Complete Genomic Sequence and Comparative Analysis of the Tumorigenic Poxvirus Yaba Monkey Tumor Virus

Abstract

The Yatapoxvirus genus of poxviruses is comprised of Yaba monkey tumor virus (YMTV), Tanapox virus, and Yaba-like disease virus (YLDV), which all have the ability to infect primates, including humans. Unlike other poxviruses, YMTV induces formation of focalized histiocytomas upon infection. To gain a greater understanding of the Yatapoxvirus genus and the unique tumor formation properties of YMTV, we sequenced the 134,721-bp genome of YMTV. The genome of YMTV encodes at least 140 open reading frames, all of which are also found as orthologs in the closely related YLDV. However, 13 open reading frames found in YLDV are completely absent from YMTV. Common to both YLDV and YMTV are the unusually large noncoding regions between many open reading frames. To determine whether any of these noncoding regions might be functionally significant, we carried out a comparative analysis between the putative noncoding regions of YMTV and similar noncoding regions from other poxviruses. This approach identified three new gene poxvirus families, defined as orthologs of YMTV23.5L, YMTV28.5L, and YMTV120.5L, which are highly conserved in virtually all poxvirus species. Furthermore, the comparative analysis also revealed a 40-bp nucleotide sequence at approximately 14,700 bases from the left terminus that was 100% identical in the comparable intergene site within members of the Yatapoxvirus, Suipoxvirus, and Capripoxvirus genera and 95% conserved in the Leporipoxvirus genus. This conserved sequence was shown to function as a poxvirus late promoter element in transfected and infected cells, but other functions, such as an involvement in viral replication or packaging, cannot be excluded. Finally, we summarize the predicted immunomodulatory protein repertoire in the Yatapoxvirus genus as a whole.

Poxviruses are divided into two major groups, the chordopoxviruses that infect vertebrates and entomopoxviruses of insects. Chordopoxviruses contain a linear double-stranded DNA genome with covalently closed hairpin loops at either end (19). The extreme left and right termini of the poxvirus genome consist of identical, but oppositely oriented, terminal inverted repeats (TIR). Chordopoxvirus genomes can be divided into two broad domains based on the functions of the encoded gene products. The central region of the genome, which ranges in length from 80,000 to 100,000 bases, is enriched for genes that encode essential conserved functions, such as transcription, replication, and virion assembly. The regions flanking this conserved central region express an array of proteins that function to increase survival of the virus in the infected host, including proteins that determine host range, inhibit apoptosis, or mediate responses to modulate the host immune system (22).

The genome sizes of published chordopoxviruses vary from 145,000 bp for Yaba-like disease virus (YLDV) (15) up to 288,000 bp for fowlpox virus (2) and possess between 151 and 260 assigned open reading frames (ORFs). Complete genomic sequences of representative members from seven of the eight Chordopoxvirus genera have now been published, including orthopoxviruses (vaccinia virus strain Copenhagen [11], modified vaccinia virus strain Ankara [6], variola virus strain Bangladesh [16], variola virus strain India [24], variola virus strain Garcia [25], camelpox virus [1], and monkeypox virus [26]), capripoxviruses (lumpy skin disease virus [LSDV] [29],goatpox virus, and sheeppox virus [30]), leporipoxviruses (myxoma virus [8] and Shope fibroma virus [31]), suipoxviruses (swinepox virus [SPV] [3]), molluscipoxvirus (molluscum contagiosum virus [23]), avipoxviruses (fowlpox [2]), and yatapoxviruses (Yaba-like disease virus [YLDV] [15]).

The Yatapoxvirus genus of poxviruses is comprised of three virus isolates: YLDV, Tanapox virus (TPV), and Yaba monkey tumor virus (YMTV) (14). The yatapoxviruses have a narrow host range, infecting only primates, including humans. Several pieces of data suggest that TPV and YLDV may be different strains of the same virus. For example, TPV and YLDV produce a clinically indistinguishable disease, which includes a mild fever and epidermal lesions (10, 17), and the published genomic sequence of YLDV is more than 98.6% identical with the 8,300 bases of TPV sequence entered into the public database (GenBank accession no. AY253325, AF245394, and AF153912) (15). This level of sequence identity is comparable to different strains of vaccinia virus and suggests that YLDV and TPV should be considered the monkey and human versions, respectively, of the same virus.

YMTV was originally characterized to be the agent responsible for subcutaneous tumors in a rhesus monkey colony occurring in 1956 in Yaba, Nigeria (7). YMTV is one of the few poxviruses that induce substantial tumor formation upon infection (5, 12, 20, 27). In rhesus monkeys infected with YMTV, the tumors are thought to be derived from histiocytes that migrate to the site of infection. The histiocytes become infected and begin to rapidly proliferate, become multinucleated, and eventually form a polyclonal tumor (27). However, the tumors generally do not become invasive and spontaneously regress, presumably when either viral cytopathic effect kills the infected cells or cell-mediated antiviral immunity becomes sufficiently effective to clear the infection (12, 27).

The complete genomic sequence of YLDV was recently published, and a number of novel ORFs not found in other chordopoxviruses were identified (15). As well, despite the fact that the noncoding regions between ORFs in most poxviruses are typically only a few nucleotides, there were multiple identified inter-ORF regions of 200 or more nucleotides in YLDV. Typically, the minimum size for a poxvirus ORF is arbitrarily set (e.g., 30 amino acids for SPV, LSDV, molluscum contagiosum virus, and fowlpox virus [2, 3, 23, 29]; 50 amino acids for myxoma virus [8]; and 60 amino acids for YLDV [15]). If bona fide ORFs were indeed located within these assigned YLDV noncoding regions, then one would predict that these ORFs might be highly conserved between YLDV and YMTV. Therefore, in an effort to understand the clinical differences between YLDV and YMTV and to provide a closely related sequence to YLDV for a comparative genomic approach, we sequenced the genome of the YMTV and provide a comparative genomic analysis of the Yatapoxvirus genus.

MATERIALS AND METHODS

Viruses.

YMTV (VR587) was obtained from the American Type Culture Collection (Manassas, Va.) and was propagated on CV1 cells at 35°C in minimum essential medium containing 5% fetal bovine serum. Myxoma virus strain Lausanne was obtained from the American Type Culture Collection and propagated in BGMK cells at 37°C.

Isolation and sequencing of YMTV genomic fragments.

YMTV genomic DNA was isolated from infected CV1 cells and was subjected to restriction enzyme digestion with PstI, BamHI, SalI, XbaI, or EcoRI. The digested DNA was cloned into pUC19 or pBR322 vectors and sequenced by the dideoxy sequencing method (21). The remainder of the YMTV genomic sequence was cloned using overlapping PCR. Briefly, PCR was carried out using Taq polymerase, YMTV genomic DNA, and PCR primers based on the corresponding sequence of YLDV (15). The resulting PCR products were cloned into pGEMT-easy (Promega, Madison, Wis.) and were sequenced by the London Regional Genomics Centre DNA Sequencing Facility using an Applied Biosystems (Foster City, Calif.) ABI Prism 377 DNA sequencer and Big Dye terminators (Applied Biosystems). Some of the YMTV sequence was previously submitted to GenBank (accession no. AY253324, AB025319, AB018404, and AB015885).

Sequence analysis.

The sequence data were assembled using Sequencher 3.0, and ORFs were identified using MacVector 6.5.3 (Oxford Molecular Ltd.).

Cloning a conserved sequence from myxoma virus upstream of an enhanced GFP cassette.

PCR was carried out using Taq polymerase; plasmid DNA pEGFP-N1 (Clontech, Palo Alto, Calif.); the reverse PCR primer 5′ TTACGCCTTAAGATACATTG 3′, which corresponds to the 3′ end of the green fluorescent protein (GFP), and the forward PCR primers (with the start codon of GFP in boldface type) 5′ TCGCCACCATGGTGAGCAAG 3′ (PCR-GFP), 5′ TTTATTTATGTTATTAGCTAGGATTTATGTTTCATTTTTTACTCGCCACCATGGTGAGCAAG 3′ (PCR-R-GFP), and 5′ GTAAAAAATGAAACATAAATCCTAGCTAATAACATAAATAAATCGCCACCATGGTGAGCAAG 3′ (PCR-L-GFP). The resulting PCR products were cloned into pGEMT-easy (Promega) and designated GFP, R-GFP, and L-GFP.

Expression of GFP cassette in BGMK cells.

Twelve-well dishes of BGMK cells approximately 90% confluent growing in minimum essential medium-5% fetal bovine serum were either infected with myxoma virus at a multiplicity of infection of 10 or mock infected. The cells were incubated at 37°C for 2 h, and this was followed by transfection with GFP, R-GFP, or L-GFP plasmid DNA using Lipofectamine Plus (Invitrogen, Burlington, Ontario, Canada) per the manufacturer's protocol. The cells were subsequently incubated at 37°C for 48 h. Cells expressing the GFP construct were detected using a fluorescence microscope.

Nucleotide sequence accession number.

Sequence data from this article have been deposited in GenBank under accession number AY386371.

RESULTS

Genome structure of YMTV.

The genome of YMTV was sequenced through the subcloning of genomic fragments into plasmid vectors, and clones were individually sequenced. In addition, regions of the genome not represented in the cloned fragments were isolated using PCR, and a minimum of three independent PCR products for each primer set were sequenced. After assembling the sequence files, a single continuous sequence of 134,721 bases was generated, making YMTV the smallest poxvirus genome yet sequenced. This deduced sequence lacks the terminal hairpin region, but evidence suggests that all the coding ORFs have been fully sequenced and only the very extreme hairpin termini of the genome were not included. In particular, the putative YMTV concatemer resolution sequence was obtained, which is typically found very close to the molecular hairpin loop at the termini (18). Published reports also confirm that the YMTV genome size is indeed approximately 135,000 bases (4).

The YMTV genome has an A+T content of 70.2% and encodes at least 140 ORFs (Table 1; Fig. 1), of which 139 are single copies and 1 is repeated in each copy of the TIR. In comparison, YLDV has been assigned 151 ORFs (15). YMTV and YLDV is closely related viruses with approximately 75% identity between the viruses at the nucleotide level overall, which is typical for chordopoxvirus members from a single genus. Furthermore, all the ORFs identified in YMTV have a corresponding ortholog in YLDV, but YMTV has lost 13 ORFs that are present in YLDV (Table 2), which accounts for the 10 kb of sequence loss in YMTV. Since YMTV and YLDV are so similar, and to avoid unnecessary confusion, we have adopted the proposed YLDV nomenclature (15) for naming orthologous YMTV ORFs.

TABLE 1.

YMTV ORFs

ORF	Codon		No. of aaf	TOEg	Predicted structure or functionh	YLDVa			SPVb		Myxc		LSDVd		VVe
	Start	Stop				ORF	BLASTP2 score	% Iden- tity	ORF	% Iden- tity	ORF	% Iden- tity	ORF	% Iden- tity	ORF	% Iden- tity
1L	1808	804	334	E	A52R family	1L	489	72					LSDV007	35	C10L	26
2L	2963	1938	341	?	vTNF-α bp, SP	2L	497	71	SPV003	34
4L	3722	3003	239	?	α-Amanitin sensitivity	4L	340	71	SPV007	28			LSDV009	35	N2L	31
5L	4232	3762	156	L	LAP/PHD finger, TM	5L	200	58	SPV009	36	M153R	32	LSDV010	48
6L	4732	4274	152	E	Unknown	6L	265	81	SPV001/150	37	M003.1	28	LSDV001/156	34	B15R	41
7L	5840	4800	346	E?	vCCR8	7L	265	70	SPV005				LSDV011	39
11L	8306	6393	637	?	14 ankyrin domains	11L	1061	79
12L	8574	8308	88	E	eIF2α mimic	12L	111	64	SPV010	36	M156R	32	LSDV014	35	K3L	31
13L	9474	8614	286	L	Monoglyceride lipase	13L	406	68							K6L	48
14L	9917	9504	137	I?	IL-18 bp, SP	14L	156	55	SPV011	30			LSDV015	37
16L	10584	10066	172	L?	Inhibition of apoptosis	16L	207	64	SPV012	29			LSDV017	30	I1L	24
17L	11066	10635	143	L?	dUTPase	17L	215	75	SPV013	52	M012L	48	LSDV018	52	F2L	46
19L	12774	11200	524	L?	Kelch-like protein	19L	820	74	SPV015	35	M014L	32	LSDV019	34	F3L	25
20L	13779	12802	325	L	Ribonucleotide reduc- tase (small subunit)	20L	611	91	SPV016	76	M015L	75	LSDV020	79	F4L	76
21L	14054	13806	82	?	SP, TM	21L	114	64	SPV017	33	M016L	42	LSDV021	31
22L	14325	14098	75	E	Unknown	22L	45	37
23.5L	14742	14530	70	E	Unknown	23.5L	88	86			M018L	45	LSDV023	57	F8L	43
24L	15443	14799	214	L	TM	24L	312	74	SPV021	45	M019L	43	LSDV024	43	F9L	48
25L	16758	15421	445	L	Ser/Thr protein kinase	25L	845	90	SPV022	77	M020L	74	LSDV025	77	F10L	72
26L	18711	16786	642	L	TM	26L	861	65	SPV024	42	M021L	37	LSDV027	40	F12L	31
27L	19845	18736	369	L	EEV envelope protein	27L	657	87	SPV025	70	M022L	69	LSDV028	72	F13L	57
28.5L	20085	19909	58	L	Unknown	28.5L
29L	20563	20117	148	?	Unknown	29L	263	82	SPV027	60	M024L	49	LSDV029	62	F15L	56
30L	21275	20628	215	?	Unknown	30L	320	73	SPV028	38	M025L	30	LSDV030	36	F16L	37
31R	21335	21649	104	L	DNA binding phosphoprotein	31R	169	79	SPV029	62	M026L	68	LSDV031	63	F17R	59
32L	23058	21646	470	?	Poly(A) polymerase	32L	832	88	SPV030	67	M027L	68	LSDV032	68	E1L	64
33L	25120	23072	683	?	Unknown	33L	1006	71	SPV031	44	M028L	40	LSDV033	40	E2L	37
34L	25700	25146	185	L	dsRNA bp	34L	217	57	SPV032	44	M029L	57	LSDV034	42	E3L	38
35L	26311	25745	188	L	RNA polymerase sub- unit RPO30	35L	326	82	SPV033	66	M030L	64	LSDV036	63	E4L	67
36R	26444	27472	342	L?	Unknown	36R	512	71			M031R	31	LSDV035	33	E5R	25
37R	27498	29201	567	L?	Unknown	37R	1006	85	SPV034	65	M032R	61	LSDV037	67	E6R	60
38R	29219	30025	268	L	ER-localized protein, TM	38R	521	93	SPV035	76	M033R	75	LSDV038	78	E8R	70
39L	33042	30022	1006	?	DNA polymerase	39L	1689	81	SPV036	64	M034L	66	LSDV039	66	E9L	63
40R	33075	33359	94	L	Redox protein	40R	181	88	SPV037	67	M035R	69	LSDV040	71	E10R	67
41L	33770	33393	125	L	TM	41L	200	74					LSDV041	53	E11L	48
43L	34881	33955	308	L	DNA binding protein	43L	472	77	SPV039	60	M038L	64	LSDV043	66	I1L	60
44L	35103	34882	73	L	TM	44L	116	77	SPV040	48	M039L	52	LSDV044	51	I2L	45
45L	35898	35104	264	E?	DNA binding phosphoprotein	45L	437	84	SPV041	60	M040L	61	LSDV045	58	I3L	56
46L	36227	35988	79	L	IMV protein, SP, TM	46L	138	86	SPV043	55	M041L	48	LSDV046	69	15L	45
47L	37402	36245	385	L	TM	47L	625	79	SPV044	51	M042L	52	LSDV047	53	16L	54
48L	38688	37399	429	L	Virion core protein	48L	773	87	SPV045	69	M043L	69	LSDV048	71	17L	64
49R	38694	40730	678	?	NPH-II, RNA helicase	49R	1133	80	SPV046	58	M044R	54	LSDV049	59	18R	54
50L	42496	40727	590	L	Metalloproteinase	50L	963	78	SPV047	59	M045L	55	LSDV050	57	G1L	51
51L	42828	42493	111	L	TM	51L	167	71	SPV049	54	M046L	48	LSDV052	47	G3L	41
52R	42822	43490	222	?	Transcriptional elongation factor	52R	349	78	SPV048	45	M047R	44	LSDV051	46	G2R	47
53L	43834	43457	125	L	Glutaredoxin 2	53L	255	99	SPV050	64	M048L	69	LSDV053	75	G4L	45
54R	43837	45156	439	?	Unknown	54R	672	76	SPV051	49	M049R	44	LSDV054	49	G5R	43
55R	45159	45350	63	?	RNA polymerase subunit, RPO7	55R	125	96	SPV052	84	M050R	85	LSDV055	85	G5.5R	79
56R	45350	45895	181	L	TM	56R	291	79	SPV053	53	M051R	57	LSDV056	54	G6R	47
57L	46964	45864	366	L	Virion core protein, TM	57L	580	78	SPV054	53	M052L	52	LSDV057	55	G7L	48
58R	46994	47776	260	L	Late transcription factor, VLTF-1, TM	58R	511	97	SPV055	88	M053R	83	LSDV058	86	G8R	83
59R	47808	48806	332	L	Myristylated protein	59R	528	78	SPV056	52	M054R	53	LSDV059	57	G9R	45
60R	48807	49550	247	L	Myristylated IMV envelope protein	60R	452	91	SPV057	82	M055R	75	LSDV060	80	L1R	69
61R	49565	49840	91	?	TM	61R	99	57	SPV058	32			LSDV061	34
62L	50763	49816	315	L	Unknown	62L	518	80	SPV059	59	M057L	54	LSDV062	60	L3L	51
63R	50788	51546	252	L	DNA binding protein	63R	455	92	SPV060	76	M058R	77	LSDV063	79	L4R	60
64R	51566	51964	132	L	TM	64R	181	68	SPV061	46	M059R	44	LSDV064	50	L5R	44
65R	51906	52385	159	L	Unknown	65R	275	83	SPV062	58	M060R	58	LSDV065	65	J1R	47
66R	52382	52927	181	E?	Thymidine kinase	66R	287	78	SPV063	62	M061R	61	LSDV066	58	J2R	61
67R	52968	53471	167	L	Host range protein	67R	283	81	SPV064	45	M062R	38	LSDV067	44	C7L	37
68R	53549	54550	333	?	Poly(A) polymerase	68R	583	85	SPV065	69	M065R	70	LSDV068	72	J3R	67
69R	54465	55022	185	?	RNA polymerase subunit, RPO22	69R	317	91	SPV066	75	M066R	72	LSDV069	78	J4R	72
70L	55412	54999	137	L	Unknown	70L	251	82	SPV067	62	M067L	62	LSDV070	64	J5L	60
71R	55509	59366	1285	L	RNA polymerase subunit, RPO147	71R	2382	91	SPV068	81	M068R	82	LSDV071	82	J6R	78
72L	59872	59363	169	L	Protein tyrosine phosphatase	72L	317	88	SPV069	71	M069L	74	LSDV072	77	H1L	63
73R	59887	60456	189	L?	TM	73R	340	84	SPV070	67	M070R	65	LSDV073	67	H2R	61
74L	61420	60458	320	L	IMV envelope protein, TM	74L	498	79	SPV071	55	M071L	50	LSDV074	53	H3L	36
75L	63814	61421	797	L	RNA polymerase-associated protein, RAP94	75L	1388	86	SPV072	71	M072L	70	LSDV075	72	H4L	64
76R	64007	64549	180	L?	Late transcription factor VLTF-4	76R	205	61	SPV073	41	M073R	40	LSDV076	34	H5R	34
77R	64560	65507	315	?	DNA topoisomerase	77R	536	83	SPV074	62	M074R	64	LSDV077	68	H6R	63
78R	65515	65967	150	L	Unknown	78R	246	80	SPV075	54	M075R	53	LSDV078	50	H7R	36
79R	65982	68504	840	L	mRNA capping enzyme (large subunit)	79R	1462	85	SPV076	65	M076R	65	LSDV079	68	D1R	63
80L	68927	68466	153	L	Virion protein	80L	224	69	SPV077	39	M077L	38	LSDV080	33	D2L	42
81R	68926	69663	245	?	Virion protein	81R	332	64	SPV078	31	M078R	28	LSDV081	38	D3R	32
82R	69660	70319	219	?	Uracil DNA glycosylase	82R	394	82	SPV079	69	M079R	71	LSDV082	70	D4R	67
83R	70393	72753	786	L	NTPase, TM	83R	1465	91	SPV080	74	M080R	75	LSDV083	74	D5R	66
84R	72750	74657	635	L	Early transcription factor VETFs, TM	84R	1227	95	SPV081	87	M081R	87	LSDV084	88	D6R	80
85R	74690	75172	160	L	RNA polymerase subunit RPO18	85R	309	94	SPV082	71	M082R	77	LSDV085	78	D7R	73
86R	75194	75859	221	?	mutT motif	86R	367	87	SPV083	62	M084R	56	LSDV086	64	D9R	55
87R	75856	76572	239	L	mutT motif	87R	431	89	SPV084	60	M085R	61	LSDV087	62	D10	50
88L	78481	76586	631	L	NPH-1, transcription termination factor	88L	1159	90	SPV085	69	M086L	67	LSDV088	71	D11L	69
89L	79373	78510	287	L	mRNA capping enzyme, VITF	89L	528	91	SPV086	78	M087L	73	LSDV089	74	D12L	70
90L	81059	79398	553	L	Rifampin resistance protein	90L	1055	93	SPV087	79	M088L	77	LSDV090	80	D13L	73
91L	81531	81076	151	L	Late transcription factor, VLTF-2	91L	266	86	SPV088	62	M089L	68	LSDV091	64	A1L	62
92L	82229	81555	224	?	Late transcription factor, VLTF-3	92L	442	95	SPV089	83	M090L	86	LSDV092	85	A2L	84
93L	82453	82226	75	L	Unknown	93L	139	84	SPV090	55	M091L	69	LSDV093	63	A2.5L	53
94L	84440	82467	657	L	Virion core protein	94L	1195	90	SPV091	73	M092L	71	LSDV094	70	A3L	63
95L	84946	84500	148	L	Virion core protein	95L	201	70	SPV092	37	M093L	33	LSDV095	37
96R	84986	85483	165	L	RNA polymerase subunit RPO19	96R	260	80	SPV093	54	M094R	52	LSDV096	56	A5R	58
97L	86595	85480	371	L	Unknown	97L	673	91	SPV094	70	M095L	70	LSDV097	75	A6L	56
98L	88760	86619	713	L?	Early transcription factor, VETF1	98L	1273	89	SPV095	74	M096L	73	LSDV098	74	A7L	68
99R	88817	89692	291	E?	Intermediate transcription factor VITF-3	99R	528	90	SPV096	64	M097R	68	LSDV099	64	A8R	61
100L	89932	89693	79	L	IMV membrane protein, SP, TM	100L	146	91	SPV097	82	M098L	72	LSDV100	74	A9L	71
101L	92641	89933	902	L	Virion core protein P4a	101L	1575	87	SPV098	64	M099L	57	LSDV101	62	A10L	50
102R	92656	93600	314	L	Unknown	102R	521	85	SPV099	72	M100R	69	LSDV102	71	A11R	52
103L	94104	93601	167	L	Virion core protein	103L	249	77	SPV100	55	M101L	61	LSDV103	55	A12L	46
104L	94357	94151	68	L	IMV membrane protein, TM	104L	122	83	SPV101	51	M102L	47	LSDV104	58	A13L	35
105L	94685	94404	93	L	IMV membrane protein SP, TM	105L	160	82	SPV102	72	M103L	64	LSDV105	65	A14L	45
106L	94864	94676	62	L	Virulence factor, SP	106L	46	86	SPV103	76	M104L	81	LSDV106	67
107L	95138	94854	94	L	Unknown	107L	167	78	SPV104	51	M105L	52	LSDV107	55	A15L	49
108L	96267	95122	381	L	Myristylated membrane protein, TM	108L	629	78	SPV105	58	M106L	54	LSDV108	60	A16L	50
109L	96847	96278	189	L	Phosphorylated IMV membrane protein, TM	109L	299	80	SPV106	59	M107L	51	LSDV109	50	A17L	37
110R	96862	98298	478	?	DNA helicase, TM	110R	839	85	SPV107	61	M108R	62	LSDV110	57	A18R	55
111L	98503	98279	74	L	Unknown	111L	102	68	SPV108	69	M109L	81	LSDV111	75	A19L	58
112L	98840	98508	110	L	TM	112L	167	71	SPV110	49	M110L	44	LSDV113	47	A21L	44
113R	98839	100119	426	?	DNA polymerase processivity factor	113R	668	75	SPV109	48	M111R	46	LSDV112	51	A20R	46
114R	100126	100602	158	L	DNA processing	114R	259	77	SPV111	66	M112R	60	LSDV114	65	A22R	63
115R	100625	101773	382	L	Intermediate transcription factor VITF-3	115R	614	80	SPV112	59	M113R	58	LSDV115	61	A23R	59
116R	101775	105269	1164	L	RNA polymerase subunit RPO132	116R	2179	92	SPV113	84	M114R	83	LSDV116	85	A24R	79
117L	105724	105272	150	L	Fusion protein SP, TM	117L	125	48	SPV114	39	M115L	25	LSDV117	31	A27L	56
118L	106150	105725	141	L		118L	215	70	SPV115	57	M116L	52	LSDV118	57	A28L	48
119L	107065	106163	300	?	RNA polymerase subunit RPO35	119L	528	85	SPV116	64	M117L	62	LSDV119	64	A29L	56
120L	107261	107034	75	L	Virion protein	120L	99	72	SPV117	45	M118L	46	LSDV120	45	A30L	51
120.5L	107421	107287	44	?	Unknown	120.5L			SPV117.5		M119L		LSDV118.5		A30.5L
121L	108224	107460	254	L	DNA packaging	121L	466	90	SPV118	79	M120L	81	LSDV121	84	A32L	60
122R	108278	108826	182	L?	EEV glycoprotein, TM	122R	208	58	SPV119	30	M121R	36	LSDV122	32	A33R	27
123R	108849	109361	170	L	EEV protein	123R	271	75	SPV120	57	M122R	51	LSDV123	48	A34R	45
124R	109364	109942	192	?	Unknown	124R	266	70	SPV121	40	M123R	43	LSDV124	36	A35R	38
125R	109969	110826	285	I?	TM	125R	436	75	SPV122	36	M124R	39	LSDV125	36
126R	110872	111366	164	?	EEV glycoprotein, TM	126R	69	29
127R	111457	112257	266	E/L?	TM	127R	379	70	SPV124	37	M126R	33	LSDV127	37	A37R	26
128L	113060	112260	266	L?	CD47	128L	263	52	SPV125	28	M128L	26	LSDV128	26
129R	113065	113481	138	L?		129R	202	75			M129R	40			E7R	26
131R	113605	113856	83	L		131R	49	38
132R	113894	114151	85	E	Unknown	132R	92	59	SPV127	35			LSDV130	40
135R	114315	120002	1895	L?	8 TM, SP	135R	2805	72	SPV131	56	M134R	52	LSDV134	43
137R	120468	120932	154	E	A52R family	137R	195	62	SPV133	32	M136R	31	LSDV136	34	C6L	28
138R	120962	121981	339	L	Unknown	138R	453	64	SPV134	36	M137R	31	LSDV137	39	A51R	34
139R	122047	122631	194	?	A52R family	139R	253	68	SPV135	43	M139R	43	(LSDV136)	28	A52R	34
141R	122895	123254	119	E?	Ox-2 mimic	141R	172	72			M141R	38	LSDV138	51
142R	123296	124225	309	?	Ser/Thr protein kinase	142R	560	84	SPV137	57	M142R	57	LSDV139	59	B1R	47
143R	124262	124972	236	L	Host range RING finger protein	143R	403	80	SPV138	43	M143R	47	LSDV140	40
144R	125037	125843	268	L	CD46 mimic	144R	283	65	SPV139	48	M144R	37	LSDV141	43	C3L	37
145R	126011	127000	329	?	vCCR8	145R	375	60	SPV146	30			LSDV011	31
146R	127424	128494	356	?	Ankyrin repeat	146R	534	73	SPV142	35	M149R	33	LSDV147	37	B4R	24
147R	128524	130017	497	?	Ankyrin repeat	147R	727	72	SPV143	28	M148R	26	LSDV148	30	B4R	22
148R	130014	131465	483	?	Ankyrin repeat	148R	588	62	SPV144	25	M149R	24	LSDV152	24	B4R	16
149R	131527	132456	310	E	Serpin/SPI-2 ortholog	149R	490	75	SPV145	37	M151R	40	LSDV149	40	C12L	29
150R	132492	132812	106	L	Unknown	150R	152	74	SPV147	33	M004.1	29	LSDV153	26
151R	132914	133918	334	E	A52R family	151R	491	72					LSDV007	34	C10L	26

^aOrtholog from YLDV (accession no. AJ293568).

^bOrtholog from SPV (accession no. AF410153).

^cOrtholog from myxoma virus (accession no. AF170726).

^dOrtholog from LSDV (accession no. AF325528).

^eOrtholog from vaccinia virus strain Copenhagen (accession no. M35027).

^faa, amino acids.

^gPredicted promoters (early [E], intermediate [I], and late [L]) were determined (15). ?, uncertain or unknown; TOE, time of expression.

^hPredicted functions were determined by identifying YMTV orthologs from YLDV and SPV. Abbreviations: vTNF-α, viral tumor necrosis factor alpha; SP, signal peptide; TM, transmembrane domain; eIF2α, eukaryotic initiation factor 2α; IL-18, interleukin-18; EEV, extracellular enveloped virions; bp, binding protein. BLASTP2 scores were determined by performing BLAST searches at http://www.ncbi.nlm.nih.gov/BLAST/.

FIG. 1.

YMTV genomic map. The assigned ORFs of YMTV are displayed, with an arrow indicating the direction of transcription. Each ORF is colored to indicate a general functional category. In addition, the black arrows above the ORFs at either end of the genome indicate the TIR.

TABLE 2.

Immune evasion ORFs and ORFs absent from YMTV but present in YLDV

YMTV ORF	YLDV ORF	Putative function(s)a
2L	2L	vTNF bp
	3L	A52R ortholog, TLR signaling inhibitor
7L	7L	vCCR8
	8L	4 ankyrin domains
	9L	Ortholog of vv M2L
	10L	Secreted serpin, myxoma virus SERP-1 ortholog
12L	12L	eIF2α mimic
14L	14L	vIL-18 bp
	15L	EGF domain
16L	16L	Inhibition of apoptosis, ortholog of myxoma virus M11L
	18L	Ortholog of myxoma virus M013L
	23L	Unknown
	28R	Unknown
34L	34L	dsRNA bp
	42L	Ortholog of vv O1L
128L	128L	CD47 mimic
	130L	Unknown
133L	133L	3β-HSD
	134R	vIL-10
	136R	IFN-α/β binding protein
	140R	Ortholog of vv A54R, kelch-like protein
141R	141R	Ox-2 mimic
144R	144R	CD46 mimic
145R	145R	CCR8 mimic
149R	149R	Intracellular serpin, SPI-2 ortholog

^aAbbreviations: vTNF, viral tumor necrosis factor; vCCR8, viral CCR8 ortholog; vv, vaccinia virus; eIF2α, eukaryotic initiation factor 2α; vIL-18, viral interleukin-18; EGF, epidermal growth factor; dsRNA, double-stranded RNA; vIL-10, viral interleukin-10; IFN-α/β, alpha/beta interferon; bp, binding protein.

The TIR of YMTV are 1,962 bases long and contain a single ORF designated 1L/151R. The noncoding region in the TIR of YMTV and YLDV is relatively large, with 804 and 755 bases (15), respectively, between the terminal ORF and the concatemer resolution sequence. In comparison, closely related genera, such as members of the Capripoxvirus, Leporipoxvirus, and Suipoxvirus genera, have noncoding regions in their termini ranging from 159 to 366 bases (3, 8, 29). Analysis of the noncoding region from YMTV and YLDV revealed a nucleotide sequence in each that exhibited striking similarity to that of the SPV002 gene (Fig. 2). However, both the YMTV and YLDV sequences lack an initiating methionine (ATG) codon, suggesting that either the large noncoding sequence in the TIR of yatapox viruses has evolved into a pseudogene of SPV002, or else the yatapox virus orthologs utilize a nonstandard initiator codon.

FIG. 2.

YMTV and YLDV each contain an apparent pseudogene within the noncoding region of the termini. An alignment of the assigned SPV002 ORF (3) with a portion of the noncoding region of the YMTV and YLDV termini is shown.

Identification of putative orthologs of YMTV23.5L in multiple poxviruses.

An unusual number of large gaps occur between ORFs in YMTV (Table 1) and YLDV (15). Our assumption is that if these presumptive noncoding regions between yatapox virus ORFs have important functions, then they would likely be conserved between YLDV and YMTV. The largest inter-ORF gap in YLDV is 376 bases and maps between 23L and 24L (15). The corresponding region in YMTV is a 474-bp gap between 22L and 24L, with YMTV lacking any obvious ortholog of 23L. As Table 1 illustrates, a small ORF between 22L and 24L of YMTV was identified and designated 23.5L (Table 1; Fig. 3a). Orthologs of 23.5L were previously reported in myxoma virus, LSDV, and vaccinia virus (8, 13, 29).

FIG. 3.

Comparative analysis of the noncoding region between YMTV22L and YMTV24L. (a) Schematic arrangement of ORFs in the region of the 23.5L orthologs in YMTV and YLDV. A 42-base conserved sequence (CS) is shown as a black box. (b) Alignment of orthologs of 23.5L in YMTV, YLDV, LSDV (LSDV023), myxoma virus (M018L), vaccinia virus (vv F8L), fowlpox (FPV113), and molluscum contagiosum virus (MC014.1L). The SPV (SPV20.5) sequence is also shown, although it lacks a start codon in the published sequence (3).

Since YMTV23.5L was present in a number of divergent poxvirus species, we wanted to examine whether YLDV and SPV might carry a 23.5L version in their genomes. We examined the large noncoding region between YLDV23L and YLDV24L and identified a 153-bp orthologous ORF, which we have designated 23.5L in YLDV (Fig. 3a). This YLDV ORF was classified as a predicted ORF in the annotated sequence of YLDV (accession no. AJ293568) but was not classified as an authentic ORF in the published sequence (15). Interestingly, an ortholog of YMTV23.5L was also found in SPV between positions 13229 and 13445 on the genomic sequence map (3) that had significant similarity to other versions of 23.5L (Fig. 3b). However, this potential ORF in SPV lacks a canonical start codon (ATG) (Fig. 3b), suggesting that the SPV version is either a pseudogene or a sequencing error that resulted in the insertion of an extra nucleotide between a potential upstream start ATG codon in an alternative reading frame six codons upstream of the assigned codon for the first lysine residue.

Unusual conserved promoter-like sequence found in yatapox, suipox, capripox, and leporipox viruses.

The identification of the 212-bp gene YMTV23.5L greatly reduced the amount of assigned noncoding sequence in the region between 22L and 24L. Nevertheless, when we continued our analysis of the noncoding sequence in this region between the ORFs 23.5L and 24L in YMTV and YLDV, we noticed a striking 42-bp sequence that was 100% identical between YMTV and YLDV (Fig. 4a).

FIG. 4.

Analysis of the conserved promoter-like sequence between YMTV23.5L and YMTV24L. (a) Alignment of a conserved sequence found between orthologs of YMTV23.5L and YMTV24L. The sequence within the red boxes labeled “A” and “B” represents the 9-bp repeat. The numbers above the grey box indicate the nucleotide positions. (b) Schematic of the orientation of the promoterless GFP with respect to the orientation of the cloned myxoma virus conserved sequence. R-GFP contains the conserved sequence from bases 2 to 41. L-GFP contains the reverse complement of the conserved sequence. The red boxes show the location of the two repeats in panel a. (c) Cells were either mock infected or infected with myxoma virus and subsequently transfected with either a promoterless GFP, R-GFP, or L-GFP construct. Forty-eight hours postinfection, the cells were visualized using a fluorescence microscope.

To determine whether this sequence was conserved in other poxviruses, we examined the region between the orthologs of 23.5L and 24L in SPV (SPV020.5 and SPV021), LSDV (LSDV023 and LSDV024), myxoma virus (M018L and M019L), and vaccinia virus (F8L and F9L). Figure 4a demonstrates that this identical nucleotide sequence is found in SPV, LSDV, goatpox virus, and sheeppox virus and was 95% conserved in myxoma virus but is not present in vaccinia virus or other orthopoxviruses. The unusually high degree of sequence conservation (i.e., 100% identity between positions 2 through 41 [Fig. 4a] for YMTV, YLDV, SPV, and LSDV) suggests that the sequence may have an important and conserved function.

Analysis of the sequence identified two 9-bp repeats separated by 10 bases (Fig. 4a). Since one turn of the DNA double helix is 10.4 bp, this suggests that the two repeats are registered on the same face of the DNA molecule. One possible function for this type of sequence arrangement is the binding of transcription factors to the DNA sequence, and indeed the sequence does resemble a tandem repeat of a canonical poxvirus late promoter (9). To test whether the conserved sequence might function as a viral promoter element, we inserted the conserved 42-bp sequence (derived from myxoma virus) in either the forward (R-GFP) or the reverse complement (L-GFP) orientations in front of a promoterless GFP construct. Cells were either mock infected or infected with myxoma virus and then transfected with promoterless GFP, R-GFP, or L-GFP constructs. The L-GFP but not the R-GFP sequence was able to drive some detectable GFP expression in the absence of virus infection, but a myxoma virus coinfection greatly increased the level of expression of the L-GFP construct (Fig. 4c). From these data we conclude that the conserved sequence could act as a late promoter element for the gene 23.5L; however, other potential functions such as an involvement in viral replication or packaging cannot be excluded. The reason for the unusual conservation of this promoter sequence across four genera of poxviruses remains to be determined.

Identification of two new conserved poxvirus gene families.

The central region of the poxvirus genome is inevitably enriched for genes that are highly conserved among all poxviruses. In YMTV, this conserved region maps between YMTV24L and YMTV124R. However, inspection of the genomic sequences from a number of poxviruses revealed that the region between YMTV ORFs 27L and 29L and between ORFs 120L and 121L were unexpectedly divergent (Fig. 5a). Analysis of the region between YMTV27L and YMTV29L identified an ORF, designated 28.5L, which encodes a 58-amino-acid protein (Table 1). Initially we examined the region between 27L and 29L in YLDV, where the previously assigned 28R gene is present. Analysis of the YLDV sequence revealed a clear ortholog of 28.5L (Fig. 6a) which overlaps extensively with 28R. Based on the fact that there are no other reported poxvirus versions of YLDV 28R in the database and there is typically only minor overlap of poxvirus ORFs with each other, we postulate that 28.5L represents the true yatapox virus ORF that maps between 27L and 29L for both YMTV and YLDV and that the slightly longer 28R encoded in the opposite polarity originally annotated for YLDV might not be expressed.

FIG. 5.

Alignment of two conserved ORF clusters in a variety of poxvirus genera. (a) Alignment of predicted ORFs from representative members from seven of the eight poxvirus genera. Two regions of the genome are shown, the orthologous region between YMTV027L and YMTV029L and the region between YMTV120L and YMTV121L. Orthologous ORFs share the same color. (b) Analysis of the region between YMTV027L/029L and YMTV120L/121L revealed two new conserved gene families. The proposed arrangements of these ORFs are shown, highlighting the arrangement of the two new gene families YMTV028.5L and YMTV120.5L.

FIG. 6.

Alignments of the predicted YMTV28.5L and YMTV120.5L protein families. (a) Arrangement of YMTV 28.5L orthologs in YMTV, YLDV, and myxoma virus. (b) Alignment of orthologs of YMTV28.5L, including YLDV28.5L, LSDV (LSDV28.5), myxoma virus (M023.5L), vaccinia virus (vvF14L), SPV (SPV26.5), and molluscum contagiosum virus (MC022.1L). (c) Alignment of orthologs of YMTV120.5L, including YLDV120.5L, LSDV (LSDV120.5), myxoma virus (M119L), vaccinia virus (vvA30.5L), swinepox virus (SPV117.5), fowlpox virus (FPV194.5L), and molluscum contagiosum virus (MC137L).

Since 28.5L appeared to be present in both sequenced members of the Yatapoxvirus genus, we examined members of other poxvirus genera to determine if orthologs of this gene could be identified. We examined the noncoding sequence between the orthologs of 27L and 29L in myxoma virus, SPV, LSDV, vaccinia virus, molluscum contagiosum virus, and fowlpox virus to determine if a previously unreported version of 28.5L existed in these genomes. Surprisingly, we found closely related orthologs of 28.5L in all poxvirus species examined, with the exception of fowlpox virus (Fig. 5b and 6b). Interestingly, the deduced ortholog of 23.5L in myxoma virus overlaps extensively with M024R (which bears no similarity with YLDV 28R [Fig. 6a]). This conservation of 23.5L in so many poxvirus genera and the lack of any other orthologs for M024R has led us to conclude that M23.5L, rather than the annotated M024R (8), may be the correct ORF that maps between M023L and M025L.

We next examined the 199-bp noncoding region between YMTV ORFs 120L and 121L. A single 44-amino-acid ORF designated YMTV120.5L was identified which lacked sequence similarity to any gene in the published database. Therefore, as in the case of the gap between 27L and 29L of YMTV, we examined the sequence gap between YMTV120L and YMTV121L (Fig. 5a) and looked for other poxvirus ORFs in this conserved region. This approach yielded clear orthologs of YMTV120.5L in all poxvirus species examined (Fig. 5b and 6c). Interestingly, versions of YMTV120.5L were previously identified in myxoma virus and molluscum contagiosum virus, although originally no relationship was reported between them, presumably because the small gene size made determination of significant identity difficult. However, the position of the conserved ORF in the genomes, the sequence similarities, and the similar gene sizes all indicate that these ORFs are part of an ancestrally evolved gene cluster that is conserved across multiple poxvirus genera.

DISCUSSION

In this work we report the complete sequence of the YMTV genome and have identified three ORFs previously unidentified in most poxviruses. The YMTV genome size of 134,721 bases represents the smallest poxvirus genome yet sequenced. In contrast, the closely related YLDV genome is approximately 144,575 bases long (15). The difference in genome sizes between YMTV and YLDV is due to the complete deletion of 13 ORFs found in YLDV but absent from YMTV. The bulk of the YMTV deleted ORFs are found at the left end of the genome and represent determinants of immune evasion, host range, or genes of unknown function (Table 2). Clinically, YMTV and YLDV produce distinct diseases, with YMTV producing histiocyte-filled tumors upon infection, whereas YLDV infection resembles a mild form of smallpox (5, 20, 27). It is possible that the absence of various YLDV gene products might, in some way, contribute to the tumorigenic phenotype produced upon YMTV infection, but the contribution of these 13 deleted genes to disease phenotype awaits further study.

The data presented here highlight the utility of using a comparative genomic approach when analyzing viral genomes for predicted genes. One of the difficulties in whether to assign a nucleotide sequence as an annotated ORF, particularly for small ORFs of less than 150 nucleotides, is that there is no way to confirm that a predicted ORF is actually expressed until the translated protein or mRNA is detected experimentally. However, we reasoned that if a putative ORF actually encodes a protein, it would be conserved in at least some other poxvirus genus members. Therefore, we examined the tentatively assigned noncoding regions between ORFs in poxvirus genomic sequences to identify yatapoxvirus ORFs with demonstrable similarity in terms of size, sequence, and presence of contiguous orthologs. This approach identified three new yatapoxvirus gene families (23.5L, 28.5L, and 120.5L) that are clearly conserved throughout many genera of poxviruses (Table 3). These three gene families all appear to encode unique proteins with no significant similarity with any other viral or cellular proteins in the sequence database, but which are clearly conserved in most of the known poxvirus genera. With the renewed interest in variola virus, the causative agent of smallpox, it is particularly relevant to identify new families of conserved viral genes that may have important conserved roles in poxvirus replication or pathogenesis.

TABLE 3.

Members of three new poxvirus gene families

Virus	YMTV23.5 family			YMTV28.5 family			YMTV120.5 family
	Gene	Start	Stop	Gene	Start	Stop	Gene	Start	Stop
YMTV	23.5L	14742	14530	28.5L	20085	19909	120.5L	107287	107421
YLDV	23.5L	17960	17808	28.5L	23539	23366	120.5L	113015	112881
SPV	20.5	13430	13229	26.5	20113	19949	117.5	110742	110617
LSDV	023	15949	15734	28.5	22161	22012	120.5	112519	112394
Goatpox virus strain G20-LKV	023	15430	15211	28.5	21620	21470	120.5	111927	111807
Sheeppox virus	023	15557	15342	28.5	21685	21536	120.5	112134	112009
Myxoma virus	018L	18513	18316	23.5L	23834	23703	119L	114993	114844
Shope fibroma virus	018L	17726	17526	23.5L	23037	22906	119L	114122	114003
Vaccinia virus
Ankara	037L	30731	30534	044L	37105	36884	141.5L	133014	132889
Tian Tan	TF8L	35166	35318	TF14L	41537	41758	TA30.5L	141666	141540
Copenhagen	F8L	38878	38684	F14L	45318	45100	A30.5L	141046	140918
WR	VACWR047	35577	35774	VACWR053	41967	42188	VACWR153.5	142061	141933
Variola virus
Garcia	E8L	27400	27579	E14L	33818	34039	A34.5L	133824	133696
Bangladesh 1975	C12L	27031	27228	C18L	33457	33678	A33.5L	133432	133313
India 1967	E8L	27597	27400	E14L	34039	33818	A33.5L	132818	132690
Ectromelia virus	EVM031	44331	44528	EVM037	50749	50964	132.5	150491	150363
Camelpox virus	CMLV043	38437	38634	CMLV049	44853	45074	CMLV170.5	144313	144185
Monkeypox virus	C14L	36022	35828	C20L	42461	42240	A31.5L	141603	141484
Cowpox virus	CPXV055	52234	52431	CPXV062	58648	58869	CPVX165.5	159066	158938
Fowlpox virus	113	134861	135058				194.5L	227787	227667
Molluscum contagiosum virus	014.1L	18646	18897	MC22.1L	28628	28807	137L	158648	158812

An unexpected finding from these observations was that several small ORFs that turned out to be members of conserved poxvirus gene families were originally characterized as unique. For example, fowlpox virus gene FPV113 (2) and molluscum contagiosum virus gene MC014.1L (23) were identified as unique genes, but our comparative analysis demonstrated that they are instead part of a larger poxvirus gene family that includes the vaccinia virus F8L gene. The reason that FPV113 and MC014.1L were not identified as being related to vaccinia virus F8L was likely that it is difficult to reach a level of statistical significance with computer database searches when the raw similarity score is reduced because of their small sizes.

Comparing genomic sequences from different poxviruses in this fashion can provide insight into the evolutionary history of these viruses. For example, comparing the presumptive noncoding regions of both YLDV and YMTV with the same region of SPV revealed a potential pseudogene in YLDV and YMTV that had significant sequence similarity with the SPV002 gene. The presence of the same pseudogene in both YMTV and YLDV but of a functional copy of the gene in SPV implies that the pseudogene arose after the split of the suipox viruses from the yatapox viruses. In this way, we can develop an evolutionary timeline for some of the major events that differentiated members of the diverse poxvirus genera.

In addition to the identification of potential ORFs, the comparative genomic approach resulted in the unexpected identification of a 40-nucleotide stretch of YMTV sequence that was 100% conserved across members of the Yatapoxvirus, Suipoxvirus, and Capripoxvirus genera. This domain represents the most highly conserved sequence yet described among these poxviruses. Even the highly conserved concatemer resolution sequence, which is involved in the essential elements of poxvirus replication at the termini, is only 81% conserved between these species. This conserved sequence maps in the noncoding region between YMTV ORFs 23.5L and 24L. Although we demonstrated that this sequence can function as a late promoter element (Fig. 4), it is not yet clear if that is the actual function of this sequence during a viral infection. For example, the poxvirus concatemer resolution sequence can function as a poxvirus late promoter element (TAAAT) sequence (28); however, its primary role appears to be in resolving concatemers during viral replication (19). One way to test the potential function of this conserved promoter-like sequence would be to generate virus deletion mutants in any one of the virus members that contain a copy of the sequence.

The data presented here have illustrated some of the potential applications of taking a comparative approach to analyze poxvirus genomics. Through the comparison of poxvirus genomes across genera we identified three new gene families that had previously been overlooked because of their small size. In addition, conserved sequences that do not encode an ORF but that potentially play an important role in poxvirus replication were also identified. The comparative genomic analysis that we undertook was originally made possible due to the sequencing of the YMTV genome and the ability to compare its sequence to that of another relatively close species, YLDV (15). However, in theory, the comparative approach that we took could be applied to any viral family and may be particularly valuable when trying to predict whether small potential ORFs truly encode a protein.