Skip to main content
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2010 Sep;161(3):453–458. doi: 10.1111/j.1365-2249.2010.04194.x

Effect of oestrogen on T cell apoptosis in patients with systemic lupus erythematosus

W-U Kim *,†, S-Y Min †, S-H Hwang †, S-A Yoo †, K-J Kim *,†, C-S Cho *,†
PMCID: PMC2962962  PMID: 20529085

Abstract

Defective control of T cell apoptosis is considered to be one of the pathogenetic mechanisms in systemic lupus erythematosus (SLE). Oestrogen has been known to predispose women to SLE and also to exacerbate activity of SLE; however, the role of oestrogen in the apoptosis of SLE T cells has not yet been documented. In this study, we investigated the direct effect of oestrogen on the activation-induced cell death of T cells in SLE patients. The results demonstrated that oestradiol decreased the apoptosis of SLE T cells stimulated with phorbol 12-myristate 13-acetate (PMA) plus ionomycin in a dose-dependent manner. In addition, oestradiol down-regulated the expression of Fas ligand (FasL) in activated SLE T cells at the both protein and mRNA levels. In contrast, testosterone increased FasL expression dose-dependently in SLE T cells stimulated with PMA plus ionomycin. The inhibitory effect of oestradiol on FasL expression was mediated through binding to its receptor, as co-treatment of tamoxifen, an oestrogen receptor inhibitor, completely nullified the oestradiol-induced decrease in FasL mRNA expression. Moreover, pre-treatment of FasL-transfected L5178Y cells with either oestradiol or anti-FasL antibody inhibited significantly the apoptosis of Fas-sensitive Hela cells when two types of cells were co-cultured. These data suggest that oestrogen inhibits activation-induced apoptosis of SLE T cells by down-regulating the expression of FasL. Oestrogen inhibition of T cell apoptosis may allow for the persistence of autoreactive T cells, thereby exhibiting the detrimental action of oestrogen on SLE activity.

Keywords: apoptosis, estrogen, lupus, T cells, testosterone

Introduction

Defective control of T cell apoptosis is considered to be one of the pathogenetic mechanisms in systemic lupus erythematosus (SLE). A number of genetic and environmental factors contribute to the T cell defect in SLE; however, the greatest risk factor for developing SLE is female gender. In addition, SLE activity flares up after administration of female sex hormones, such as oestrogen [1]. Conversely, anti-oestrogenic agents, including danazole and prolactin, are effective in the amelioration of SLE symptoms [2,3]. Several studies have implicated oestrogen as one of the key factors responsible for the development and exacerbation of SLE [1,4–6], as it stimulates interferon (IFN)-γ, interleukin (IL)-1, IL-5, IL-6 and IL-10 secretion, supports B cell survival and enhances antibody production [1]. Oestrogen has also been shown to accelerate immune complex glomerulonephritis in autoimmune Murphy Roths Large lymphoproliferation (MRL lpr/lpr) mice [4]. Further, it up-regulates Bcl-2 expression, blocks tolerance induction of naive B cells [5] and enhances the production of anti-double-stranded DNA (dsDNA) antibody and immunoglobulin G in peripheral blood mononuclear cells of SLE patients [6]. Despite these reports, the exact role of oestrogen in SLE T cell apoptosis has yet to be documented.

The Fas/Apo-1 molecule is a cell surface receptor belonging to the tumour necrosis factor (TNF) receptor superfamily and is expressed constitutively in various tissues [7,8]. The triggering of Fas by its ligand results in rapid induction of apoptosis in susceptible cells [7,8]. On the other hand, the Fas ligand (FasL), which is expressed in activated T cells, dendritic cells and natural killer (NK) cells [8], is a 40-kDa type II integral membrane protein and a member of the TNF superfamily [8,9]. It has been reported that mice carrying the lpr and generalized lymphoproliferative disease (gld) mutations have defects in the Fas and FasL gene, respectively, developed lymphadenopathy and suffered from a SLE-like autoimmune diseases [9,10]. Therefore, dysfunction in the Fas/FasL system could represent one of the crucial factors responsible for the apoptotic defect of SLE T cells.

Activation-induced cell death (AICD) is a process of apoptosis induced by repeated activation of T cells by their cognate antigen [11]. In T cells, the principal mechanism of AICD is the co-expression of Fas and FasL, followed by engagement of Fas, and a subsequent delivery of a death-inducing signal [8–10]. T cells of SLE patients can be activated by self-antigens such as dsDNA and nucleosomes [12], and in mice, nucleosomes were reported to act as effective initiators of autoreactive T cell development [13]. Moreover, T cell responses to nucleosomes were increased in SLE patents [14]. If Fas-mediated apoptosis of T cells is defective, activated T cells reactive to self-antigens may escape apoptosis and proliferate abnormally, resulting in the destruction of target tissues. Given that oestrogen triggers SLE activity, which correlates with an apoptotic defect of T cells [15], it can be postulated that oestrogen may affect the survival of activated T cells and their associated molecules, although the direct effects of oestrogen on SLE T cells have not yet been tested. The aim of this study was to determine whether oestrogen acts as a regulator of AICD and FasL expression in SLE T cells.

Materials and methods

Isolation and culture of T cells

This work was approved by the institutional review committees of the Catholic Medical Center (Seoul, Republic of Korea). Heparinized peripheral blood (100 ml) was collected aseptically from SLE patients. Informed consent for usage of cells was obtained from all the SLE patients included in this study. Peripheral blood mononuclear cells were isolated by density gradient centrifugation on a Ficoll-Hypaque. Sorting of CD3+, CD4+ and CD8+ T cells (1 × 105 cells) was performed using anti-CD3, anti-CD4 and anti-CD8 microbeads (Miltenyi Biotec, Auburn, CA, USA), respectively. T cells were then cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) (Gibco BRL, Grand Island, NY, USA), 100 U/ml penicillin, 100 µg/ml streptomycin and 2 mM L-glutamine. Each culture was performed in triplicate in 96-well plates. Cells were incubated for the predetermined times at 37°C in a 5% CO2 atmosphere and then stimulated with phorbol 12-myristate 13-acetate (PMA, 10 ng/ml) plus ionomycin (5 µg/ml) in the absence or presence of 17β-oestradiol (Sigma, St Louis, MO, USA), ranging from 10−8 M to 10−6 M.

Apoptosis assay

Assessment of T cells undergoing apoptosis was accomplished using a cellular DNA fragmentation enzyme-linked immunosorbent assay (ELISA), as described previously [16]. Briefly, an anti-DNA antibody was fixed in the wells of a microtitre plate. The bromodeoxyuridine (BrdU)-labelled DNA fragments contained in the sample were then bound to the immobilized anti-DNA Ab. Following this, the immune-complexed BrdU-labelled DNA fragments were denatured and fixed on the surface of the plate through microwave irradiation. In the final step, the anti-BrdU peroxidase conjugate was reacted with the BrdU incorporated into the DNA. After removing the unbound peroxidase conjugates, the quantity of peroxidase bound in the immune complex was determined photometrically with 3,3,5′,5′-tetramethylbenzidine dihydrochloride (TMB) as a substrate.

Flow cytometry analysis for the determination of FasL expression

After treatment of SLE T cells with PMA plus ionomycin in the absence or presence of 17β-oestradiol for 6 h, the cells were harvested, incubated for 20 min on ice in a blocking buffer [phosphate-buffered saline (PBS) with 3% fetal calf serum (FCS) and 0·02% 1 M sodium azide], and stained subsequently for 30 min on ice with phycoerythrin (PE)-conjugated mouse anti-human FasL antibody (Pharmingen, San Diego, CA, USA). PE-conjugated mouse IgG1 (Pharmingen) was used as the isotype control antibody. The cells were washed and resuspended twice in a staining buffer (PBS containing 3% FCS and 0·02% 1 M sodium azide), and then analysed on a fluorescence activated cell sorter (FACScan) cytometer (Becton Dickinson, Mountain View, CA, USA). At least 10 000 events were acquired from each sample and were analysed subsequently using Lysis II and CellQuest software (Becton Dickinson).

Semi-quantitative reverse transcription–polymerase chain reaction (RT–PCR) analysis for FasL and Fas mRNA expression

The SLE T cells were analysed for FasL and Fas mRNA expression by semi-quantitative RT–PCR [17]. Briefly, after stimulation of T cells with PMA plus ionomycin for 6 h, the mRNA was extracted from the cells using RNAzol B according to the manufacturer's instructions (Biotec Laboratories, Houston, TX, USA). The RNA was converted to cDNA using SuperscriptII RT (Gibco BRL, Gaithersburg, MD, USA), 10 mM 2′-deoxynucleoside 5′-triphosphate (dNTP), 0·1 M dithiothreitol (DTT), RNase inhibitor (Rnasin, Toyobo, Osaka, Japan) and random hexamer oligonucleotide priming (Gibco BRL). The PCR amplification of the cDNA aliquots was performed by adding 2·5 mM dNTPs, 2·5 U Taq DNA polymerase (Boehringer, Mannheim, Germany) and 0·25 µM each of the sense and anti-sense primers. The reaction was performed in PCR buffer (1·5 mM MgCl2, 50 mM KCl, 10 mM Tris HCl, pH 8·3) with a total final volume of 25 µl. The following sense and anti-sense primers for FasL, Fas and glyceraldehydes-3-phosphate-dehydrogenase (GAPDH) were used (5′→3′ direction): FasL sense GCCTGTGTCTCCTTGTGA, FasL anti-sense GCCACCCTTCTTATACTT; Fas sense CAAGTGACTGACATCAACTCC, Fas anti-sense CCTTGGTTTTCCTTTCTGTGC; GAPDH sense CGATGCTGGGCGTGAGTAC, GAPDH anti-sense CGTTCAGTCCAGGGATGACC. The reactions were processed in a DNA thermal cycler (Hybaid, Teddington, UK) under the following conditions: 1 min of denaturation at 94°C; 30 s of annealing at 63°C for FasL, 1 min at 57°C for Fas and 1 min at 55°C for GAPDH; and 1 min elongation at 72°C. PCR cycles were repeated 34 times for FasL, 34 times for Fas and 28 times for GAPDH, values which had been determined previously to fall within the exponential phase of amplification for each molecule. Reaction products were run on a 1·5% agarose gel and stained with ethidium bromide. Expression levels of mRNA are presented as a ratio of the FasL product to GAPDH product.

Statistical analysis

The data are expressed as mean ± standard deviation (s.d.). Comparisons of the numerical data between the groups were performed using a Mann–Whitney U-test. Probability (P) values less than 0·05 were considered statistically significant.

Results

As indicated in Fig. 1a, apoptosis of SLE T cells was observed at high levels 24 h after the treatment with PMA plus ionomycin, as determined using a cellular DNA fragmentation ELISA. The increase in T cell apoptosis by PMA plus ionomycin was decreased dose-dependently through treatment with 17β-oestradiol, ranging from 10−8 M to 10−6 M, indicating that oestradiol inhibited the AICD of SLE T cells. We purified CD4 and CD8 T cells of SLE patients and then determined the effect of oestrogen on these cell subsets separately. The result showed that 10−6 M of 17β-oestradiol repressed the PMA plus ionomycin-induced increase in DNA fragmentation in both cell subsets near to basal level (Fig. 1b), indicating that the protective effect of oestrogen on AICD is not different between CD4+ and CD8+ T cells.

Fig. 1.

Fig. 1

Inhibitory effect of apoptosis by oestradiol (E2) in activated T cells. The T cells of systemic lupus erythematosus (SLE) patients were incubated with phorbol 12-myristate 13-acetate (PMA, 10 ng/ml) plus ionomycin (IM, 5 µg/ml) for 24 h in the absence or presence of 17β-oestradiol (E2), ranging from 10−8 M to 10−6 M. The apoptosis of CD3+ T cells (a), CD4+ T cells (b), and CD8+ T cells (b) was determined by DNA fragmentation enzyme-linked immunosorbent assay. *P < 0·05 versus T cells stimulated with PMA plus IM alone. Data are the mean ± standard deviation of more than three independent experiments.

To address how oestrogen blocked the ACID of T cells, we next investigated whether oestrogen regulated FasL expression in T cells. Flow cytometry analysis revealed that treatment of 17β-oestradiol (10−8 M–10−6 M) decreased FasL protein expression dose-dependently in SLE T cells stimulated with PMA plus ionomycin (Fig. 2a). In contrast, testosterone (10−8 M–10−6 M), a male sex hormone, increased FasL expression additively in these same types of cells (Fig. 2b). Additionally, 17β-oestradiol (10−8 M–10−6 M) abrogated the PMA plus ionomycin-induced up-regulation of FasL mRNA expression in SLE T cells in a dose-dependent manner (Fig. 3a). The Fas mRNA expression in T cells stimulated with PMA plus ionomycin was decreased similarly by 17β-oestradiol (Fig. 3a). Moreover, 17β-oestradiol also repressed FasL mRNA expression dose-dependently in an hFasL/L5178Y cell line (kindly provided by Dr J.K. Min, Catholic University of Korea), in which human FasL mRNA was expressed stably (Fig. 3b).

Fig. 2.

Fig. 2

Opposing effects of oestrogen and testosterone on FasL expression in T cells. Systemic lupus erythematosus (SLE) T cells activated by phorbol 12-myristate 13-acetate plus ionomycin (PMA/IM) were incubated with various concentrations of 17β-oestradiol (E2, 10−8–10−6 M) or testosterone (T, 10−8 M–10−6 M) for 6 h. Expression of FasL in T cells was assessed by flow cytometry analysis using phycoerythrin (PE)-conjugated anti-FasL monoclonal antibodies. (a) Down-regulation of FasL expression by oestradiol in activated T cells. (b) Contrasting effect of testosterone on FasL expression in T cells. Data are representative of three independent experiments.

Fig. 3.

Fig. 3

Inhibition of FasL mRNA expression in activated T cells and hFasL/L5178Y cells by oestradiol. T cells of systemic lupus erythematosus (SLE) patients (a) stimulated with phorbol 12-myristate 13-acetate plus ionomycin (PMA/IM) or hFasL/L5178Y cells (b) were incubated in various concentrations of 17β-oestradiol (E2), ranging from 10−8 M to 10−6 M. Expressions of FasL and Fas mRNA were analysed by semi-quantitative reverse transcription-polymerase chain reaction. The results are expressed as the ratio of FasL- or Fas-amplified products to glyceraldehydes-3-phosphate-dehydrogenase (GAPDH) products in the lower panel. Data are representative of three independent experiments.

To test the specificity of the oestrogen effect, SLE T cells were pretreated with various concentrations (0·5 µM–5 µM) of tamoxifen, an oestrogen receptor antagonist, 1 h before the addition of 17β-oestradiol (10−6 M). As revealed in Fig. 4, tamoxifen cancelled the oestradiol-induced decrease dose-dependently in FasL mRNA expression in T cells stimulated with PMA plus ionomycin, indicating that oestrogen regulates FasL expression through a receptor-coupling event. Based on these data, we speculated that oestrogen may inhibit the apoptosis of SLE T cells by suppressing FasL up-regulation in the course of AICD. To address this issue, human FasL-expressing cells (hFasL/L5178Y) were co-cultured with a Fas-expressing cell line (D98AH2 cells, kindly provided by Dr J.H. Lee, Catholic University of Korea) in the presence of 17β-oestradiol. As shown in Fig. 5, 10−6 M of oestradiol inhibited apoptosis of Fas-expressing cells to a similar extent to 10 µg/ml of anti-FasL monoclonal antibody (mAb) treatment. Considering that 17β-oestradiol inhibited FasL expression in the hFasL/L5178Y cell line (Fig. 3b), these data suggest that oestradiol attenuates apoptotic death of Fas-expressing cells by suppressing FasL expression in effector cells.

Fig. 4.

Fig. 4

Inhibition of FasL expression by oestradiol is receptor-mediated. Systemic lupus erythematosus (SLE) T cells stimulated with phorbol 12-myristate 13-acetate (PMA) plus ionomycin (PMA/IM) were incubated in 17β-oestradiol (E2, 10−6 M) in the presence or absence of tamoxifen (TAM), ranging from 0·5 µM to 5 µM. Expression of FasL mRNA was analysed by reverse transcription-polymerase chain reaction. Data are representative of more than three independent experiments.

Fig. 5.

Fig. 5

Inhibition of apoptosis by oestradiol or anti-FasL antibody. Fas-sensitive HeLa cells (D98AH2-Fas cell) were co-cultured with FasL/L5178Y cells in the presence of 17β-oestradiol or anti-FasL antibody. Apoptosis was determined by cellular DNA fragmentation enzyme-linked immunosorbent assay. Data are the mean ± standard deviation of three independent experiments.

Discussion

Autoreactive T cells in the periphery maintain self-tolerance through several mechanisms of clonal deletion by apoptosis, anergy and active suppression during lymphocyte development and differentiation [18]. If these cells are defective in or resistant to apoptotic death, they would not be eliminated and could, therefore, elicit autoimmune disease [18]. A number of genes are involved in T cell apoptosis in SLE, including Fas, FasL, Bcl-2, Bcl-xL, myc, Nur 77 and p53 [19–21]. Among these, Fas and FasL increase T cell apoptosis, whereas Bcl-2 and Bcl-xL promotes T cell survival by blocking AICD [19–21]. The expression of Fas and FasL has been reported to be increased in SLE patients [15,22,23], leading to the hypothesis that apoptotic death of T cells is excessive in SLE patients [24]. However, a discrepancy exists as some reports have also demonstrated that AICD of T cells is defective in SLE patients [25–27].

This discrepancy could be due to the relative abundance of anti-apoptotic molecules over pro-apoptotic proteins in SLE T cells or to other mechanisms that impede the T cell receptor- or Fas-mediated apoptotic pathway. In this study, we demonstrated first that oestradiol decreased the AICD of SLE T cells, and secondly that oestradiol down-regulated the expression of FasL in activated SLE T cells both at the protein and mRNA levels. The Fas expression in activated T cells was also repressed by oestradiol. In contrast, testosterone increased FasL expression dose-dependently in SLE T cells. The inhibitory effect of oestradiol on FasL expression was mediated by a receptor-coupling event and, moreover, pretreatment of FasL-expressing cells with oestradiol inhibited the apoptosis of Fas-sensitive cells. These data provide evidence that oestrogen regulates the AICD of T cells by down-regulating FasL expression, suggesting that oestrogen inhibition of T cell death may allow for the persistence of activated T cells, thereby exhibiting the detrimental action of oestrogen on SLE activity.

Oestrogen has contradictory effects on different types of cells. Huber et al. demonstrated that in Coxsackie virus B3-speciifc T cell clones, 17β-oestradiol prevented Fas-dependent apoptosis by altering Bcl-2 expression while testosterone promoted it [28]. Oestrogen also reduced AICD of normal peripheral blood T cells stimulated with anti-human CD3 antibody [29], a finding which is supportive of our results. However, in lupus-prone mice, treatment with E2 caused a decrease in thymic cellularity, but up-regulated several genes involved in apoptosis, including FasL and caspases in thymocytes of these mice [30]. In addition, 17β-oestradiol altered Jurkat lymphocyte cell cycling and induced apoptosis through suppression of Bcl-2 and cyclin A [29,31]. It has been also demonstrated that oestrogen protected bone loss by inducing FasL in osteoblasts, thereby decreasing osteoclast survival [32]. Therefore, it seems likely that oestrogen-induced decrease in cell survival is not a universal phenomenon, but is limited to primary T cells and can be different depending on cell types.

In summary, our study demonstrated that oestrogen hampers AICD of SLE T cells by suppressing FasL expression, whereas testosterone promotes FasL expression in T cells. These data suggest that oestrogen contributes to the persistence of autoreactive T cells through the defective control of apoptosis, and may also provide a clue as to how oestrogen triggers SLE activity. However, it remains unclear as to whether oestrogen affects the survival of peripheral T cells reactive to self-antigens in vivo. In addition, we did not examine the tripartite relationship among oestrogen, T cell apoptosis and disease activity in SLE patients. Further longitudinal study is required to clarify these issues.

Acknowledgments

This research was supported by Basic Science Research Program through the National Research Foundation funded by the Ministry of Education, Science and Technology (No. 314-2008-1-E00113) and by a grant from the Korea Association of Internal Medicine.

Disclosure

None.

References

  • 1.McMurray RW. Estrogen, prolactin, and autoimmunity: actions and interactions. Int Immunopharmacol. 2001;1:995–1008. doi: 10.1016/s1567-5769(01)00045-5. [DOI] [PubMed] [Google Scholar]
  • 2.West SG, Johnson SC. Danazol for the treatment of refractory autoimmune thrombocytopenia in systemic lupus erythematosus. Ann Intern Med. 1988;108:703–6. doi: 10.7326/0003-4819-108-5-703. [DOI] [PubMed] [Google Scholar]
  • 3.Alvarez-Nemegyei J, Cobarrubias-Cobos A, Escalante-Triay F, Sosa-Munoz J, Miranda JM, Jara LJ. Bromocriptine in systemic lupus erythematosus: a double-blind, randomized, placebo-controlled study. Lupus. 1998;7:414–9. doi: 10.1191/096120398678920334. [DOI] [PubMed] [Google Scholar]
  • 4.Carlsten H, Nilsson N, Jonsson R, Backman K, Holmdahl R, Tarkowski A. Estrogen accelerates immune complex glomerulonephritis but ameliorates T cell-mediated vasculitis and sialadenitis in autoimmune MRL lpr/lpr mice. Cell Immunol. 1992;144:190–202. doi: 10.1016/0008-8749(92)90236-i. [DOI] [PubMed] [Google Scholar]
  • 5.Bynoe MS, Grimaldi CM, Diamond B. Estrogen up-regulates Bcl-2 and blocks tolerance induction of naive B cells. Proc Natl Acad Sci USA. 2000;97:2703–8. doi: 10.1073/pnas.040577497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kanda N, Tsuchida T, Tamaki K. Estrogen enhancement of anti-double-stranded DNA antibody and immunoglobulin G production in peripheral blood mononuclear cells from patients with systemic lupus erythematosus. Arthritis Rheum. 1999;42:328–37. doi: 10.1002/1529-0131(199902)42:2<328::AID-ANR16>3.0.CO;2-#. [DOI] [PubMed] [Google Scholar]
  • 7.Trauth BC, Klas C, Peters AM, et al. Monoclonal antibody-mediated tumor regression by induction of apoptosis. Science. 1989;245:301–5. doi: 10.1126/science.2787530. [DOI] [PubMed] [Google Scholar]
  • 8.Nagata S, Golstein P. The Fas death factor. Science. 1995;267:1449–56. doi: 10.1126/science.7533326. [DOI] [PubMed] [Google Scholar]
  • 9.Takahashi T, Tanaka M, Brannan CI, et al. Generalized lymphoproliferative disease in mice, caused by a point mutation in the Fas ligand. Cell. 1994;76:969–76. doi: 10.1016/0092-8674(94)90375-1. [DOI] [PubMed] [Google Scholar]
  • 10.Watanabe-Fukunaga R, Brannan CI, Copeland NG, Jenkins NA, Nagata S. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature. 1992;356:314–7. doi: 10.1038/356314a0. [DOI] [PubMed] [Google Scholar]
  • 11.van Parijs L, Perez VL, Abbas AK. Mechanisms of peripheral T cell tolerance. Novartis Found Symp. 1998;215:5–14. doi: 10.1002/9780470515525.ch2. [DOI] [PubMed] [Google Scholar]
  • 12.Wellmann U, Letz M, Herrmann M, Angermüller S, Kalden JR, Winkler TH. The evolution of human anti-double-stranded DNA autoantibodies. Proc Natl Acad Sci USA. 2005;102:9258–63. doi: 10.1073/pnas.0500132102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Mohan C, Adams S, Stanik V, Datta SK. Nucleosome: a major immunogen for pathogenic autoantibody-inducing T cells of lupus. J Exp Med. 1993;177:1367–81. doi: 10.1084/jem.177.5.1367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Bruns A, Bläss S, Hausdorf G, Burmester GR, Hiepe F. Nucleosomes are major T and B cell autoantigens in systemic lupus erythematosus. Arthritis Rheum. 2000;43:2307–15. doi: 10.1002/1529-0131(200010)43:10<2307::AID-ANR19>3.0.CO;2-J. [DOI] [PubMed] [Google Scholar]
  • 15.Bijl M, Horst G, Limburg PC, Kallenberg CG. Fas expression on peripheral blood lymphocytes in systemic lupus erythematosus (SLE): relation to lymphocyte activation and disease activity. Lupus. 2001;10:866–72. doi: 10.1191/096120301701548517. [DOI] [PubMed] [Google Scholar]
  • 16.Kim WU, Yoo SA, Min SY, et al. Hydroxychloroquine potentiates Fas-mediated apoptosis of rheumatoid synoviocytes. Clin Exp Immunol. 2006;144:503–11. doi: 10.1111/j.1365-2249.2006.03070.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Han D, Xu X, Baidal D, et al. Assessment of cytotoxic lymphocyte gene expression in the peripheral blood of human islet allograft recipients: elevation precedes clinical evidence of rejection. Diabetes. 2004;53:2281–90. doi: 10.2337/diabetes.53.9.2281. [DOI] [PubMed] [Google Scholar]
  • 18.Walker LS, Abbas AK. The enemy within: keeping self-reactive T cells at bay in the periphery. Nat Rev Immunol. 2002;2:11–9. doi: 10.1038/nri701. [DOI] [PubMed] [Google Scholar]
  • 19.Akbar AN, Borthwick NJ, Wickremasinghe RG, et al. Interleukin-2 receptor common γ chain signaling cytokines regulate activated T cell apoptosis in response to growth factor withdrawal: selective induction of anti-apoptotic (bcl-2, bcl-xL) but not pro-apoptotic (bax, bcl-xS) gene expression. Eur J Immunol. 1996;26:294–9. doi: 10.1002/eji.1830260204. [DOI] [PubMed] [Google Scholar]
  • 20.Tsokos GC, Liossis SN. Immune cell signaling defects in lupus: activation, anergy and death. Immunol Today. 1999;20:119–24. doi: 10.1016/s0167-5699(98)01395-4. [DOI] [PubMed] [Google Scholar]
  • 21.Youle RJ, Strasser A. The BCL-2 protein family: opposing activities that mediate cell death. Nat Rev Mol Cell Biol. 2008;9:47–59. doi: 10.1038/nrm2308. [DOI] [PubMed] [Google Scholar]
  • 22.Kovacs B, Liossis SN, Dennis GJ, Tsokos GC. Increased expression of functional Fas-ligand in activated T cells from patients with systemic lupus erythematosus. Autoimmunity. 1997;25:213–21. doi: 10.3109/08916939708994730. [DOI] [PubMed] [Google Scholar]
  • 23.Amasaki Y, Kobayashi S, Takeda T, et al. Up-regulated expression of Fas antigen (CD95) by peripheral naive and memory T cell subsets in patients with systemic lupus erythematosus (SLE): a possible mechanism for lymphopenia. Clin Exp Immunol. 1995;99:245–50. doi: 10.1111/j.1365-2249.1995.tb05540.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Emlen W, Niebur J, Kadera R. Accelerated in vitro apoptosis of lymphocytes from patients with systemic lupus erythematosus. J Immunol. 1994;152:3685–92. [PubMed] [Google Scholar]
  • 25.Budagyan VM, Bulanova EG, Sharova NI, Nikonova MF, Stanislav ML, Yarylin AA. The resistance of activated T-cells from SLE patients to apoptosis induced by human thymic stromal cells. Immunol Lett. 1998;60:1–5. doi: 10.1016/s0165-2478(97)00128-4. [DOI] [PubMed] [Google Scholar]
  • 26.Kovacs B, Vassilopoulos D, Vogelgesang SA, Tsokos GC. Defective CD3-mediated cell death in activated T cells from patients with systemic lupus erythematosus: role of decreased intracellular TNF-α. Clin Immunol Immunopathol. 1996;81:293–302. doi: 10.1006/clin.1996.0192. [DOI] [PubMed] [Google Scholar]
  • 27.Xu L, Zhang L, Yi Y, Kang HK, Datta SK. Human lupus T cells resist inactivation and escape death by upregulating COX-2. Nat Med. 2004;10:411–5. doi: 10.1038/nm1005. [DOI] [PubMed] [Google Scholar]
  • 28.Huber SA, Kupperman J, Newell MK. Estradiol prevents and testosterone promotes Fas-dependent apoptosis in CD4+ Th2 cells by altering Bcl 2 expression. Lupus. 1999;8:384–7. doi: 10.1177/096120339900800511. [DOI] [PubMed] [Google Scholar]
  • 29.Hirano S, Furutama D, Hanafusa T. Physiologically high concentrations of 17β-estradiol enhance NF-κB activity in human T cells. Am J Physiol Regul Integr Comp Physiol. 2007;292:R1465–71. doi: 10.1152/ajpregu.00778.2006. [DOI] [PubMed] [Google Scholar]
  • 30.Do Y, Ryu S, Nagarkatti M, Nagarkatti PS. Role of death receptor pathway in estradiol-induced T-cell apoptosis in vivo. Toxicol Sci. 2002;70:63–72. doi: 10.1093/toxsci/70.1.63. [DOI] [PubMed] [Google Scholar]
  • 31.Jenkins JK, Suwannaroj S, Elbourne KB, Ndebele K, McMurray RW. 17-β-estradiol alters Jurkat lymphocyte cell cycling and induces apoptosis through suppression of Bcl-2 and cyclin A. Int Immunopharmacol. 2001;1:1897–911. doi: 10.1016/s1567-5769(01)00114-x. [DOI] [PubMed] [Google Scholar]
  • 32.Krum SA, Miranda-Carboni GA, Hauschka PV, et al. Estrogen protects bone by inducing Fas ligand in osteoblasts to regulate osteoclast survival. EMBO J. 2008;27:535–45. doi: 10.1038/sj.emboj.7601984. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES