deletion of SL-IV alone led to the production of a reduced amount of sfRNA1 and the appearance of smaller sfRNA3 (Fig. 2A). This is in agreement with previous data which showed that destabilization of some structures downstream of SL-II can lead to decreased production of sfRNA1 (26). When SL-IV was deleted in combination with SL-II, only sfRNA3 was produced (Fig. 2A). This shows that SL-IV is indeed the structure downstream of SL-II which prevents further RNA degradation. However, since sfRNA3 was still formed, an RNA structure downstream of SL-IV was able to stop the complete 3′ UTR digestion. Consequently, we deleted DB1, which we predicted to be responsible for further resistance to RNA degradation and formation of sfRNA3. Deletion of DB1 alone did not affect sfRNA1 formation (Fig. 2A). However, the combination of SL-II, SL-IV, and DB1 deletions strongly inhibited RNA replication (Fig. 2A and B), thus preventing us from analyzing the role of DB1 in sfRNA formation using the deletion approach. Calculation of the gRNA-to-sfRNA ratio revealed a general tendency toward an increase in the ratio with the decrease in the size and/or the amount of sfRNA, with the exception of the ΔSL-IV mutant, which produced two sfRNA species, sfRNA1 and sfRNA3 (Fig. 2A).

FIG. 2.

FIG. 2.

Defined 3′ UTR secondary structures are required for sfRNA formation. (A) Northern blot assay using a 3′-UTR-specific probe of RNA isolated from BHK-21 cells 72 h after electroporation with replicon RNAs containing indicated deletions. 18S rRNA is shown as a loading control. gRNA, genomic RNA; sfRNA, subgenomic flavivirus RNA; gRNA/sfRNA, ratio of gRNA to sfRNA. (B) Beta-galactosidase assay using lysates from electroporated BHK-21 cells 72 h after electroporation. The beta-galactosidase amount expressed from the wt construct was set at 100%. The standard deviations (SD) from 3 independent experiments are shown.

To further assess the effect of these deletions on RNA replication, the expression of the beta-galactosidase reporter gene carried on the replicon as a marker for viral RNA replication was investigated. Replicon RNA replication was not significantly affected by the deletion of SL-IV, while deletions of SL-II or DB1 reduced RNA replication efficiency (Fig. 2B). Replication of a mutant RNA with deletion of all 3 structures was barely detectable by the reporter assay (Fig. 2B). Taken together, our data show that SL-IV downstream of SL-II is responsible for providing resistance to RNase degradation and leading to the production of sfRNA2.

Pseudoknot 1 (PK1) blocks degradation of gRNA, resulting in accumulation of sfRNA1.

We have previously predicted that PK interactions in SL-II were likely to be important for gRNA resistance to RNase degradation and generation of sfRNA1 (26) (Fig. 1A and B). To confirm this prediction experimentally, we introduced point mutations predicted to disrupt PK1 interactions into a WNVKUN replicon RNA. The mutations were introduced into either PK1′ (sequence within SL-II) or PK1″ (sequence adjacent to SL-II) (Fig. 1B and C). In addition, we have generated a mutant replicon RNA in which the predicted PK1 interactions were reconstituted by restoring complementarity (Fig. 1B and C). sfRNA size and RNA replication were then investigated as described above.

The PK1′ and PK1″ mutant replicons both did not produce sfRNA1 but instead produced the smaller sfRNA2 (Fig. 3A), demonstrating that mutations at either side of the PK1 loosen the RNA structure in a way that allows nuclease attack. Importantly, combining the PK1′ and PK1″ mutations and therefore reconstituting the PK1 interactions (Fig. 1B and C) rescued sfRNA1 production (Fig. 3A), clearly showing that the RNA structure forming PK1 but not the respective RNA sequences are required for resistance to RNase degradation and generation of sfRNA1. Similarly to the deletion analysis, mutations in PK1 leading to generation of smaller sfRNA2 resulted in increase in the ratio of gRNA to sfRNA (Fig. 3A).

FIG. 3.

FIG. 3.

PK1 is required for sfRNA1 formation. (A) Northern blot assay using a 3′-UTR-specific probe of RNA isolated from BHK-21 cells 72 h after electroporation with replicon RNAs containing indicated mutations in PK1. 28S rRNA is shown as a loading control. gRNA, genomic RNA; sfRNA, subgenomic flavivirus RNA. (B) Beta-galactosidase assay using lysates from electroporated BHK-21 cells 72 h after electroporation. The beta-galactosidase amount expressed from the wt construct was set at 100%. The SDs from 3 independent experiments are shown. (C) Probing RNA structure by using RNase digestion. The RNA representing nucleotides −527 to −448 of the 3′ terminus of the WNVKUN genome (spanning SL-II, PK-1, and RCS3) was 5′ end labeled with 32P and digested with RNase I and RNase V1. The reaction mixtures were analyzed on a 6% (left panel) and a 20% (right panel) polyacrylamide denaturing gel. An OH ladder and G ladder were included to locate the positions of the digested nucleotides. The positions of G residues are labeled on the left sides of the gels. (D) Summary of RNase cleavages from panel C. Both weak and strong digestions are indicated. The nucleotides involved in the PK1 interactions (indicated by a dashed line) are shaded in gray.

To provide biochemical evidence for the existence of the PK1 interaction, we probed the RNA structure spanning nucleotides 448 to 527 of the 3′ terminus of WNVKUN genome. This 80-nt RNA contained SL-II, PK1, and RCS3. The 5′-end 32P-labeled RNA was partially digested by RNase I (cleaving single-strand RNA) and RNase V1 (cleaving double-strand RNA). The RNase cleavage reaction mixtures were then resolved on a 6% (Fig. 3C, left panel) and a 20% (Fig. 3C, right panel) polyacrylamide denaturing gel to detect the digestion patterns of the 3′- and 5′-terminal nucleotides of the RNA, respectively. An RNA hydrolysis ladder (OH ladder) and G ladder (generated by RNase T1, which specifically cleaves at G residues) were included to locate the position of the digested nucleotides (Fig. 3C). As summarized in Fig. 3D, the overall RNase cleavage pattern supports the predicted stem-loop structure. Importantly, nucleotides 5′-GUUGAGU-3′ at the top of the predicted SL-II were cleaved by RNase V1, indicating that these nucleotides form base pairs with other nucleotides. Concurrently, two nucleotides within the 5′-ACUCAAC-3′ sequence at the bottom of SL-II were cleaved by RNase V1, although the same region was also digested by RNase I, suggesting that these nucleotides have the potential to base pair with the top region of SL-II.

In combination with the genetic results, the data show that PK1′ and PK1" form PK1, which provides resistance to RNase degradation. Thus, PK1 is likely to stabilize SL-II as a prerequisite for sfRNA1 formation. The generation of smaller sfRNAs by the PK1 mutant RNAs also demonstrates that elimination of more than one nuclease-resistant RNA structure in the 3′ UTR is required to completely abolish production of any sfRNA. RNA replication analysis using the β-galactosidase assay showed that RNA replication was not significantly affected by any of the PK1 mutations in BHK-21 cells (Fig. 3B). This shows that an intact PK1 is not required for RNA replication.

PK2 sequences but not PK2 interactions are important for accumulation of sfRNA2.

The structure downstream of SL-II and PK1 capable of stopping nuclease digestion of gRNA is SL-IV (Fig. 2A), which was also predicted to contain a PK, PK2 (Fig. 1A) (26). The PK2′ and PK2″ sequences were therefore mutated to disrupt this PK, and the effect on sfRNA production was investigated.

Northern blot analysis showed that mutation of PK2′, PK2″, or PK2′2″ alone did not alter sfRNA1 production (Fig. 4A). This was expected, as PK1 was intact in these constructs and could prevent RNA degradation. Replication efficiency of PK2 mutant RNAs was also not affected (Fig. 4B). To be able to investigate the ability of PK2 to contribute to sfRNA2 formation, we combined the PK1 and PK2 mutations. Northern blot analysis showed that the PK1′2′ as well as PK1′2″ mutant replicon RNAs produced sfRNA3 as expected (Fig. 4A). This indicates that wt sequences on both sides of the predicted PK2 interaction are required to stall the nuclease after it could digest through the mutated PK1. However, unexpectedly, restoration of PK2 complementarity in the PK1′2′2″ replicon RNA did not rescue sfRNA2 production (Fig. 4A). The results show that although sequences in the putative PK2 are unlikely to form PK interactions, they are clearly important in preventing further degradation of gRNA when PK1 is mutated. This indicates that PK2 sequences and not the predicted PK2 interaction are required to protect RNA from degradation. The tendency toward the ratio of gRNA to sfRNA increasing with the decrease in the size of sfRNA (Fig. 2A and 3A) was also present in these mutants (Fig. 4A). The production of sfRNA3 by mutants with combined PK1 and PK2 mutations also suggests that other structures downstream from PK1 and PK2 prevent further degradation of the gRNA.

FIG. 4.

FIG. 4.

Sequences in PK2 are required for sfRNA2 formation. (A) Northern blot assay using a 3′-UTR-specific probe of RNA isolated from BHK-21 cells 72 h after electroporation with replicon RNAs containing indicated mutations in PK2 and PK1. 18S rRNA is shown as a loading control. gRNA, genomic RNA; sfRNA, subgenomic flavivirus RNA. (B) Beta-galactosidase assay using lysates from electroporated BHK-21 cells 72 h after electroporation. The beta-galactosidase amount expressed from the wt construct was set at 100%. The SDs from 3 independent experiments are shown.

PK3 blocks further degradation of gRNA and is responsible for sfRNA3 production.

The structure downstream of PK2 and SL-IV likely to prevent complete nuclease digestion of gRNA is DB1 (Fig. 1A). This structure was also predicted to contain a PK, PK3 (25). The effect of the disruption of PK3 on sfRNA production was thus investigated as described above.

Mutant replicon RNAs containing PK3′, PK3″, or PK3′3″ mutations alone (Fig. 1C) all produced sfRNA1 as expected (Fig. 5A). To investigate the contribution of PK3 to sfRNA formation and to test the hypothesis that PK3 in DB1 is the structure downstream of SL-IV which stalls RNA degradation to produce sfRNA3, we combined the PK3′ mutation with the PK1′2′ mutations. Northern blot analysis of the PK1′2′3′ replicon RNA showed loss of sfRNA3 and no detectable sfRNA production 120 h after electroporation (Fig. 5A, right panel), indicating that PK3 is indeed required for sfRNA3 formation. Importantly, reconstitution of the PK3 interactions in the PK1′2′3′3″ replicon rescued production of low levels of sfRNA3 (Fig. 5A, right panel). The results show that PK3 is responsible for protecting RNA against nuclease attack and production of sfRNA3. The results also suggest that DB1 is indeed the secondary structure which confers resistance to RNase digestion and formation of sfRNA3. The comparative analysis of PK1, -2, and -3 mutants producing progressively smaller sfRNAs in one experiment confirmed the tendency toward increased ratios of gRNA to sfRNA with the decrease in the size of sfRNA (Fig. 5A, right panel) observed in previous separate experiments (Fig. 2A, 3A, and 4A).

FIG. 5.

FIG. 5.

PK3 is required for sfRNA3 formation and efficient viral replication. (A) Northern blot assay of RNA isolated from electroporated BHK-21 cells 72 and 120 h after electroporation using a 3′-UTR-specific probe. The left panel shows 72 h after electroporation; the right panel shows 120 h after electroporation. Note that 4-fold (72 h) and 2-fold (120 h) more total RNA, respectively, is loaded for PK1′2′3′ than for the other samples. 18S rRNA is shown as a loading control. gRNA, genomic RNA; sfRNA, subgenomic flavivirus RNA. (B) Beta-galactosidase assay using lysates from electroporated BHK-21 cells 72 h after electroporation. The beta-galactosidase amount expressed from the wt construct was set at 100%. The SDs from 3 independent experiments are shown.

Interestingly, quantification of β-galactosidase activity in electroporated BHK-21 cells 72 h after electroporation showed that mutation of the PK3′ sequence in the DB1 loop (Fig. 1A) significantly inhibited replicon RNA replication while mutation of PK3″ sequence located downstream of DB2 (Fig. 1A) had no negative effect on RNA replication (Fig. 5B). The PK3′ mutation may affect the DB1 secondary structure, which, when deleted, also had a similar detrimental effect on RNA replication (Fig. 2B). Interestingly, reconstitution of PK3 by combining the PK3′ and PK3″ mutations in PK3′3″ rescued RNA replication efficiency (Fig. 5B), suggesting that interaction between the PK3′ and PK3" sites may be required for efficient RNA replication. Analogous observations were made for the replication of the PK1′2′3′ mutant, which was strongly reduced, while restoring PK3 interactions in the PK1′2′3′3″ mutant replicon rescued replication (Fig. 5B). In conclusion, PK3 in DB1 is able to prevent further degradation of gRNA and produce sfRNA3 when PK1 and PK2 are mutated. In addition, the results show that an intact PK3′ sequence in the DB1 loop is essential for efficient RNA replication (25, 26).

Full-length sfRNA1 is required for efficient viral replication and cytopathicity in cells as well as virulence in mice.

Infectious WNVKUN viruses containing individual PK1′ (FL-PK1′); combined PK1′ and PK2′ (FL-PK1′2′); and combined PK1′, PK2′, and PK3′ mutations (FL-PK1′2′3′) were produced and used for infection of insect and mammalian cells at an MOI of 1. Northern blot analysis of RNA samples harvested at the indicated time points from infected Vero and C6/36 cells showed accumulation of sfRNAs of expected sizes for each mutant (Fig. 6A). Interestingly, RNA with the predicted size of sfRNA4 was visible in mosquito C6/36 cells but not in mammalian Vero cells infected with the FL-PK1′2′3′ mutant (Fig. 6A), suggesting that mosquito cells may be more stable in maintaining the accumulation of generated sfRNA. The ratios of gRNA to sfRNA in cells infected with PK mutant viruses did not appear to increase much with the decrease in the sfRNA size (Fig. 6A), in contrast to what was seen in cells transfected with PK mutant replicon RNAs (Fig. 6A, right panels). Titration of viruses harvested from the supernatant of these infected cells on BHK cells (in which all viruses were cytopathic and produced plaques) showed that there were no significant differences in virus production and accumulation between the wt and mutant viruses in Vero cells, while some decrease in virus accumulation was detected for the mutant viruses later in infection in C6/36 cells (Fig. 6B). Notably, FL-PK1′2′3′ mutant virus producing a small amount of sfRNA4 in C6/36 cells showed substantial delay and reduced accumulation of secreted virus in the culture fluid of these cells (Fig. 6B) despite efficient accumulation of gRNA (Fig. 6A), suggesting a potential effect of these mutations on gRNA packaging and/or virus assembly and secretion.

FIG. 6.

FIG. 6.

sfRNA1 is essential for efficient viral replication, cytopathicity, and pathogenicity. (A) Northern blot assay with RNA isolated from C6/36 and Vero cells infected with wild-type and mutant WNVKUN viruses. gRNA, genomic RNA; sfRNA, subgenomic flavivirus RNA. rRNA is shown as a loading control. (B) Growth kinetics of mutant viruses in mosquito (C6/36, left panel) and mammalian (Vero, right panel) cells infected with an MOI of 1. sfRNA species produced are indicated. Data are represented as averages ± SDs. (C) Cytopathicity assay. Vero cells were infected, fixed, and stained with crystal violet at the indicated time points. (D) Pathogenicity in mice. Three-week-old Swiss outbred mice (5 per group) were injected intraperitoneally with 104 PFU of indicated viruses. Mice were monitored daily and sacrificed when symptoms of encephalitis became evident. As a control, 5 mice were injected with medium only. These mice remained healthy over the observation period (data not shown). d pi, days postinfection.

We have previously shown that sfRNA1 is essential for the induction of cell death in infected Vero cells (26). To confirm this finding and to analyze the effect of PK mutations on virus-induced cytopathicity, Vero cells were infected with an MOI of 1 of the different PK mutant viruses, incubated for various times, and fixed and stained with crystal violet. Cells infected with wt virus showed a strong cytopathic effect (CPE) starting from day 5 after infection, whereas the cells infected with either of the PK mutant viruses showed no CPE for up to 8 days after infection (Fig. 6C). The results independently confirm that mutations abolishing production of sfRNA1 and resulting in the production of smaller sfRNA species strongly reduce viral cytopathicity in Vero cells. In contrast to Vero cells, all mutant viruses were cytopathic and formed plaques in BHK cells (not shown), indicating that differences in cell death signaling exist in the two cell types.

To then investigate the pathogenicity and neuroinvasiveness of the PK mutant viruses, 3-week-old mice were injected intraperitoneally with 104 PFU and survival was monitored for 14 days after injection. All mice inoculated with the wt virus succumbed to WNVKUN infection by 8 days while 80% or more of the mice injected with the PK mutant viruses survived (Fig. 6D). Sequence analysis of the 360 nucleotides in the 3′ UTR of the viral RNA isolated from the brains of those mice which succumbed to infection with mutant viruses showed retention of introduced mutations and no changes in the sequenced part of the 3′ UTR (nt 110 to 469; data not shown), suggesting that other compensatory mutations in the remaining parts of the 3′ UTR or elsewhere in the genome may occur to restore the virulence of mutant viruses. The results overall, however, confirm our previous findings that viruses lacking sfRNA1 are significantly attenuated in vivo (26).

Immunization with sfRNA1-deficient WNVKUN viruses protects mice against challenge with pathogenic WNVNY99.

To determine the vaccine potential of the sfRNA1-deficient mutant viruses, 5-week-old mice were immunized with 104 PFU of FLSDX (wt), FL-PK1′2′, and FL-PK1′2′3′ viruses, and our previously generated FL-IRAΔCS3 (producing sfRNA3) virus. Two weeks after immunization, the collected mouse serum was analyzed for the presence of anti-WNVKUN antibodies using ELISA on fixed WNVKUN-infected C6/36 cells (12). All of the inoculated mice had produced WNVKUN-specific antibodies, although to various degrees, at this time point (Fig. 7 A). The mutant virus FL-PK1′2′3′ led to the production of lower antibody titers than did the wild-type, FL-PK1′2′, or FL-IRAΔCS3 virus infections, likely due to decreased replication efficiency. To determine the protective efficacy of the mutant WNVKUN viruses, the immunized mice were challenged 4 weeks after immunization with 1,000 PFU of the highly pathogenic NY99 strain of WNV intraperitoneally. All immunized mice were fully protected against the challenge, while all mock-injected mice succumbed to infection by day 8 (Fig. 7B). The results demonstrate that sfRNA1-deficient WNVKUN viruses induce highly protective immune responses against the pathogenic WNVNY99 strain in mice and can be considered attractive WNV vaccine candidates.

FIG. 7.

FIG. 7.

sfRNA-deficient WNVKUN viruses protect against lethal challenge with highly pathogenic WNVNY99. (A) Antibody production in inoculated mice. Five-week-old Swiss outbred mice were intraperitoneally inoculated with 10,000 PFU of indicated viruses in groups of 5 mice. Two weeks after immunization, serum was collected and the production of WNVKUN-specific antibodies was investigated by ELISA. Values from the 1:320 serum dilution are shown. As a control, mice were mock inoculated with medium only, which did not lead to the development of WNVKUN-specific antibodies (data not shown). (B) Survival of inoculated mice after challenge with WNVNY99. Four weeks after immunization, mice were challenged with 1,000 PFU of WNVNY99, and survival was monitored for 14 days after infection.

DISCUSSION

We have recently shown that a small, nuclease-resistant, noncoding RNA, sfRNA, is produced in large amounts by all the members of the Flavivirus genus (26). The production of sfRNA was proposed to be the result of incomplete gRNA degradation after stalling of the cellular exoribonuclease XRN1 on rigid secondary RNA structures in the 3′ UTR of the viral genome (26). Here, we demonstrated not only that stem-loop and dumbbell structures in the 3′ UTR of the flaviviral genome are required to stall nuclease digestion but also that PK interactions stabilizing these structures play a significant role in sfRNA generation.

PKs have been found in a number of viral genomes (3). They are often associated with key roles in the replication cycle of several viruses, including hepatitis C and West Nile viruses (22, 37). Usually, the function of the PK is linked to its position in the viral genome and can include binding of proteins. In noncoding regions like the 3′ UTR, they can act as regulators of protein synthesis or assist in template recognition for viral replication (3). In the coding region, they often result in ribosomal frameshifts or mediate termination steps of translation. For many viral PKs, the primary sequence is unimportant for function as long as the conformation and overall stability of the structure are maintained (3). It is not uncommon for viruses to contain several PKs in their 3′ UTRs. Tobacco mosaic virus, for example, harbors a total of 5 PKs within its 3′ UTR which regulate the switch between translation and replication (36).

The data in this study show that several complex RNA structures in the 3′ UTR of the flaviviral gRNA are required to produce sfRNAs of different sizes. These include secondary structures like SL-II and SL-IV as well as DB1 and DB2, which, by their apparent duplication, ensure that some form of sfRNA is made. The production of sfRNA in general suggests that the gRNA of flaviviruses is prone to nuclease attack in the infected host cell. This may be an antiviral response mediated by the cell to inhibit viral replication, or alternatively the virus may eliminate faulty, nonreplicative RNA genomes by directing them toward cellular RNA degradation pathways. Further studies are needed to clarify these questions.

In addition to the secondary structures, we and others predicted 5 PKs in the 3′ UTR of WNVKUN (25, 26, 32). Here, we showed that at least 2 of them are required for the production of sfRNA. We have clearly shown by using RNase probing and mutagenesis analysis of PK sequences that PK1 is formed. Our data also unequivocally show that PK1 is required for sfRNA1 production and that PK1 interactions are likely to be more important than SL-II alone in protecting gRNA from degradation and producing sfRNA1 (all data are summarized in Table 2 ).

TABLE 2.

Summary of findings with replicon RNA mutants

Structure deleted/mutated RNA replication efficiencya sfRNA species
wt +++ 1
SL-II +++ 2
SL-II, -IV +++ 3
SL-II, SL-IV, and DB1 − NDb
PK1′ +++ 2
PK1" +++ 2
PK1′1″ +++ 1
PK2′ +++ 1
PK2″ +++ 1
PK2′2″ +++ 1
PK1′2′ +++ 3
PK1′2″ +++ 3
PK1′2′2″ +++ 3
PK3′ ++ 1
PK3″ +++ 1
PK3′3′ ′ +++ 1
PK1′2′3′ + 4
PK1′2′3′3″ +++ 3
a

− to +++, no replication to highest-efficiency replication, respectively.

b

ND, not determined.

PK1 and PK3 could be disrupted by mutations in one part of the interacting sequences and reconstituted again by restoring complementarity between both parts as expected for a PK. As expected for the role of PKs in sfRNA formation, these reconstitutions lead to generation of corresponding sfRNAs, sfRNA1 for PK1 and sfRNA3 for PK3. However, this was not the case for PK2 in SL-IV. Disruption of the predicted PK2 by mutations of either of the PK2 sequences did affect sfRNA2 formation and led to formation of the smaller form, sfRNA3. However, reconstitution of the PK interactions did not result in the restoration of sfRNA2. One possible explanation is that the predicted PK2 interactions do not exist in the context of the viral 3′ UTR. Thus, reconstitution of the complementarity between mutated PK2′ and PK2" sequences did not restore formation of sfRNA2. The formation of sfRNA3 by the combined mutations of PK1′ and PK2′ or PK1′ and PK2" could thus be explained by their disruptive effect on the structure of SL-IV. An alternative explanation could be that the mutations restoring the complementarily between mutated PK2′ and PK2" sequences were different from the original wild-type PK sequences. The predicted PK2 is unique since it contains a non-Watson-Crick base pair, G-U (GCG in PK2′ is predicted to interact with UGC in PK2"). Although G/U and G/A base pairs commonly stabilize RNA structures (24, 27), they do represent less stringent interactions. The mutated PK2, however, was reconstituted to form three classical Watson-Crick base pairs (CGC in PK2′ is predicted to interact with GCG in PK2"). This could influence the 3′ UTR structure in such a way that the PK2 is not properly reconstituted as in the wild-type sequence and thus production of sfRNA2 is not restored.

Somewhat surprising was the result that mutations in the PK3′ but not in the PK3" sequence strongly reduced RNA replication. Since both mutations are predicted to disrupt PK3, the decrease in replication in the PK3′ mutant cannot simply be explained by the requirement of an intact PK3 for replication. Most likely, the PK3′ mutation disrupted part of or the complete secondary structure DB1, which is required for efficient RNA replication. Strikingly, reconstitution of PK3 by restoring complementarity between PK3′ and PK3" mutations did lead to a significant increase in replication efficiency compared to that with the PK3′ mutation alone. This indicates that an intact PK3 as well as an intact DB1 is required for replication. The direct comparison of the ratios of gRNA to sfRNA by PK1, -2, and -3 mutant replicon RNAs in the same experiment showed a tendency toward an increase in the ratio with the decrease in the size of sfRNA. From another viewpoint, this ratio was not increased as much in cells infected with PK1, -2, and -3 mutant viruses, which could probably be explained by the removal of gRNA but not of sfRNA from cells in the form of secreted viral particles. It is possible that the gRNA/sfRNA ratio may reflect some functional role for the amount of sfRNA in RNA replication; however, it is probably more likely that the increase in the ratio can be explained by the lower efficiency of detection of smaller sfRNAs by the larger probe consisting of the entire 3′ UTR.

In addition to PK1, -2, and -3, two more PKs, PK4 and PK5, were predicted by RNA structure prediction analysis (Fig. 1A). The generation of sfRNA4 in C6/36 cells by FL-PK1′2′3′ mutant virus indicates that at least one of them can function in protecting RNA from nuclease degradation. Our preliminary data with replicon RNAs showed a strong inhibitory effect of mutations in PK4 and PK5 on RNA replication (data not shown), thus precluding us from drawing conclusions on the potential role of these PKs in protection against nuclease degradation and generation of smaller sfRNAs. The use of cytomegalovirus (CMV) promoter-based replicon DNAs capable of transcribing and accumulating replicon RNA and subsequently sfRNAs without the need for RNA replication (26) should allow clarification of the role of PK4 and PK5 in protection against nuclease degradation and generation of smaller sfRNAs, and this is the subject of our current investigations.

Our data with defined mutations in PKs, in particular PK1, also show that sfRNA1 plays a prominent role in the virus-induced cytopathicity in Vero cells as well as pathogenicity in mice. This confirms our previous findings obtained by combined deletion/mutagenesis analysis affecting sfRNA1 formation (26). As observed previously, in contrast to Vero cells, all replicating sfRNA virus mutants were cytopathic in BHK cells, clearly indicating the difference in death signaling pathways in these two types of cells. The exact factors/mechanisms determining this difference require further investigation. All mutant viruses not producing sfRNA1 were highly attenuated in mice and thus represent attractive vaccine candidates. Indeed, our results show that vaccination of adult mice with FL-PK1′2′ and FL-PK1′2′3′ mutant viruses as well as with the previously characterized FL-IRAΔCS3 mutant virus completely protected them from a lethal challenge with the pathogenic WNVNY99 strain. However, the possibility of compensatory mutations leading to observed partial restoration of virulence in 10 to 20% of weanling mice infected with some PK mutants indicates that other changes are likely to be needed to generate genetically stable attenuated vaccine candidates. In this regard, the FL-IRAΔCS3 mutant containing point mutations in the loop part of SL-II and a deletion of CS3 was genetically stable (26) and, as shown here, was also highly protective against WNVNY99 challenge.

Overall, our data indicate that the stem-loop and dumbbell structures as well as PK interactions in the 3′ UTR stabilize viral RNA and protect it from degradation by cellular RNase(s). The resulting product of this protection, small noncoding sfRNA, plays an important role in flavivirus-induced pathogenicity, and viruses deficient in production of sfRNA1 represent attractive live attenuated vaccine candidates.

Acknowledgments

We thank Wing Chuang for helpful discussions as well as Michelle Audsley for help with the animal work. We are indebted to Ruth Lee for assistance with the animal experiments.

This work was supported by the grants to A.A.K. and A.F. from the National Health and Medical Research Council of Australia and to A.A.K. from the U.S. National Institutes of Health.

Footnotes

▿

Published ahead of print on 18 August 2010.

REFERENCES

  • 1.Alvarez, D. E., M. F. Lodeiro, S. J. Luduena, L. I. Pietrasanta, and A. V. Gamarnik. 2005. Long-range RNA-RNA interactions circularize the dengue virus genome. J. Virol. 79:6631-6643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bredenbeek, P. J., E. A. Kooi, B. Lindenbach, N. Huijkman, C. M. Rice, and W. J. Spaan. 2003. A stable full-length yellow fever virus cDNA clone and the role of conserved RNA elements in flavivirus replication. J. Gen. Virol. 84:1261-1268. [DOI] [PubMed] [Google Scholar]
  • 3.Brierley, I., S. Pennell, and R. J. Gilbert. 2007. Viral RNA pseudoknots: versatile motifs in gene expression and replication. Nat. Rev. Microbiol. 5:598-610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Brinton, M. A., A. V. Fernandez, and J. H. Dispoto. 1986. The 3′-nucleotides of flavivirus genomic RNA form a conserved secondary structure. Virology 153:113-121. [DOI] [PubMed] [Google Scholar]
  • 5.Brion, P., and E. Westhof. 1997. Hierarchy and dynamics of RNA folding. Annu. Rev. Biophys. Biomol. Struct. 26:113-137. [DOI] [PubMed] [Google Scholar]
  • 6.Coia, G., M. D. Parker, G. Speight, M. E. Byrne, and E. G. Westaway. 1988. Nucleotide and complete amino acid sequences of Kunjin virus: definitive gene order and characteristics of the virus-specified proteins. J. Gen. Virol. 69:1-21. [DOI] [PubMed] [Google Scholar]
  • 7.Dong, H., B. Zhang, and P. Y. Shi. 2008. Terminal structures of West Nile virus genomic RNA and their interactions with viral NS5 protein. Virology 381:123-135. [DOI] [PubMed] [Google Scholar]
  • 8.Friebe, P., and E. Harris. 2010. The interplay of RNA elements in the dengue virus 5′ and 3′ ends required for viral RNA replication. J. Virol. 84:6103-6118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gould, E. A., and T. Solomon. 2008. Pathogenic flaviviruses. Lancet 371:500-509. [DOI] [PubMed] [Google Scholar]
  • 10.Hahn, C. S., Y. S. Hahn, C. M. Rice, E. Lee, L. Dalgarno, E. G. Strauss, and J. H. Strauss. 1987. Conserved elements in the 3′ untranslated region of flavivirus RNAs and potential cyclization sequences. J. Mol. Biol. 198:33-41. [DOI] [PubMed] [Google Scholar]
  • 11.Hall, R. A., A. K. Broom, D. W. Smith, and J. S. Mackenzie. 2002. The ecology and epidemiology of Kunjin virus. Curr. Top. Microbiol. Immunol. 267:253-269. [DOI] [PubMed] [Google Scholar]
  • 12.Hall, R. A., D. J. Nisbet, K. B. Pham, A. T. Pyke, G. A. Smith, and A. A. Khromykh. 2003. DNA vaccine coding for the full-length infectious Kunjin virus RNA protects mice against the New York strain of West Nile virus. Proc. Natl. Acad. Sci. U. S. A. 100:10460-10464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Khromykh, A. A., N. Kondratieva, J. Y. Sgro, A. Palmenberg, and E. G. Westaway. 2003. Significance in replication of the terminal nucleotides of the flavivirus genome. J. Virol. 77:10623-10629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Khromykh, A. A., H. Meka, K. J. Guyatt, and E. G. Westaway. 2001. Essential role of cyclization sequences in flavivirus RNA replication. J. Virol. 75:6719-6728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Khromykh, A. A., and E. G. Westaway. 1994. Completion of Kunjin virus RNA sequence and recovery of an infectious RNA transcribed from stably cloned full-length cDNA. J. Virol. 68:4580-4588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Khromykh, A. A., and E. G. Westaway. 1997. Subgenomic replicons of the flavivirus Kunjin: construction and applications. J. Virol. 71:1497-1505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Liu, W. J., H. B. Chen, and A. A. Khromykh. 2003. Molecular and functional analyses of Kunjin virus infectious cDNA clones demonstrate the essential roles for NS2A in virus assembly and for a nonconservative residue in NS3 in RNA replication. J. Virol. 77:7804-7813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Liu, W. J., P. L. Sedlak, N. Kondratieva, and A. A. Khromykh. 2002. Complementation analysis of the flavivirus Kunjin NS3 and NS5 proteins defines the minimal regions essential for formation of a replication complex and shows a requirement of NS3 in cis for virus assembly. J. Virol. 76:10766-10775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Liu, W. J., X. J. Wang, D. C. Clark, M. Lobigs, R. A. Hall, and A. A. Khromykh. 2006. A single amino acid substitution in the West Nile virus nonstructural protein NS2A disables its ability to inhibit alpha/beta interferon induction and attenuates virus virulence in mice. J. Virol. 80:2396-2404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lo, M. K., M. Tilgner, K. A. Bernard, and P. Y. Shi. 2003. Functional analysis of mosquito-borne flavivirus conserved sequence elements within 3′ untranslated region of West Nile virus by use of a reporting replicon that differentiates between viral translation and RNA replication. J. Virol. 77:10004-10014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Markoff, L. 2003. 5′- and 3′-noncoding regions in flavivirus RNA. Adv. Virus Res. 59:177-228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Melian, E. B., E. Hinzman, T. Nagasaki, A. E. Firth, N. M. Wills, A. S. Nouwens, B. J. Blitvich, J. Leung, A. Funk, J. F. Atkins, R. Hall, and A. A. Khromykh. 2010. NS1′ of flaviviruses in the Japanese encephalitis virus serogroup is a product of ribosomal frameshifting and plays a role in viral neuroinvasiveness. J. Virol. 84:1641-1647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Men, R., M. Bray, D. Clark, R. M. Chanock, and C. J. Lai. 1996. Dengue type 4 virus mutants containing deletions in the 3′ noncoding region of the RNA genome: analysis of growth restriction in cell culture and altered viremia pattern and immunogenicity in rhesus monkeys. J. Virol. 70:3930-3937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Nagaswamy, U., N. Voss, Z. Zhang, and G. E. Fox. 2000. Database of non-canonical base pairs found in known RNA structures. Nucleic Acids Res. 28:375-376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Olsthoorn, R. C., and J. F. Bol. 2001. Sequence comparison and secondary structure analysis of the 3′ noncoding region of flavivirus genomes reveals multiple pseudoknots. RNA 7:1370-1377. [PMC free article] [PubMed] [Google Scholar]
  • 26.Pijlman, G. P., A. Funk, N. Kondratieva, J. Leung, S. Torres, L. van der Aa, W. J. Liu, A. C. Palmenberg, P. Y. Shi, R. A. Hall, and A. A. Khromykh. 2008. A highly structured, nuclease-resistant, noncoding RNA produced by flaviviruses is required for pathogenicity. Cell Host Microbe 4:579-591. [DOI] [PubMed] [Google Scholar]
  • 27.Pley, H. W., K. M. Flaherty, and D. B. McKay. 1994. Three-dimensional structure of a hammerhead ribozyme. Nature 372:68-74. [DOI] [PubMed] [Google Scholar]
  • 28.Poole, T. L., and A. Stevens. 1997. Structural modifications of RNA influence the 5′ exoribonucleolytic hydrolysis by XRN1 and HKE1 of Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun. 235:799-805. [DOI] [PubMed] [Google Scholar]
  • 29.Proutski, V., E. A. Gould, and E. C. Holmes. 1997. Secondary structure of the 3′ untranslated region of flaviviruses: similarities and differences. Nucleic Acids Res. 25:1194-1202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Proutski, V., T. S. Gritsun, E. A. Gould, and E. C. Holmes. 1999. Biological consequences of deletions within the 3′-untranslated region of flaviviruses may be due to rearrangements of RNA secondary structure. Virus Res. 64:107-123. [DOI] [PubMed] [Google Scholar]
  • 31.Rauscher, S., C. Flamm, C. W. Mandl, F. X. Heinz, and P. F. Stadler. 1997. Secondary structure of the 3′-noncoding region of flavivirus genomes: comparative analysis of base pairing probabilities. RNA 3:779-791. [PMC free article] [PubMed] [Google Scholar]
  • 32.Shi, P. Y., M. A. Brinton, J. M. Veal, Y. Y. Zhong, and W. D. Wilson. 1996. Evidence for the existence of a pseudoknot structure at the 3′ terminus of the flavivirus genomic RNA. Biochemistry 35:4222-4230. [DOI] [PubMed] [Google Scholar]
  • 33.Stevens, A. 1980. Purification and characterization of a Saccharomyces cerevisiae exoribonuclease which yields 5′-mononucleotides by a 5′ leads to 3′ mode of hydrolysis. J. Biol. Chem. 255:3080-3085. [PubMed] [Google Scholar]
  • 34.Thurner, C., C. Witwer, I. L. Hofacker, and P. F. Stadler. 2004. Conserved RNA secondary structures in Flaviviridae genomes. J. Gen. Virol. 85:1113-1124. [DOI] [PubMed] [Google Scholar]
  • 35.Tilgner, M., T. S. Deas, and P. Y. Shi. 2005. The flavivirus-conserved penta-nucleotide in the 3′ stem-loop of the West Nile virus genome requires a specific sequence and structure for RNA synthesis, but not for viral translation. Virology 331:375-386. [DOI] [PubMed] [Google Scholar]
  • 36.van Belkum, A., J. P. Abrahams, C. W. Pleij, and L. Bosch. 1985. Five pseudoknots are present at the 204 nucleotides long 3′ noncoding region of tobacco mosaic virus RNA. Nucleic Acids Res. 13:7673-7686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Wang, C., S. Y. Le, N. Ali, and A. Siddiqui. 1995. An RNA pseudoknot is an essential structural element of the internal ribosome entry site located within the hepatitis C virus 5′ noncoding region. RNA 1:526-537. [PMC free article] [PubMed] [Google Scholar]
  • 38.Westaway, E. G., J. M. Mackenzie, and A. A. Khromykh. 2003. Kunjin RNA replication and applications of Kunjin replicons. Adv. Virus Res. 59:99-140. [DOI] [PubMed] [Google Scholar]
  • 39.Westaway, E. G., J. M. Mackenzie, and A. A. Khromykh. 2002. Replication and gene function in Kunjin virus. Curr. Top. Microbiol. Immunol. 267:323-351. [DOI] [PubMed] [Google Scholar]
  • 40.Yu, L., and L. Markoff. 2005. The topology of bulges in the long stem of the flavivirus 3′ stem-loop is a major determinant of RNA replication competence. J. Virol. 79:2309-2324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Yun, S. I., Y. J. Choi, B. H. Song, and Y. M. Lee. 2009. 3′ cis-acting elements that contribute to the competence and efficiency of Japanese encephalitis virus genome replication: functional importance of sequence duplications, deletions, and substitutions. J. Virol. 83:7909-7930. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES