Skip to main content
NCBI home page
Annals of Botany logoLink to Annals of Botany
. 2010 Sep 1;106(5):791–802. doi: 10.1093/aob/mcq170

Arbuscular mycorrhizal fungi restore normal growth in a white poplar clone grown on heavy metal-contaminated soil, and this is associated with upregulation of foliar metallothionein and polyamine biosynthetic gene expression

Angela Cicatelli 1, Guido Lingua 2, Valeria Todeschini 2, Stefania Biondi 3, Patrizia Torrigiani 4, Stefano Castiglione 1,*
PMCID: PMC2958786  PMID: 20810743

Abstract

Background and Aims

It is increasingly evident that plant tolerance to stress is improved by mycorrhiza. Thus, suitable plant–fungus combinations may also contribute to the success of phytoremediation of heavy metal (HM)-polluted soil. Metallothioneins (MTs) and polyamines (PAs) are implicated in the response to HM stress in several plant species, but whether the response is modulated by arbuscular mycorrhizal fungi (AMF) remains to be clarified. The aim of the present study was to check whether colonization by AMF could modify growth, metal uptake/translocation, and MT and PA gene expression levels in white poplar cuttings grown on HM-contaminated soil, and to compare this with plants grown on non-contaminated soil.

Methods

In this greenhouse study, plants of a Populus alba clone were pre-inoculated, or not, with either Glomus mosseae or G. intraradices and then grown in pots containing either soil collected from a multimetal- (Cu and Zn) polluted site or non-polluted soil. The expression of MT and PA biosynthetic genes was analysed in leaves using quantitative reverse transcription–PCR. Free and conjugated foliar PA concentrations were determined in parallel.

Results

On polluted soil, AMF restored plant biomass despite higher Cu and Zn accumulation in plant organs, especially roots. Inoculation with the AMF caused an overall induction of PaMT1, PaMT2, PaMT3, PaSPDS1, PaSPDS2 and PaADC gene expression, together with increased free and conjugated PA levels, in plants grown on polluted soil, but not in those grown on non-polluted soil.

Conclusions

Mycorrhizal plants of P. alba clone AL35 exhibit increased capacity for stabilization of soil HMs, together with improved growth. Their enhanced stress tolerance may derive from the transcriptional upregulation of several stress-related genes, and the protective role of PAs.

Keywords: Arbuscular mycorrhizal fungi, contaminated soil, heavy metals, metallothioneins, polyamines, Populus alba, white poplar

INTRODUCTION

Heavy metal (HM) contamination of soil due to anthropogenic activities poses serious environmental and health problems. Metals can be removed, or immobilized in situ by various procedures based on physicochemical or biological processes; amongst the latter, phytoremediation represents an emerging technology that is probably cheaper and preserves soil biological activity and structure (Krämer, 2005). As revealed over the past decade in several hydroponic, pot- and field-scale experiments, fast-growing trees such as poplars and willows are ideal candidates for the phytoremediation of metal-contaminated soil, not only due to their high biomass production and deep widespreading root system, but also for their excellent metal tolerance and accumulation capacity (Di Baccio et al., 2003; Utmazian et al., 2007).

Soil microorganisms, such as ecto- (Karlinski et al., 2010) and endomycorrhiza, are also important in the recovery of polluted sites via phytoremediation because they can modify metal bioavailability and/or improve plant growth by contributing to nutrient acquisition, by producing growth-stimulating substances and/or by conferring increased tolerance to stress. An interesting option therefore consists of exploiting the synergistic effect of plants and microorganisms by a process called rhizoremediation or bio-augmentation (Kuiper et al., 2004; Lebeau et al., 2008).

Arbuscular mycorrhizal fungi (AMF) are biological constituents of the soil of most ecosystems where they can form associations with the roots of the vast majority of land plants. By increasing the exchange surface between plant and soil, AMF improve nutrient (especially phosphorus) uptake (Smith and Read, 1997). There is also increasing evidence that symbiotic fungi contribute to, or are responsible for, plant adaptation to stress, namely drought, HMs, disease, salinity, herbivores and pathogens (Rodriguez and Redman, 2008, and references therein; Lingua et al., 2002; Gamalero et al., 2010). In the case of HMs, results vary according to plant and fungal species, metal type and concentration (Bois et al., 2005; Takàcs et al., 2005; Todeschini et al., 2007; Lebeau et al., 2008), but, on the whole, microorganisms may contribute to the efficiency of the phytoremediation effort (Hildebrandt et al., 2007).

To cope with HM toxicity, plants use two types of polypeptides, metallothioneins (MTs) and phytochelatins. Based on their conserved cysteine residues, plant MTs have been subdivided into four types. The genes encoding these proteins are present as multigene families whose members appear to be differentially regulated in relation to organ and developmental stage, and in response to a number of stimuli including HMs (Cobbett and Goldsbrough, 2002). The evidence is largely based on MT gene expression studies and yeast complementation experiments with plant MT genes, and some of it comes from studies on Populus species or hybrids (Kohler et al., 2004; Castiglione et al., 2007; Hassinen et al., 2009).

Polyamines (PAs) are small organic molecules, occurring both in free form and conjugated to low molecular mass compounds, mainly phenolics (Edreva et al., 2007). The diamine putrescine (Put) is the obligate precursor of the PAs spermidine (Spd) and spermine (Spm); it is synthesized via arginine decarboxylase (ADC) and ornithine decarboxylase (ODC), while Spd and Spm biosynthesis requires the activities of S-adenosylmethionine decarboxylase (SAMDC) and of Spd/Spm synthases. PAs are organic polycations that are positively charged at physiological pH. They therefore can establish strong ionic interactions with negatively charged nucleic acids, acidic phospholipids and cell wall components. PAs can also affect the conformation and function of specific proteins by forming covalent linkages mediated by transglutaminase. Through these interactions, PAs regulate the structure and function of biological macromolecules, and are regarded as essential for normal growth and development through transcriptional and translational regulation (Kusano et al., 2008, and references therein). Moreover, the accumulation of PAs appears to be a universal response to stress in plants (Alcazar et al., 2010); indeed, an enhancement of cellular PA levels is associated with abiotic stress, including toxic HM concentrations (Pang et al., 2007; Groppa and Benavides, 2008). The response may be of a protective nature since PAs have been shown to stabilize membranes, act as free radical scavengers and retard senescence. PAs may also be cell wall modulators involved in abiotic stress and in host–microbe interactions through their cross-linking activity (Hahlbrock and Scheel, 1989) and the production of hydrogen peroxide through PA catabolism (Cona et al., 2006). This protective function of PAs is corroborated by numerous studies indicating that engineered plants over-expressing PA biosynthetic enzymes have increased resistance towards environmental challenges (Liu et al., 2007; Wen et al., 2010). Although there is some evidence for the positive involvement of PAs in the ectomycorrhizal interaction between roots of Pinus sylvestris and Suillus variegatus (Niemi et al., 2007), to date the PA profile in plants inoculated with AMF and exposed (or not) to HMs has not been examined.

The main objectives of the present work were to investigate if inoculation with AMF could modify the expression of some stress-responsive genes in a Populus alba clone, named AL35, selected on a HM-polluted site for its high survival, and metal accumulation capacity in the course of a field-scale trial aimed at evaluating the phytoremediation potential of a large clonal collection of poplars (Castiglione et al., 2009), and to check if these effects were modulated by prolonged exposure to elevated concentrations of Cu and Zn. The experiment was conducted with plants grown in pots in the greenhouse in order to minimize the impact of other environmental stress factors (such as drought, pests), but under conditions as similar as possible to those of the field. Soil was collected from the same multimetal- (Cu and Zn) contaminated area used for the field trials. The response of AL35 plants in terms of foliar steady-state levels of MT and PA biosynthetic gene transcripts, as well as PA concentrations, during the first and second growing season was investigated after pre-inoculating them with the AMF Glomus mosseae or G. intraradices, and compared with that of plants grown on non-polluted soil, equally inoculated or not with AMF. Results are discussed in relation to the differences in plant biomass, metal uptake and translocation observed in mycorrhizal compared with non-mycorrhizal plants.

MATERIALS AND METHODS

Plant material

The poplar clone Populus alba L. AL35 used in the present study was selected during a field trial (Castiglione et al., 2009) on a metal-polluted site, located next to the KME-Italy S.p.A. factory (Serravalle Scrivia, AL, Italy). Cuttings 20 cm long were collected in February 2006 from plants growing in the field, and stored at 4 °C until use.

Fungal inoculation

In March 2006, the poplar cuttings were placed overnight under running tap water. They were then put into 20 cm high plastic pots (750 mL) containing heat-sterilized (180 °C, 3 h) quartz sand (3–4 mm diameter). Pots were inoculated with either G. mosseae (Gerd. and Nicol.) Gerdemann and Trappe BEG 12 or G. intraradices (Schenck and Smith) BB-E (supplied by Biorize, Dijon, France) as previously described (Lingua et al., 2008), or were not inoculated (controls). Inoculum was provided at 50 % (v/v) concentration around each cutting, using a 50 mL bottomless Falcon tube around the cutting. Cuttings were fed on alternate days with 80 mL of Long Ashton solution, modified according to Trotta et al. (1996). After 1 month, the cuttings were transferred into sterilized 7·5 L plastic pots containing either polluted or non-polluted autoclaved soil (see below).

Experimental design and growth conditions

The soil originating from the above-mentioned polluted site is a sandy loam (according to USDA specifications) and has the following chemical features: organic matter 2·24 % d. wt; N < 0·01 d. wt; K 0·0237 % d. wt; P 0·0026 % d. wt; pH 6·2, with a mean soil total zinc concentration of 950 mg kg−1 d. wt and 1300 mg kg−1 d. wt of copper (Castiglione et al., 2009). The non-polluted soil, collected from a nearby uncontaminated area, had similar features, and mean Zn and Cu concentrations of 60 and 14 mg kg−1 d. wt, respectively. The chemical analyses (performed by Idrocons s.r.l., Rivalta Scrivia, Tortona, Italy) were carried out by inductively coupled plasma optic emission spectrometry (ICP-OES) as described in Lingua et al. (2008).

The experimental design therefore consisted of growing the plants pre-inoculated with either G. mosseae (Gm plants) or G. intraradices (Gi plants) for two vegetative seasons (from March 2006 to July 2007) in pots containing either polluted or non-polluted soil. Ten plants per treatment were prepared, placed in a greenhouse and automatically watered (from the top) twice a week before dawn for 3 min; in July and August, plants were watered for 8 min on alternate days. A commercial organic slow release fertilizer (Grenagro Medio Plus, Grena, San Bonifacio, Verona, Italy) was supplied (16·5 g per plant) once. The same numbers of uninoculated plants were grown under the same conditions.

Sampling procedure

Samples were taken in July 2006 (first sampling, 4-month-old plants) and in July 2007 (second sampling, end of experiment, 16-month-old plants). In the first year, leaf samples, representative of the entire foliage of the plant (excluding the youngest unexpanded leaves), were taken from all plants in each treatment. In the second year, the whole plant was harvested; root, stem and leaf samples (as above) were collected and stored separately for fresh and dry weight measurements, and for determination of Cu, Zn and P concentrations. The leaves from groups of 3–4 plants per treatment (from a total of ten) were pooled in order to have three biological repeats at each sampling time, frozen in liquid nitrogen and stored at –80 °C for RNA extraction and PA determination, or dried at 75 °C up to constant weight for HM determinations.

Chemical analyses

Approximately 0·5 g d. wt from three biological replicates were used for the quantification of Cu, Zn and P in leaves, stems and roots, separately. Samples were digested, and their metal concentrations determined as described in Lingua et al. (2008) by ICP-OES using an IRIS Advantage ICAP DUO HR series (Thermo Jarrell Ash, Franklin, MA, USA) spectrometer.

Analysis of growth and mycorrhizal colonisation

At the end of the experiment (July 2007), growth was evaluated on the basis of leaf, stem (excluding the weight of the original cutting) and root fresh and dry weights. The degree of mycorrhizal colonization of all plants, pre-inoculated or not, was evaluated microscopically using the method of Trouvelot et al. (1986) on fifty 1 cm long root segments per plant. Microscopic observations were carried out at ×50–×630 magnifications. Results are expressed as intensity of colonization, i.e. percentage of colonized roots (M %). The production of arbuscules and vesicles was also investigated.

Northern blot analysis

Total RNA was extracted from approx. 100 mg of frozen leaves using the RNeasy Plant Mini Kit (Qiagen, Milano, Italy) with on-column DNA digestion to eliminate traces of genomic DNA according to the manufacturer's instructions. For northern blot analysis, the P. trichocarpa cDNA sequences available in the EMBL database (accession nos AY594295 and AY594296 for MT1, AY594297 and AY594298 for MT2, AY594299 and AY594300 for MT3, respectively) were used to design the DNA primers of PaMT1, PaMT2 and PaMT3 as described in Castiglione et al. (2007). For PaADC, PaODC and PaSAMDC, the primers described in Franchin et al. (2007) were used; in the case of PaSPDS1, primers are those shown below.

Quantitative reverse transcription–PCR (qRT–PCR)

Gene-specific primers used for PCR experiments, designed on poplar sequences available at the P. trichocarpa database (http://genome.jgi-psf.org/Poptr1_1/Poptr1_1.home.html) using the primer design software Primer3, version 0.4.0, are listed in Table 1. Total RNA, extracted from leaf tissues and treated with RNase-free DNAase (Qiagen, Milano, Italy), was used to generate cDNA using an Omniscript RT synthesis kit (Qiagen, Milano, Italy). The cDNA was then used as substrate in qRT–PCR experiments, and amplified in duplicate using the BioRad iQ5 cycler in a final volume of 20 µl of 2× iQ SYBR green supermix (Bio-Rad Laboratories, Hercules, CA, USA). The following thermal cycle conditions were used for amplifications of the target and housekeeping genes: an initial denaturing step at 95 °C for 3 min followed by 45 cycles, with one cycle consisting of denaturation at 95 °C for 10 s, annealing for 40 s at temperatures indicated in Table 1, and extension at 55 °C for 10 s.

Table 1.

List of primer pairs and of annealing temperatures used for RT–PCR amplifications of Populus alba metallothionein (MT), spermidine synthase (SPDS), arginine decarboxylase (ADC) and actin genes.

Primer DNA sequence Annealing temperature (°C)
MT1a_for 5′ ATGTCTGGCTGTAGCTGTGG 3' 60
MT1a_rev_UTR 5′ ACCATGTCCATGTGTCCTCAT 3′ 60
MT1b_for 5′ CCTAAAGAAAATGTCTGGTT 3′ 55
MT1b_rev_UTR 5′ TATAGGCCACAATAACTACTT 3′ 55
MT2a_for 5′ ATGCT TGCTGTGGTGGAAGC 3′ 55
MT2a_rev_UTR 5′ GAATCAACGCAGCCAGC 3′ 55
MT2b_for 5′ CAGATGCAGCATGTACCCA 3′ 55
MT2b_rev_UTR 5′ GTTTTCTCATTTGCAGGAGC 3′ 55
MT3a_for 5′ ATGTCTAGCACCTGCGACAA 3′ 55
MT3a_rev_UTR 5′ ACACATGACGGTTTACGTG 3′ 55
MT3b_for 5′ AATCATCATGTCTAGCACCT 3′ 55
MT3b_rev_UTR 5′ CATGATAGTTGATGTGCTTG 3′ 55
PaADC_for 5′ TGGTGATAGCGATCATGGAA 3′ 55
PaADC_rev 5′ CGGGGATGTTACTCTCAAGC 3′ 55
PaSPDS1_for 5′ TCGATTCCATCTCCCAAAAC 3′ 55
PaSPDS1_rev 5′ CCTCAAATCCAACAGCCAAT 3′ 55
PaSPDS2_for 5′ TGACGTAGCAATCGGGTATG 3′ 55
PaSPDS2_rev 5′ TGTGCTCACAACTCCTCCTG 3′ 55
Actin_for 5′ GCCCAGAGGTCCTCTTCCAA 3′ 55–60
Actin_rev 5′ GGGGCTAGTGCTGAGATTT 3′ 55–60
Open in a new tab

In each experiment, a negative (no-template) control was used to test for false-positive results or contaminations. Primers specific for P. trichocarpa actin were used for the normalization of reactions. Actin was chosen as housekeeping gene for all RT–PCR experiments after also testing poplar ubiquitin and 18S rDNA genes (data not shown). The actin gene was the most reproducible and stable with time and among samples. Data collection and analysis were performed using the Optical System Software (iQ5 version 2·0). Fold changes in RNA expression were estimated, using threshold cycles, by the comparative CT method (2−ΔΔCt) (Livak and Schmittgen, 2001). Threshold cycle (CT) values were in the range of 25–27 cycles for actin and 20–22 for the genes of interest. Data are the means (±s.e.) of three biological replicates.

HPLC analysis of polyamine content

Plant material (0·3–0·5 g f. wt leaves) was homogenized with 4 % perchloric acid, kept for 1 h on ice and centrifuged at 15 000 g for 30 min. Free and conjugated PAs (Put, Spd and Spm) were extracted, derivatized, and analysed by HPLC as described in Franchin et al. (2007).

Statistical analyses

Mean values and standard errors were calculated, and the data compared by one-way analysis of variance (ANOVA), followed by a post-hoc F-test with P < 0·05 as the significance cut-off.

RESULTS

Mycorrhizal colonization

On both polluted and non-polluted soil, M % in roots of non-inoculated plants at the end of the experiment was <1 % (Table 2). In contrast, plants inoculated with G. intraradices or G. mosseae showed levels of M % ranging from 5 to 23 % without significant differences between the two fungal species, and without any significant difference between polluted and non-polluted soil (data not shown). Although many vesicles were observed, no arbuscules were detected in any of the root samples.

Table 2.

Extent of mycorrhizal colonization (M %) by either G. mosseae (Gm) or G. intraradices (Gi) in the roots of P. alba clone AL35 after two growth seasons, on polluted or unpolluted (control) soil

No inoculation Gm Gi
Control 0·35 ± 0·11 4·65 ± 1·01 20·70 ± 13·00
Polluted 0·26 ± 0·09 11·36 ± 5·98 22·05 ± 8·88
Open in a new tab

Values are the means of five replicates ± ss.e. Differences were not statistically significant.

Biomass production

At the end of the experiment, fresh (data not shown) and dry weight measurements made in all plants from various treatments (Fig. 1) showed that the biomass of roots, stems and leaves was severely affected by polluted soil in the absence of AMF, with decreases of approx. 85 % relative to plants grown on non-polluted soil. On the latter soil, the presence of AMF did not affect fresh and dry weights (except leaves of Gm plants). In contrast, on polluted soil, both fungal species exerted a positive effect on the growth of all three organs (except leaves of Gi plants), with about 4- to 6-fold increases in mycorrhizal plants relative to non-mycorrhizal plants.

Fig. 1.

Fig. 1.

Open in a new tab

Root, stem and leaf biomass of P. alba clone AL35 after two growth seasons on non-polluted or polluted soil. Plants were either not inoculated (C) or inoculated with either G. mosseae (Gm) or G. intraradices (Gi). Different letters indicate significantly different (P < 0·05) values for treatments with reference to the same organ. Bars indicate s.e.

Copper, zinc and phosphorus concentrations in plant organs

Copper

In plants grown on polluted soil, Cu reached the highest concentrations in roots (up to 600 mg kg−1 d. wt) in comparison with all the other organs (Fig. 2). Both AMF caused a significant increase in root Cu concentration, with the highest levels in Gm plants (>6 times the levels observed in non-mycorrhizal plants). Copper concentration in stems was comparatively very low (ranging from approx. 5 to 20 mg kg−1 d. wt), with the non-mycorrhizal plants showing the highest values (Fig. 2), and no significant differences among the other treatments. Measurements at both sampling dates showed that Cu levels were always rather low in leaves (approx. 10–30 mg kg−1 d. wt) as compared with roots; at the second sampling date, both Gm and Gi plants showed a significant increase in leaf Cu concentration (Fig. 2). On non-polluted soil, root, stem and leaf Cu concentrations were similar in mycorrhizal and non-mycorrhizal plants (Fig. 2). The total amount of metal accumulated by the plants increased dramatically in roots upon inoculation with AMF (Table 3). An increase, albeit smaller, was also observed in leaves and stems. Thus, the total amount of Cu accumulated by Gm plants as a whole, relative to uninoculated plants, rose by 30-fold. The organ distribution of Cu was also different in non-mycorrhizal and mycorrhizal plants: from 68·7 % in roots (relative to the whole plant) in uninoculated plants to 95·0 and 93·5 % in Gm and Gi plants, respectively. Consequently, the shoot (leaf + stem)-to-root ratio, i.e. the translocation factor (TF), was also higher in the former as compared with the latter (Table 3).

Fig. 2.

Fig. 2.

Open in a new tab

Copper concentrations in leaves, stems and roots of P. alba clone AL35 grown on non-polluted or polluted soil in the absence (C) or presence of either G. mosseae (Gm) or G. intraradices (Gi). Leaves were collected after one (white bars) or two (black bars) growth seasons; stems and roots were harvested only at the second growth season (end of experiment). Different letters indicate significantly different (P < 0·05) values for treatments with reference to the same organ and separately for each sampling time. Bar indicate s.e.

Table 3.

Total Cu or Zn content, calculated as the product of mean metal concentration and mean dry weight, in leaves, stem and roots of P. alba clone AL35 after two growth seasons on polluted soil in the absence (C) or presence of either G. mosseae (Gm) or G. intraradices (Gi)

Leaves
 Stems
 Roots
Total (mg) % Total (mg) % Total (mg) % TF
Cu
C 0·010 8·9 0·025 22·3 0·077 68·7 0·45
Gm 0·089 2·9 0·064 2·1 2·955 95·3 0·05
Gi 0·012 1·3 0·047 5·3 0·832 93·5 0·07
Zn
C 0·194 44·1 0·166 37·7 0·078 17·7 4·6
Gm 1·502 50·0 0·525 16·9 1·035 33·7 2·0
Gi 0·203 12·8 0·967 61·9 0·394 15·2 3·0
Open in a new tab

Percentage content (%) in each organ relative to the total (leaves + stems + roots), and the shoot (leaf + stem)-to-root ratios [translocation factor (TF)] are also given.

Zinc

Zinc was mainly accumulated in the leaves (Fig. 3). At the first sampling date, leaves of Gm plants grown on polluted soil accumulated about twice the concentration of non-noculated and Gi plants (Fig. 3). At the end of the experiment, on polluted soil, leaf Zn concentrations reached even higher values (approx. 400–500 mg kg−1 d. wt), although differences between mycorrhizal and non-mycorrhizal plants were no longer significant (Fig. 3). In stems, Zn concentrations were lower than in leaves (60–120 mg kg−1 d. wt), and higher in non-inoculated and Gi plants than in Gm plants (Fig. 3). Root Zn concentrations (Fig. 3), which were of the same order of magnitude as in stems, were higher in Gm plants than in controls and Gi plants (which were not significantly different). The total amount of Zn per plant organ (Table 3) and per whole plant (data not shown) was always greater in mycorrhizal plants (with the exception of Gi leaves) as compared with non-mycorrhizal plants. As with Cu, the TF for Zn was diminished in mycorrhizal plants relative to uncolonized controls. On non-polluted soil, again no differences were detected in mycorrhizal compared with non-mycorrhizal plants in terms of Zn concentration in any of the three organs, except in roots of Gm and Gi plants where it was less than half of that of uninoculated plants (Fig. 3).

Fig. 3.

Fig. 3.

Open in a new tab

Zinc concentrations in leaves, stems and roots of P. alba clone AL35 grown on non-polluted or polluted soil in the absence (C) or presence of either G. mosseae (Gm) or G. intraradices (Gi). Leaves were collected after one (white bars) or two (black bars) growth seasons; stems and roots were harvested only at the second growth season (end of experiment). Different letters indicate significantly different (P < 0·05) values for treatments with reference to the same organ and separately for each sampling time. Bars indicate s.e.

Phosphorus

On polluted soil, no differences were detected in leaves of mycorrhizal compared with non-mycorrhizal plants at the first sampling date (data not shown); however, at the second sampling, P concentration was higher in leaves of Gi plants and in roots of both Gm and Gi plants compared with those of non-inoculated plants (Table 4), while this effect was not observed on non-polluted soil (data not shown).

Table 4.

Phosphorus concentrations (mg kg−1 d. wt, mean ± s.e.) at the second sampling date (end of experiment) in leaves, stems and roots of P. alba clone AL35 grown on polluted soil in the absence (C) or presence of either G. mosseae (Gm) or G. intraradices (Gi)

Leaves Stems Roots
C 1535 ± 138a 768 ± 69a 1001 ± 90a
Gm 1916 ± 172a 497 ± 45b 1540 ± 139b
Gi 2687 ± 241c 505 ± 45b 1727 ± 155b
Open in a new tab

Different letters indicate significantly different (P < 0·05) values for treatments with reference to the same organ (columns).

Steady-state transcript levels of MT genes

Given that the objective of this study was to investigate the effect of AMF colonization, the results of the quantitative real-time PCR analyses performed to evaluate steady-state transcript levels of MT, SPDS and ADC genes are presented by comparing relative expression levels in mycorrhizal plants compared with non-mycorrhizal plants, grown on either polluted or non-polluted soil.

At the first sampling date, transcript levels of all MT genes in leaves of plants grown on non-polluted soil were either lower or unaffected in the presence of AMF compared with uninoculated controls (Fig. 4). In contrast, when grown on polluted soil, expression of both a and b isogenes of PaMT1, PAMT2 and PaMT3 was upregulated (with the exception of PaMT3a in Gm plants) in the presence of mycorrhiza (Fig. 4). The largest (approx. 6-fold) increase was observed with PaMT1a in leaves of Gm plants.

Fig. 4.

Fig. 4.

Open in a new tab

Transcript levels of PaMT genes in leaves of P. alba clone AL35 at the first sampling date. Plants were grown on non-polluted or polluted soil in the absence (C) or presence of either G. mosseae (Gm) or G. intraradices (Gi). Steady-state mRNA levels were quantified by real-time RT–PCR. The mRNA levels were normalized with respect to actin, and are expressed relative to those of control plants that were arbitrarily given a value of 1. Bars represent 95 % confidence intervals calculated on three biological replicates. Different letters indicate significantly different (P < 0·05) values between mycorrhizal plants and non-mycorrhizal controls for each gene.

At the end of the experiment, the upregulation (from 2- to 8- to 9-fold) of MT gene expression in mycorrhizal plants grown on polluted soil was confirmed (Fig. 5). In contrast to the first sampling, however, transcription of PaMT1a, PaMT1b and PaMT2a was enhanced in mycorrhizal plants and that of PaMT2b, PaMT3a and PaMT3b only in Gi plants, also on non-polluted soil (Fig. 5).

Fig. 5.

Fig. 5.

Open in a new tab

Transcript levels of PaMT genes in leaves of P. alba clone AL35 at the second sampling date. Plants were grown on non-polluted or polluted soil in the absence (C) or presence of either G. mosseae (Gm) or G. intraradices (Gi). Steady-state mRNA levels were quantified by real-time RT–PCR. The mRNA levels were normalized with respect to actin, and are expressed relative to those of control plants that were arbitrarily given a value of 1. Bars represent 95 % confidence intervals calculated on three biological replicates. Different letters indicate significantly different (P < 0·05) values between mycorrhizal plants and non-mycorrhizal controls for each gene.

Transcript levels of PA biosynthetic genes, and PA accumulation

A preliminary northern blot analysis on total RNA extracted from leaves, collected at the first sampling date, was performed for the main PA biosynthetic enzymes: PaADC, PaODC, PaSAMDC and PaSPDS. Results showed that only ADC and SPDS were differentially expressed on polluted/non-polluted soil in mycorrhizal compared with non-mycorrhizal plants (data not shown). Consequently, qRT–PCR analyses were performed to evaluate steady-state transcript levels only of the responsive genes.

At the first sampling date, no marked changes in PaADC mRNA levels were observed in leaves of mycorrhizal compared with non-mycorrhizal plants on non-polluted soil (Fig. 6A). In contrast, an induction of PaADC transcription was observed in mycorrhizal plants grown on polluted soil: 7-fold in Gm and 4-fold in Gi plants (Fig. 6B). At the second sampling, ADC gene expression was downregulated in inoculated plants as compared with non-inoculated plants, and to the same extent on polluted and non-polluted soil (Fig. 6C, D).

Fig. 6.

Fig. 6.

Open in a new tab

Transcript levels for PaADC in leaves of P. alba clone AL35 at the first (A, B) and second (C, D) sampling dates. Plants were grown on non-polluted (A, C) or polluted (B, D) soil in the absence (C) or presence of either G. mosseae (Gm) or G. intraradices (Gi). Steady-state mRNA levels were quantified by real-time RT–PCR. The mRNA levels were normalized with respect to actin, and are expressed relative to those of control plants that were arbitrarily given a value of 1. Bars represent 95 % confidence intervals calculated on three biological replicates. Different letters indicate significantly different (P < 0·05) values between mycorrhizal plants and non-mycorrhizal controls.

The transcription of the two PaSPDS genes at first sampling in leaves of plants grown on non-polluted soil was lower or unchanged in the presence of G. intraradices or G. mosseae, respectively, relative to uninoculated controls (Fig. 7A). In contrast, in the presence of HMs, PaSPDS1 and PaSPDS2 were both upregulated in Gi plants (Fig. 7B). At the second sampling date, both SPDS transcripts were induced by inoculation with AMF on both non-polluted (Fig. 7C) and polluted soil (with the exception of PaSPDS2 in Gm plants; Fig. 7D).

Fig. 7.

Fig. 7.

Open in a new tab

Transcript levels for PaSPDS1 and PaSPDS2 in leaves of P. alba clone AL35 at the first (A, B) and second (C, D) sampling dates. Plants were grown on non-polluted (A, C) or polluted (B, D) soil in the absence (C) or presence of either G. mosseae (Gm) or G. intraradices (Gi). Steady-state mRNA levels were quantified by real-time RT–PCR. The mRNA levels were normalized with respect to actin, and are expressed relative to those of control plants that were arbitrarily given a value of 1. Bars represent 95 % confidence intervals calculated on three biological replicates. Different letters indicate significantly different (P < 0·05) values between mycorrhizal plants and non-mycorrhizal controls for each gene.

Put, Spd and Spm were detected in their free (Fig. 8A, B) and soluble conjugated forms (Fig. 8C) in leaves of plants grown on either non-polluted or polluted soil. Free Put and Spd levels were significantly lower in the former compared with the latter. At first sampling, on non-polluted soil, free PA levels were strongly reduced in the presence of AMF (Fig. 8A), while those of conjugated Put, Spd and/or Spm were significantly higher in mycorrhizal plants, as compared with uninoculated controls (Fig. 8C). On polluted soil, free Spd titres were significantly higher in the presence than in the absence of AMF, especially G. mosseae (Fig. 8B); conjugated Spd and Spm titres were also dramatically enhanced (up to 5-fold) relative to uninoculated controls, but only in Gi plants (Fig. 8D).

Fig. 8.

Fig. 8.

Open in a new tab

Free (A, B) and soluble conjugated (C, D) putrescine (Put), spermidine (Spd) and spermine (Spm) levels in leaves of P. alba clone AL35 (first sampling date) grown on non-polluted (A, C) or polluted (B, D) soil in the absence (C) or presence of either G. mosseae (Gm) or G. intraradices (Gi). Different letters indicate, separately for each polyamine, values that are significantly different (P < 0·05) from those of the uninoculated control. Bars indicate s.e.

At the end of the experiment, free and conjugated PA levels in mycorrhizal samples compared with uninoculated controls were not significantly different on both soil types (data not shown).

DISCUSSION

In this long-term greenhouse study, AMF were shown to restore growth, despite greater metal accumulation, of a selected white poplar clone grown on a multimetal-contaminated soil and to enhance foliar steady-state transcript levels of several stress-related gene families, namely MTs, ADC and SPDS, the latter two together with their products, i.e. PAs.

AMF restore plant biomass production despite higher Cu and Zn accumulation in plant organs

In the present work, % M, with either G. mosseae or G. intraradices, of clone AL35 poplar roots was comparable in plants grown on non-polluted and polluted soil. This indicates that pre-inoculation with the fungal propagules could overcome the reduced (or lack of) spontaneous mycorrhization (Leyval et al., 1997; Turnau, 1998). Moreover, given that poplar can also establish associations with ectomycorrhiza (Karlinski et al., 2010), it would be desirable to perform experiments with dual inoculation to simulate the field situation more realistically.

The extent of mycorrhizal colonization is in line with previous reports relative to poplar (Neville et al., 2002; Quoreshi and Khasa, 2008). In a few cases, AM colonization reached higher levels (e.g. Lopez-Aguillon and Garbaye, 1989; Khasa et al., 2002; Karlinski et al., 2010). Although arbuscules were not observed, the presence of vesicles and of mostly non-septate hyphae, and the rare traces of colonization in non-inoculated plants, strongly support the idea that these fungal structures derived from artificial pre-inoculation. The lack of arbuscules could be related to the high level of P in the soil (Smith and Read, 1997), or to the plant species or clone, and was previously observed for another P. alba accession inoculated with the same fungal species (Lingua et al., 2008). When quantified, arbuscule abundance is, in fact, usually rather low in poplar (Kaldorf et al., 2002; Todeschini et al., 2007; Lingua et al., 2008); Takàcs et al. (2005) reported a high value of a % (65 %) only in a few poplar clones on both unpolluted and polluted soils. Thus, if any improvement in P nutrition occurs by means of the AMF, the exchange with plants might be localized in structures different from the arbuscules. It has in fact been reported that, in tomato, non-mycorrhizal roots express only two P transporter genes, whilst mycorrhizal roots express five genes; two out of five are exclusive to cells containing arbuscules, while one is also expressed in cells which do not contain arbuscules (Balestrini et al., 2007). In addition, modifications in the architecture of the root system in response to mycorrhization can affect the efficiency of plant nutrient uptake (Hooker et al., 1992). Alternatively, the fact that no arbuscules were detected at the time of harvest may be due to seasonal variations in their abundance.

Growth retardation is a frequent symptom of HM phytotoxicity; however, in AL35 biomass was restored to levels comparable with that of plants grown on non-polluted soil by inoculation with AMF, suggesting that mycorrhization exerted a strong protective effect against HM toxicity.

The only case of a limited restoration of growth was leaf biomass in Gi plants. Histological analyses have revealed differences at the chloroplast level between leaves of Gm and Gi plants of P. alba ‘Villafranca’ grown on Zn-supplemented soil (V. Todeschini et al., unpubl. res.). Thus, these two fungal species might exert differential effects on plants exposed to HMs (Lingua et al., 2008).

Although increased nitrogen and P content could be part of the plant tolerance mechanism (Lin et al., 2007), in the present study, P concentration in the different organs was not enhanced by inoculation with AMF, possibly due to the fact that the soil was sufficiently rich in nutrients. This lack of difference between mycorrizal and non-mycorrhizal plants may also mask differences in P use efficiency, but also allowed us to separate the effects of fungal occupancy on gene expression (discussed below) from those of improved plant nutrient status. It is noteworthy, on the other hand, that at the second sampling, non-mycorrhizal plants grown on polluted soil had about half the root P concentration of plants grown on non-polluted soil, but that levels were recovered following inoculation with AMF. This suggests that growth recovery was, at least in part, due to a general effect on nutritional status.

Stress alleviation by AMF occurred in spite of the fact that organs of mycorrhizal plants accumulated higher concentrations of Cu and Zn than those of non-mycorrhizal plants, discarding the possibility that they were protected via the ‘dilution effect’ (Audet and Charest, 2007). Even though mycorrhiza may decrease HM toxicity to plants by promoting their immobilization in the soil (Hildebrandt et al., 2007, and references therein), according to Lebeau et al. (2008) metal concentrations in microorganism-assisted plants are often higher than in controls grown on non-bioaugmented soil. HM concentrations recorded in this study were comparable with those recently reported by Hassinen et al. (2009) for hybrid aspen, except for Cu concentrations that were considerably higher in roots of both mycorrhizal and non-mycorrhizal AL35 plants. This organ distribution is in agreement with other studies on Salicaceae (Vandecasteele et al., 2005; Todeschini et al., 2007; Guerra et al., 2009). A restricted root-to-shoot transport of Cu was likewise reported by Guerra et al. (2009) for P. deltoides. In contrast, Zn was translocated and mostly accumulated in the leaves, again according to the expected pattern (Di Baccio et al., 2003; Lingua et al., 2008). The present results also reveal an altered allocation in mycorrhizal compared with non-mycorrhizal plants for both HMs. In particular, Gm plants, which grew much better than controls on polluted soil, exhibited substantially higher root contents of both HMs; indeed, increased metal concentration in microorganism-assisted plants is, most of the time, proportionally higher in roots than in shoots (Lebeau et al., 2008). Plants that preferentially accumulate HMs in roots generally display higher tolerance, because the photosynthetic apparatus is protected from toxicity (Pulford et al., 2002). Indeed, reduced HM toxicity due to inoculation with AMF has been associated with diminished root-to-shoot translocation in metallophytes (Hildebrandt et al., 2007) and some mycorrhizal legumes (Lin et al., 2007).

Metallothionein gene expression is enhanced by AMF on polluted soil

When mycorrhizal plants grow better than their non-mycorrhizal counterparts despite accumulating more metal(s), the ameliorative effect exerted by the microorganism probably depends upon detoxifying and/or molecular and biochemical processes that set in to relieve stress (Galli et al., 1995).

The improved tolerance of the mycorrhizal AL35 clone was associated, in general, with higher MT gene expression, suggesting that these polypeptides may afford protection against HM-induced stress as previously reported in Pisum (Rivera-Becerril et al., 2005). MTs probably exert an antioxidant function (Akashi et al., 2004), as recently shown in transgenic P. alba ‘Villafranca’ plantlets over-expressing a pea MT2 gene (PsMTA1; Balestrazzi et al., 2009). Indeed, MT gene expression in clone AL35 was strongly affected by inoculation with AMF at the first sampling date, but the two types of soil caused an opposite effect. Ouziad et al. (2005) found, in contrast to present data, that tomato plants inoculated with G. intraradices and grown on HM-polluted soil showed reduced expression of Lemt2, but this was associated with lowered metal concentration compared with the non-colonized controls. In AL35 plants, at first sampling, there was no direct relationship, except in the case of Gm plants, between leaf metal concentrations and MT transcript levels; hence, the former cannot explain the observed induction of the latter in mycorrhizal plants grown on polluted soil. However, data from the second sampling indicate that roots of Gm/Gi plants had accumulated higher concentrations than controls of one or both metals. This would suggest that leaf mRNA levels were induced by a signal coming from the root (i.e. the high metal concentration and/or the AMF). Since results from non-polluted soil show that the fungus alone did not have this effect, both stimuli appear to be necessary for this induction to take place. This has been confirmed by the results of a genome-wide transcriptomic analysis conducted in parallel showing that, under the present experimental conditions, many genes, including the MT genes, were either downregulated or unaffected in AL35 plants grown on polluted soil, as compared with those grown on non-polluted soil in the absence of AMF (A. Cicatelli et al., unpubl. res.). The transcriptomic study shows that the majority of genes whose expression was activated by HMs and AMF are involved in defence/protection from stress. A gene encoding a protein not directly involved in stress protection (intracellular transport protein) was, instead, downregulated in mycorrhizal plants grown on polluted soil as compared with non-mycorrizal plants. At the second sampling date, non-mycorrhizal and mycorrhizal plants showed a similar upregulation of MT gene expression on polluted and non-polluted soil, suggesting that the plants may have adapted to the metal-polluted soil such that the effects that persisted were mainly due to fungal colonization.

PA metabolism is enhanced in mycorrhizal plants grown on polluted soil

Generally speaking, enhanced Put titres seem to be a common physiological response to HM stress (Lei et al., 2007; Groppa and Benavides, 2008; Castiglione et al., 2009).

In the present study, the combination of HMs and AMF caused an increase in ADC mRNA levels, in agreement with the purported role of this enzyme in plant responses to different stresses (Groppa and Benavides, 2008). This occurred despite the lack of accumulation of Put, which could depend upon the fact that it was converted into Spd. PaSPDS1 and PaSPDS2 upregulation in mycorrhizal AL35 plants growing on polluted soil was more accentuated in Gi plants than in Gm plants. Transcriptional changes associated with colonization by G. mosseae or G. intraradices in roots of Medicago truncatula also revealed several hundred genes that were up- or downregulated by only one of the two fungal species (Hohnjec et al., 2005).

As a result of the transcriptional upregulation of SPDS genes, also reported to be associated with HM tolerance (Wen et al., 2010), foliar concentrations of Spd and, to a lesser extent, Spm were significantly higher in mycorrhizal plants than in uninoculated controls on polluted soil, and correlated with improved plant growth. The accumulation of the higher PAs, rather than the diamine Put, seems to be typical of mycorrhizal plants grown under abiotic stress (Sannazzaro et al., 2007). The idea that PAs play a protective role is based upon data indicating that they behave as antioxidants and/or metal chelators (Kuthanová et al., 2004; Groppa et al., 2007).

The present data show that conjugated PAs also increased in leaves of mycorrhizal plants grown on polluted soil. These conjugates are mainly phenylamides, i.e. products of the covalent bonding of PAs with hydroxycinnamic acids, and can be regarded as secondary metabolites (Edreva et al., 2007) with protective functions. Long-distance signalling from mycorrhizal roots may result in the activation of secondary metabolite production in leaves (Guerrieri et al., 2004; Copetta et al., 2006). The singlet oxygen quenching capacity of phenylamides, as well as their free radical-scavenging properties, have been established in vitro, and may also operate in vivo (Edreva et al., 2007). In plants grown on non-polluted soil (first sampling date), the modest increase in conjugated PAs can be interpreted as a defence response to the systemic signal generated by the AMF per se, in agreement with Peipp et al. (1997) who reported that phenylamides accumulated in barley upon G. intraradices colonization. This increased amount of conjugated PAs occurred at the expense of the respective free forms, suggesting that PA conjugation to phenolic compounds was enhanced, but not biosynthetic activity, as indicated by the down- rather than upregulation of PaADC and PaSPDS expression. At the second sampling, differences between mycorrhizal and non-mycorrhizal plants as regards foliar PA and biosynthetic gene transcript levels followed the same pattern on both non-polluted and polluted soil, and may be again indicative of the plant's long-term adaptation to HM stress.

In conclusion, plants of clone AL35 grown on polluted soil and artificially inoculated with G. mosseae or G. intraradices show improved biomass relative to uninoculated controls, enhanced expression of MT and PA biosynthetic genes (PaADC, PaSPDS1 and PaSPDS2), together with the accumulation of Spd and Spm. Taken together, these results suggest that stress recovery may derive from the protective role of these molecules, and provide new insight into the combined effect of HMs and AMF.

ACKNOWLEDGEMENTS

This work was supported by funds from the Italian Ministry for Education, University and Research (PRIN 2005_2007055337), the Italian Ministry of Environment, Land and Sea Protection (‘Research and development in biotechnology applied to the protection of the environment’ in collaboration with The People's Republic of China) to S.C., and from Associazione Ambiente-Territorio-Formazione to G.L. Cinzia Franchin is gratefully acknowledged for performing the northern blot analyses, and Marco Sobrero for assistance with plant growth and management.

LITERATURE CITED

  1. Akashi K, Nishimura N, Ishida Y, Yokota A. Potent hydroxyl radical-scavenging activity of drought-induced type-2 metallothionein in wild watermelon. Biochemical and Biophysical Research Communications. 2004;323:72–78. doi: 10.1016/j.bbrc.2004.08.056. [DOI] [PubMed] [Google Scholar]
  2. Alcazar R, Altabella T, Marco F, et al. Polyamines: molecules with regulatory functions in plant abiotic stress tolerance. Planta. 2010;231:1237–1249. doi: 10.1007/s00425-010-1130-0. [DOI] [PubMed] [Google Scholar]
  3. Audet P, Charest C. Dynamics of arbuscular mycorrhizal symbiosis in heavy metal phytoremediation: meta-analytical and conceptual perspectives. Environmental Pollution. 2007;147:609–614. doi: 10.1016/j.envpol.2006.10.006. [DOI] [PubMed] [Google Scholar]
  4. Balestrazzi A, Botti S, Zelasco S, et al. Expression of the PsMT (A1) gene in white poplar engineered with the MAT system is associated with heavy metal tolerance and protection against 8-hydroxy-2'-deoxyguanosine mediated-DNA damage. Plant Cell Reports. 2009;28:1179–1192. doi: 10.1007/s00299-009-0719-x. [DOI] [PubMed] [Google Scholar]
  5. Balestrini R, Gomez-Ariza J, Lanfranco L, Bonfante P. Laser microdissection reveals that transcripts for five plant and one fungal phosphate transporter genes are contemporaneously present in arbusculated cells. Molecular Plant–Microbe Interactions. 2007;20:1055–1062. doi: 10.1094/MPMI-20-9-1055. [DOI] [PubMed] [Google Scholar]
  6. Bois G, Piche Y, Fung MYP, Khasa DP. Mycorrhizal inoculum potentials of pure reclamation materials and revegetated tailing sands from the Canadian oil sand industry. Mycorrhiza. 2005;15:149–158. doi: 10.1007/s00572-004-0315-4. [DOI] [PubMed] [Google Scholar]
  7. Castiglione S, Franchin C, Fossati T, et al. High zinc concentrations reduce rooting capacity and alter metallothionein gene expression in white poplar (Populus alba L. cv. Villafranca) Chemosphere. 2007;67:1117–1126. doi: 10.1016/j.chemosphere.2006.11.039. [DOI] [PubMed] [Google Scholar]
  8. Castiglione S, Todeschini V, Franchin C, et al. Clonal differences in survival capacity, copper and zinc accumulation, and correlation with leaf polyamine levels in poplar: a large-scale field trial on heavily polluted soil. Environmental Pollution. 2009;157:2108–2117. doi: 10.1016/j.envpol.2009.02.011. [DOI] [PubMed] [Google Scholar]
  9. Cobbett C, Goldsbrough P. Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annual Review of Plant Biology. 2002;53:159–182. doi: 10.1146/annurev.arplant.53.100301.135154. [DOI] [PubMed] [Google Scholar]
  10. Cona A, Rea G, Angelini R, Federico R, Tavaldoraki P. Functions of amine oxidases in plant development and defence. Trends in Plant Science. 2006;11:80–88. doi: 10.1016/j.tplants.2005.12.009. [DOI] [PubMed] [Google Scholar]
  11. Copetta A, Lingua G, Berta G. Effects of three AM fungi on growth, distribution of glandular hairs, and essential oil production in Ocimum basilicum L. var. Genovese. Mycorrhiza. 2006;16:485–494. doi: 10.1007/s00572-006-0065-6. [DOI] [PubMed] [Google Scholar]
  12. Di Baccio D, Tognetti R, Sebastiani L, Vitagliano C. Responses of Populus deltoides × Populus nigra (Populus × euramericana) clone I-214 to high zinc concentrations. New Phytologist. 2003;159:443–452. doi: 10.1046/j.1469-8137.2003.00818.x. [DOI] [PubMed] [Google Scholar]
  13. Edreva AM, Velikova VB, Tsonev TD. Phenylamides in plants. Russian Journal of Plant Physiology. 2007;54:287–301. [Google Scholar]
  14. Franchin C, Fossati T, Pasquini E, et al. High concentrations of zinc and copper induce differential polyamine responses in micropropagated white poplar (Populus alba) Physiologia Plantarum. 2007;130:77–90. [Google Scholar]
  15. Galli U, Schuepp H, Brunold C. Thiols of Cu-treated maize plants inoculated with the arbuscular-mycorrhizal fungus Glomus intraradices. Physiologia Plantarum. 1995;94:247–253. [Google Scholar]
  16. Gamalero E, Berta G, Massa N, Glick BR, Lingua G. Interactions between Pseudomonas putida UW4 and Gigaspora rosea BEG9 and their consequences for the growth of cucumber under salt-stress conditions. Journal of Applied Microbiology. 2010;108:236–245. doi: 10.1111/j.1365-2672.2009.04414.x. [DOI] [PubMed] [Google Scholar]
  17. Groppa MD, Benavides MP. Polyamines and abiotic stress: recent advances. Amino Acids. 2008;34:35–45. doi: 10.1007/s00726-007-0501-8. [DOI] [PubMed] [Google Scholar]
  18. Groppa MD, Tomaro ML, Benavides MP. Polyamines and heavy metal stress: the antioxidant behavior of spermine in cadmium- and copper-treated wheat leaves. Biometals. 2007;20:185–195. doi: 10.1007/s10534-006-9026-y. [DOI] [PubMed] [Google Scholar]
  19. Guerra F, Duplessis S, Kohler A, et al. Gene expression analysis of Populus deltoides roots subjected to copper stress. Environmental and Experimental Botany. 2009;67:335–344. [Google Scholar]
  20. Guerrieri E, Lingua G, Digilio MC, Massa N, Berta G. Do interactions between plant roots and the rhizosphere affect parasitoid behaviour? Ecological Entomology. 2004;29:753–756. [Google Scholar]
  21. Hahlbrock K, Scheel D. Physiology and molecular biology of phenylpropanoid metabolism. Annual Review of Plant Physiology and Plant Molecular Biology. 1989;40:347–369. [Google Scholar]
  22. Hassinen V, Vallinkoski VM, Issakainen S, Tervahauta A, Karenlampi S, Servomaa K. Correlation of foliar MT2b expression with Cd and Zn concentrations in hybrid aspen (Populus tremula × tremuloides) grown in contaminated soil. Environmental Pollution. 2009;157:922–930. doi: 10.1016/j.envpol.2008.10.023. [DOI] [PubMed] [Google Scholar]
  23. Hildebrandt U, Regvar M, Bothe H. Arbuscular mycorrhiza and heavy metal tolerance. Phytochemistry. 2007;68:139–146. doi: 10.1016/j.phytochem.2006.09.023. [DOI] [PubMed] [Google Scholar]
  24. Hohnjec N, Vieweg ME, Puhler A, Becker A, Kuster H. Overlaps in the transcriptional profiles of Medicago truncatula roots inoculated with two different Glomus fungi provide insights into the genetic program activated during arbuscular mycorrhiza. Plant Physiology. 2005;137:1283–1301. doi: 10.1104/pp.104.056572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hooker JE, Munro M, Atkinson D. Vesicular-arbuscular mycorrhizal fungi induced alteration in poplar root system morphology. Plant and Soil. 1992;145:207–214. [Google Scholar]
  26. Kaldorf M, Fladung M, Muhs H-J, Buscot F. Mycorrhizal colonization of transgenic aspen in a field trial. Planta. 2002;214:653–660. doi: 10.1007/s004250100658. [DOI] [PubMed] [Google Scholar]
  27. Karliński L, Rudawska M, Kieliszewska-Rokicka B, Leski T. Relationship between genotype and soil environment during colonization of poplar roots by mycorrhizal and endophytic fungi. Mycorrhiza. 2010;20:315–324. doi: 10.1007/s00572-009-0284-8. [DOI] [PubMed] [Google Scholar]
  28. Khasa PD, Chakravarty P, Robertson A, Thomas BR, Dancik BP. The mycorrhizal status of selected poplar clones introduced in Alberta. Biomass and Bioenergy. 2002;22:99–104. [Google Scholar]
  29. Kohler A, Blaudez D, Chalot M, Martin F. Cloning and expression of multiple metallothioneins from hybrid poplar. New Phytologist. 2004;164:83–93. doi: 10.1111/j.1469-8137.2004.01168.x. [DOI] [PubMed] [Google Scholar]
  30. Kramer U. Phytoremediation: novel approaches to cleaning up polluted soils. Current Opinion in Biotechnology. 2005;16:133–141. doi: 10.1016/j.copbio.2005.02.006. [DOI] [PubMed] [Google Scholar]
  31. Kuiper I, Lagendijk EL, Bloemberg GV, Lugtenberg BJJ. Rhizoremediation: a beneficial plant–microbe interaction. Molecular Plant-Microbe Interactions. 2004;17:6–15. doi: 10.1094/MPMI.2004.17.1.6. [DOI] [PubMed] [Google Scholar]
  32. Kusano T, Berberich T, Tateda C, Takahashi Y. Polyamines: essential factors for growth and survival. Planta. 2008;228:367–381. doi: 10.1007/s00425-008-0772-7. [DOI] [PubMed] [Google Scholar]
  33. Kuthanová A, Gemperlová L, Zelenková S, et al. Cytological changes and alterations in polyamine contents induced by cadmium in tobacco BY-2 cells. Plant Physiology and Biochemistry. 2004;42:149–156. doi: 10.1016/j.plaphy.2003.11.003. [DOI] [PubMed] [Google Scholar]
  34. Lebeau T, Braud A, Jezequel K. Performance of bioaugmentation-assisted phytoextraction applied to metal contaminated soils: a review. Environmental Pollution. 2008;153:497–522. doi: 10.1016/j.envpol.2007.09.015. [DOI] [PubMed] [Google Scholar]
  35. Lei YB, Korpelainen H, Li CY. Physiological and biochemical responses to high Mn concentrations in two contrasting Populus cathayana populations. Chemosphere. 2007;68:686–694. doi: 10.1016/j.chemosphere.2007.01.066. [DOI] [PubMed] [Google Scholar]
  36. Leyval C, Turnau K, Haselwandter K. Effect of heavy metal pollution on mycorrhizal colonization and function: physiological, ecological and applied aspects. Mycorrhiza. 1997;7:139–153. [Google Scholar]
  37. Lin AJ, Zhang XH, Wong MH, et al. Increase of multi-metal tolerance of three leguminous plants by arbuscular mycorrhizal fungi colonization. Environmental Geochemistry and Health. 2007;29:473–481. doi: 10.1007/s10653-007-9116-y. [DOI] [PubMed] [Google Scholar]
  38. Lingua G, D'Agostino G, Massa N, Antosiano M, Berta G. Mycorrhiza-induced differential response to a yellows disease in tomato. Mycorrhiza. 2002;12:191–198. doi: 10.1007/s00572-002-0171-z. [DOI] [PubMed] [Google Scholar]
  39. Lingua G, Franchin C, Todeschini V, et al. Arbuscular mycorrhizal fungi differentially affect the response to high zinc concentrations of two registered poplar clones. Environmental Pollution. 2008;153:137–147. doi: 10.1016/j.envpol.2007.07.012. [DOI] [PubMed] [Google Scholar]
  40. Liu J-H, Kitashiba H, Wang J, Ban Y, Moriguchi T. Polyamines and their ability to provide environmental stress tolerance to plants. Plant Biotechnology. 2007;24:117–126. [Google Scholar]
  41. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  42. Lopez-Aguillon R, Garbaye J. Some aspects of a double symbiosis with ectomycorrhizal and VAM fungi. Agriculture, Ecosystems and Environment. 1989;29:263–266. [Google Scholar]
  43. Neville J, Tessier JL, Morrison I, Scarratt J, Canning B, Klironomos JN. Soil depth distribution of ecto- and arbuscular mycorrhizal fungi associated with Populus tremuloides within a 3-year-old boreal forest clear-cut. Applied Soil Ecology. 2002;19:209–216. [Google Scholar]
  44. Niemi K, Julkunen-Tiitto R, Haggman H, Sarjala T. Suillus variegatus causes significant changes in the content of individual polyamines and flavonoids in Scots pine seedlings during mycorrhiza formation in vitro. Journal of Experimental Botany. 2007;58:391–401. doi: 10.1093/jxb/erl209. [DOI] [PubMed] [Google Scholar]
  45. Ouziad F, Hildebrandt U, Schmelzer E, Bothe H. Differential gene expressions in arbuscular mycorrhizal-colonized tomato grown under heavy metal stress. Journal of Plant Physiology. 2005;162:634–649. doi: 10.1016/j.jplph.2004.09.014. [DOI] [PubMed] [Google Scholar]
  46. Pang XM, Zhang ZY, Wen XP, Ban Y, Moriguchi T. Polyamines, all-purpose players in response to environmental stresses in plants. Plant Stress. 2007;1:173–188. [Google Scholar]
  47. Peipp H, Maier W, Schmidt J, Wray V, Strack D. Arbuscular mycorrhizal fungus-induced changes in the accumulation of secondary compounds in barley roots. Phytochemistry. 1997;44:581–587. [Google Scholar]
  48. Pulford ID, Riddell-Black D, Stewart C. Heavy metal uptake by willow clones from sewage sludge-treated soil: the potential for phytoremediation. International Journal of Phytoremediation. 2002;4:59–72. [Google Scholar]
  49. Quoreshi AM, Khasa DP. Effectiveness of mycorrhizal inoculation in the nursery on root colonization, growth, and nutrient uptake of aspen and balsam poplar. Biomass and Bioenergy. 2008;32:381–391. [Google Scholar]
  50. Rivera-Becerril F, van Tuinen D, Martin-Laurent F, et al. Molecular changes in Pisum sativum L. roots during arbuscular mycorrhiza buffering of cadmium stress. Mycorrhiza. 2005;16:51–60. doi: 10.1007/s00572-005-0016-7. [DOI] [PubMed] [Google Scholar]
  51. Rodriguez R, Redman R. More than 400 million years of evolution and some plants still can't make it on their own: plant stress tolerance via fungal symbiosis. Journal of Experimental Botany. 2008;59:1109–1114. doi: 10.1093/jxb/erm342. [DOI] [PubMed] [Google Scholar]
  52. Sannazzaro AI, Echeverria M, Alberto EO, Ruiz OA, Menendez AB. Modulation of polyamine balance in Lotus glaber by salinity and arbuscular mycorrhiza. Plant Physiology and Biochemistry. 2007;45:39–46. doi: 10.1016/j.plaphy.2006.12.008. [DOI] [PubMed] [Google Scholar]
  53. Smith SE, Read DJ. Mycorrhizal symbioses. 2nd edn. San Diego: Academic Press; 1997. [Google Scholar]
  54. Takacs D, Radimszky L, Nemeth T. The arbuscular mycorrhizal status of poplar clones selected for phytoremediation of soils contaminated with heavy metals. Zeitschrift fur Naturforschung Series C. 2005;60:357–361. doi: 10.1515/znc-2005-3-420. [DOI] [PubMed] [Google Scholar]
  55. Todeschini V, Franchin C, Castiglione S, et al. Responses to copper of two registered poplar clones inoculated or not with arbuscular mycorrhizal fungi. Caryologia. 2007;60:146–155. [Google Scholar]
  56. Trotta A, Varese GC, Gnavi E, Fusconi A, Sampo S, Berta G. Interactions between the soilborne root pathogen Phytophthora nicotianae var parasitica and the arbuscular mycorrhizal fungus Glomus mosseae in tomato plants. Plant and Soil. 1996;185:199–209. [Google Scholar]
  57. Trouvelot A, Kough JL, Gianinazzi-Pearson V. Mesure du taux de mycorrhization VA d'un système radiculaire. Recherche de méthodes d'estimation ayant une signification fonctionnelle. In: Gianinazzi-Pearson V, Gianinazzi S, editors. Mycorrhizae: physiology and genetics. Paris: INRA Press; 1986. pp. 217–221. [Google Scholar]
  58. Turnau K. Heavy metal content and localization in mycorrhizal Euphorbia cyparissias from zinc wastes in southern Poland. Acta Societatis Botanicorum Poloniae. 1998;67:105–113. [Google Scholar]
  59. Utmazian MND, Wieshammer G, Vega R, Wenzel WW. Hydroponic screening for metal resistance and accumulation of cadmium and zinc in twenty clones of willows and poplars. Environmental Pollution. 2007;148:155–165. doi: 10.1016/j.envpol.2006.10.045. [DOI] [PubMed] [Google Scholar]
  60. Vandecasteele B, Meers E, Vervaeke P, De Vos B, Quataert P, Tack FMG. Growth and trace metal accumulation of two Salix clones on sediment-derived soils with increasing contamination levels. Chemosphere. 2005;58:995–1002. doi: 10.1016/j.chemosphere.2004.09.062. [DOI] [PubMed] [Google Scholar]
  61. Wen XP, Ban Y, Inoue H, Matsuda N, Moriguchi T. Spermidine levels are implicated in heavy metal tolerance in a spermidine synthase overexpressing transgenic European pear by exerting antioxidant activities. Transgenic Research. 2010;19:91–103. doi: 10.1007/s11248-009-9296-6. [DOI] [PubMed] [Google Scholar]

Articles from Annals of Botany are provided here courtesy of Oxford University Press

RESOURCES