Skip to main content
PLOS One logoLink to PLOS One
. 2010 Oct 28;5(10):e15379. doi: 10.1371/journal.pone.0015379

Functional Roles of the N- and C-Terminal Regions of the Human Mitochondrial Single-Stranded DNA-Binding Protein

Marcos T Oliveira 1, Laurie S Kaguni 1,*
Editor: Janine Santos2
PMCID: PMC2965674  PMID: 21060847

Abstract

Biochemical studies of the mitochondrial DNA (mtDNA) replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB). Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence) are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold). Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

Introduction

Single-stranded DNA-binding proteins (SSBs) are essential components in DNA metabolic processes, including replication, repair and recombination. In addition to their protective single-stranded DNA-coating properties, it has been demonstrated that SSBs from distantly-related species have far more complex roles that include the organization and/or mobilization of all aspects of DNA metabolism (reviewed in [1]). In eukaryotic cells, there are two compartmentalized SSBs: replication protein A is found in the nucleus, whereas mtSSB is found in the mitochondrion. Despite sharing a similar single-stranded DNA-binding domain (oligonucleotide/oligosaccharide binding domain or OB-fold) together with bacterial and viral SSBs [2], [3], [4], [5], [6], and performing analogous functions in their respective cellular compartments, mtSSB and RPA are not related evolutionarily. mtSSBs are homologues of eubacterial SSBs, whose prototype is the well studied Escherichia coli SSB (EcSSB) (Fig. 1), a fact that is in agreement with the endosymbiont theory of mitochondrial origin [7].

Figure 1. Sequence alignment of animal mtSSBs with E. coli SSB, and mutagenesis of HsmtSSB.

Figure 1

Thirteen mtSSB sequences (notwithstanding the mitochondrial presequence) from various species across the animal kingdom were aligned with the E. coli SSB sequence using Clustal X [49]. Only the representative mtSSB sequences from humans (GenBank accession: NP_003134), fruitfly (Drosophila melanogaster; GenBank accession: AAF16936), silkworm (Bombyx mori; GenBank accession: ABF51293), and frog (Xenopus laevis; GenBank accession: NP_001095241) are shown. The gray boxes denote the N- and C-terminal regions of animal mtSSB that are not conserved in E. coli SSB. The amino acid residues indicated in bold in the HsmtSSB sequence were targeted for deletion mutagenesis. Amino acid residues 13–123 in the HsmtSSB sequence comprise the OB-fold domain (see the text for details).

At the mitochondrial DNA (mtDNA) replication fork, mtSSB interacts functionally with DNA polymerase γ (pol γ) and mtDNA helicase (also known as Twinkle) to promote mtDNA replication. In vitro, the Drosophila melanogaster mtSSB (DmmtSSB) stimulates 15- to 20-fold the DNA polymerase and 3′-5′ exonuclease activities of Drosophila pol γ (Dmpol γ) on a singly-primed single-stranded DNA (ssDNA) template [8]. The human mtSSB (HsmtSSB) stimulates the DNA unwinding activity of the human mtDNA helicase (HsmtDNA helicase) [9], and is required for strand-displacement DNA synthesis in the presence of human pol γ (Hspol γ) and HsmtDNA helicase [10]. In vivo, deleterious mutations in the mtSSB gene cause loss of mtDNA that results in developmental arrest in Drosophila [11], and growth limitation due to mitochondrial dysfunction in Saccharomyces cerevisiae [12]. Our group has shown that the knockdown of the endogenous DmmtSSB in Drosophila Schneider cells results in mtDNA copy number reduction and growth retardation [13]. The overexpression of the wild-type protein rescues the phenotype, whereas a ssDNA-binding mutant of DmmtSSB is unable to do so. Very recently, the knockdown of HsmtSSB in human HeLa cells was shown to promote a gradual decline in mtDNA copy number and a severe reduction in 7S DNA synthesis [14].

In this report, we examine the biochemical and physical properties of four HsmtSSB proteins: the mature full-length protein (notwithstanding the mitochondrial presequence, HsmtSSBwt), a deletion variant lacking the first 9 residues in the N-terminus (HsmtSSBΔN), a deletion variant lacking the last 7 residues in the C-terminus (HsmtSSBΔC), and a variant that lacks both termini (HsmtSSBΔNΔC). The target regions are of particular interest for several reasons: 1) they represent two of the few regions of significant amino acid sequence variability between mtSSBs and bacterial SSBs – the N-terminal extension is absent in bacterial SSBs, whereas the C-terminus is short and uncharged in mtSSBs (Fig. 1); 2) they appear disordered in the crystal structure of HsmtSSB [3], suggesting flexibility and/or dynamism of these regions without apparent interactions with the ssDNA-binding domain; and 3) in EcSSB, bacteriophage T7 gp2.5 and T4 gp32 SSBs, the C-terminal region interacts with other components of DNA metabolic processes, and regulates ssDNA binding negatively. We evaluate our findings in the context of functions at the mitochondrial replication fork, and discuss them in comparison with other DNA replication systems.

Results

Purification of amino- and carboxyl-terminal deletion variants of HsmtSSB, and determination of oligomeric state

In order to study the possible roles of the N- and C-terminal regions of HsmtSSB at the mtDNA replication fork, we produced three deletion variants together with HsmtSSBwt: HsmtSSBΔN, HsmtSSBΔC, and HsmtSSBΔNΔC. The overexpression of untagged recombinant proteins in E. coli using the pET-11a system resulted in high levels of soluble proteins, except for HsmtSSBΔC; the extraction and solubility of HsmtSSBΔC was dependent on inclusion of a dodecyl-maltoside detergent. From this point on, the purification of the proteins was identical. We modified earlier protocols for purification of DmmtSSB [8] and HsmtSSB [15] in order to obtain highly pure proteins (Fig. 2). In particular, substitution of velocity sedimentation, used previously as a final step, by phosphocellulose chromatography followed by assay of ATP-dependent dsDNA unwinding activity in each fraction, was a critical improvement towards the elimination of a highly active bacterial contaminant (see “Materials and Methods” for details).

Figure 2. SDS-PAGE of terminal deletion variants of HsmtSSB.

Figure 2

Near-homogeneous fractions (∼2 µg) of recombinant HsmtSSBwt (lane 1), ΔN (lane 2), ΔC (lane 3), and ΔNΔC (lane 4) were subjected to SDS-PAGE in a 17% gel, followed by Coomassie blue staining as described under “Materials and Methods.” The sizes of molecular mass markers (BenchMark™ Pre-Stained Protein Ladder, Invitrogen™) are indicated in kDa at left.

With near-homogeneous HsmtSSBwt and the terminal deletion variants in hand, we evaluated the possible consequences of the lack of the termini on its physical and biochemical properties. SDS-PAGE of HsmtSSBwt, ΔN, ΔC, and ΔNΔC reveals polypeptides of ∼15, 14, 14, and 13 kDa, respectively (Fig.2). To investigate their oligomeric state in solution, we employed hydrodynamic methods to estimate native molecular mass. We observed single peaks for each recombinant protein both in velocity sedimentation and in Superdex 75 gel filtration (Fig. 3). The sedimentation coefficient was 4.2 S for all of the proteins, and the Stokes' radii were 3.4, 3.2, 3.2, and 3.0 nm respectively for wild type, ΔN, ΔC, and ΔNΔC. Together, these indexes indicate native molecular masses of ∼56, 53, 53, and 51 kDa, respectively, consistent with the size of homotetrameric forms.

Figure 3. Terminal deletion variants of HsmtSSB form tetramers in solution.

Figure 3

Hydrodynamic analysis of HsmtSSBwt and deletion variants. A, HsmtSSBwt (•), ΔN (▪), ΔC (▴), and ΔNΔC (▾) were sedimented in 12–30% glycerol gradients for 63 hr at 264,000×g, and the gradient fractions were analyzed by 17% SDS-PAGE. B, the HsmtSSB proteins were chromatographed on a Superdex 75 gel filtration column, and fractions were analyzed by absorption at 280 nm. Standard protein markers used were: bovine serum albumin (BSA: 4.85 S, RS 3.61 nm), carbonic anhydrase (CA: 3.23 S, RS 2.43 nm), and lysozyme (LYS: 1.91 S, RS 1.5 nm).

Terminal deletion variants of HsmtSSB bind to ssDNA with similar affinities

We proceeded to evaluate the HsmtSSB deletion variants by examining their biochemical activities as compared to the wild-type protein. Using a gel mobility shift assay (GMSA), we examined the apparent DNA-binding affinities of HsmtSSBwt and the terminal deletion variants using a 48-mer ssDNA oligonucleotide (Fig. 4), whose size is close to the binding-site size determined previously for HsmtSSB [16]. A titration of the proteins at 50 mM NaCl revealed no significant differences in ssDNA-binding affinities between HsmtSSBwt and the deletion variants, with apparent Kds of ∼5 nM. Interestingly, the lack of the C-terminal region does not appear to interfere with the ssDNA-binding efficacy of HsmtSSB, in contrast to EcSSB and T7 gp2.5. A recent report by Kozlov et al. [17] shows that an increased ssDNA binding of EcSSB lacking the C-terminus is observed only at 100 and 200 mM NaCl, and not at low salt concentration (20 mM NaCl). We also performed the GMSA assays with the HsmtSSB proteins at 20 and 100 mM NaCl, but failed to observe any differences in binding affinities (data not shown). At the 20–100 mM range, salt does not seem to affect the ssDNA-binding affinity of either the wild-type or variant forms of HsmtSSB.

Figure 4. Terminal deletion variants of HsmtSSB bind to ssDNA with similar affinities.

Figure 4

A, ssDNA-binding affinity was evaluated by GMSA. HsmtSSBwt and its deletion variants were pre-incubated with a radiolabeled 48-mer oligonucleotide at 50 mM NaCl in the presence of increasing mtSSB concentrations: 1.25, 2.5, 3.75, 5, 7.5, 10, 15, 20, 30, 40 and 50 nM (as tetramer), as described under “Materials and Methods”. “−” denotes no added protein. The fraction of unbound (U) and bound (B) oligomer were quantitated, and the data were plotted in B as the percent of substrate utilized. The data represent the average of three experiments.

Salt-dependent stimulation of Hspol γ by HsmtSSB terminal deletion variants

To evaluate the capacity of the HsmtSSB variants to stimulate the DNA polymerase activity of Hspol γ in vitro, we first examined the effects of KCl concentration on DNA synthesis by reconstituted Hspol γ holoenzyme on singly-primed M13 DNA in the presence and absence of HsmtSSBwt (Fig. 5). In the absence of HsmtSSBwt, Hspol γ activity is stimulated ∼2 fold as the concentration of KCl in the reaction increases from 20 to 100 mM, in agreement with previously published data [18]. Unlike Dmpol γ stimulation by DmmtSSB that occurs over a broad range of KCl concentrations (0–130 mM) [8], the stimulation of Hspol γ by HsmtSSBwt is only observed at 20 mM KCl, and reaches its maximum at a concentration of HsmtSSBwt sufficient to cover the entire singly-primed M13 DNA substrate (according to our GMSA data). At 50 mM KCl, the presence of HsmtSSBwt at low levels promotes a slight stimulation of DNA synthesis by Hspol γ, but it becomes somewhat inhibitory at higher levels. At 100 mM KCl, where the activity of Hspol γ alone is highest, the presence of HsmtSSBwt is completely inhibitory. The maximal stimulation of DNA synthesis by Hspol γ in the presence of HsmtSSBwt at 20 mM KCl is only moderate, albeit ∼3-fold higher than the activity of Hspol γ alone at 100 mM KCl. Judging by the fact that the ssDNA-binding affinity of HsmtSSBwt does not change over the range of 20–100 mM KCl, the data suggest that increasing ionic strength inhibits the ability of Hspol γ to displace HsmtSSB from ssDNA template during the course of in vitro DNA synthesis.

Figure 5. HsmtSSBwt stimulates the DNA polymerase activity of Hspol γ in a salt-dependent manner.

Figure 5

DNA synthesis by reconstituted Hspol γ holoenzyme was measured on singly-primed M13 DNA, as described under “Materials and Methods”, in the presence of the indicated KCl and HsmtSSBwt concentrations. The data were normalized to the amount of nucleotide incorporated by Hspol γ at 100 mM KCl in absence of HsmtSSBwt (that was arbitrarily set as 1).

Next, we evaluated the ability of the terminal deletion variants of HsmtSSB to stimulate DNA synthesis by Hspol γ (Fig. 6). Overall, the effect of KCl concentration is similar among the variants: at 20 mM, DNA synthesis is stimulated; at 50 mM, we observe no stimulation and/or slight inhibition; at 100 mM, Hspol γ is inhibited completely. Notably, under low salt conditions, HsmtSSBΔN, ΔC, and ΔNΔC show 1.4- to 2-fold higher stimulation of Hspol γ as compared to HsmtSSBwt. This increased stimulation is not apparent at low concentrations of the HsmtSSBs, but it is clearly evident and reproducible at saturating levels. The data argue that the N- and C-terminal regions of HsmtSSB have functionally inhibitory roles on its ability to stimulate the DNA polymerase activity of Hspol γ, suggesting a modulatory role in vivo.

Figure 6. Stimulation of Hspol γ by terminal deletion variants of HsmtSSB.

Figure 6

DNA synthesis by reconstituted Hspol γ holoenzyme was measured on singly-primed M13 DNA, as described under “Materials and Methods”, in the presence of the indicated concentrations of HsmtSSBwt (▪), ΔN (•), ΔC (▴), and ΔNΔC (▾), at 20 mM (upper), 50 mM (middle), and 100 mM (lower panel) KCl. The data were normalized to the amount of nucleotide incorporated by Hspol γ at 100 mM KCl in absence of HsmtSSBwt (that was arbitrarily set as 1).

Stimulation of DNA unwinding activity of HsmtDNA helicase by terminal deletion variants of HsmtSSB

As shown previously, HsmtSSBwt stimulates the DNA unwinding activity of HsmtDNA helicase in vitro [9]. We examined the effects of the terminal deletion variants in stimulating the DNA unwinding activity of HsmtDNA helicase using as substrate pBSKS+ ssDNA (2,958 nt), to which was annealed a 60-mer ssDNA oligonucleotide that creates a 40-nt 5′-single-stranded tail for helicase loading followed by 20 nt of paired sequence. First, we asked if varying KCl concentrations produced the same pattern of stimulation of HsmtDNA helicase by HsmtSSBwt as compared to its stimulation of Hspol γ (Fig. 7). We found that HsmtDNA helicase shows a slightly better DNA unwinding activity at 100 mM KCl as compared to that at 20 and 50 mM KCl. We then evaluated various potassium salts, including phosphate, acetate and glutamate, and found that KCl provided the best stimulation (data not shown). In contrast to the results with Hspol γ, stimulation of HsmtDNA helicase in the presence of saturating amounts of HsmtSSBwt is similar at the three KCl concentrations tested, suggesting that the results we show in Figures 5 and 6 are related specifically to functional interactions between HsmtSSB and Hspol γ.

Figure 7. Stimulation of DNA unwinding activity of HsmtDNA helicase by HsmtSSBwt is independent of KCl concentration.

Figure 7

DNA unwinding assays were performed as described under “Materials and Methods”. Upper panel, 3.5 nM of HsmtDNA helicase (as hexamer) and 200 nM of HsmtSSBwt (as tetramer) were used where indicated by “+”. The concentration of KCl used is indicated above each lane. “−” and “+ boil” lanes represent the intact and denatured substrate (heated to 100°C for 2 min prior to loading), respectively. Lower panel, analysis of the data shown in the upper panel together with the data from two other independent experiments. The gray and black bars represent the average of unwound substrate as percent in the absence and presence of HsmtSSBwt, respectively.

We extended our analysis by titrating HsmtSSBwt, ΔN, ΔC, and ΔNΔC in DNA unwinding assays conducted at 50 mM KCl (Fig. 8). None of the concentrations of the HsmtSSBs used were sufficient to cause any dsDNA destabilization in the absence of helicase (Fig. 8A). HsmtDNA helicase shows maximal DNA unwinding activity in the presence of 100 nM HsmtSSB, a concentration corresponding to coating of ∼80% of the ssDNA substrate (according to our GMSA data). No significant differences in stimulation were observed between HsmtSSBwt and deletion variants; stimulation of the HsmtDNA helicase was ∼8 fold at the highest HsmtSSB concentrations.

Figure 8. Stimulation of HsmtDNA helicase by terminal deletion variants of HsmtSSB.

Figure 8

DNA unwinding assays were performed as described under “Materials and Methods”. A, a constant concentration of HsmtDNA helicase (3.5 nM as hexamer) and KCl (50 mM) were used in each assay. The concentration of HsmtSSBs (as tetramer) that was used is indicated above each lane. “−” and “+ boil” lanes represent the intact and denatured substrate (heated to 100°C for 2 min prior to loading), respectively. B, analysis of the data shown in A together with the data from two other independent experiments. The data represent the average of unwound substrate as percent.

Discussion

Biochemical studies of the mtDNA replisome demonstrate that pol γ and the mtDNA helicase are stimulated by mtSSB. We have shown previously that DmmtSSB can stimulate ∼20-fold in vitro DNA synthesis by Dmpol γ over a broad range of KCl concentrations, primarily by enhancing primer recognition and binding [8], [19]. Similarly, DmmtSSB stimulates ∼15-fold the 3′-5′ exonuclease activity of Dmpol γ over the same KCl range [8]. Furthermore, HsmtSSB has been shown to stimulate the DNA unwinding activity of the HsmtDNA helicase [9] and together with Hspol γ and HsmtDNA helicase, reconstitutes a minimal mtDNA replisome in vitro [10]. These data indicate that mtSSBs serve an important role in initiation and elongation of DNA synthesis in mtDNA replication, consistent with the observation that the disruption of the Drosophila (lopo) and yeast (rim1) mtSSB genes results in loss of mtDNA and respiratory capacity, and consequently, developmental lethality or impaired growth, respectively [11], [12].

mtSSBs are homologues of EcSSB, with which they exhibit a high degree of amino acid sequence conservation in the OB-fold domain (Fig. 1), and share similar physical, biochemical, and structural properties [3], [16], [19], [20]. Animal mtSSBs, however, evolved at least two different sequences from their eubacterial counterpart: their N- and C-termini. After import into mitochondria, the mitochondrial presequence is cleaved, producing the mature mtSSB protein. The mature polypeptide in humans contains 9 amino acids at the N-terminus that are absent in EcSSB, and only 7 residues at the C-terminus, in contrast with the long acidic C-terminal tail of its eubacterial homologue; these potentially protrude from the ssDNA-binding core without any detectable secondary structure [3]. Here, we sought to analyze the functional importance of the N- and C-terminal regions of HsmtSSB in the context of mtDNA replication. We purified HsmtSSBwt, HsmtSSBΔN, HsmtSSBΔC, and HsmtSSBΔNΔC to near-homogeneity and showed that all of the proteins form tetramers in solution, indicating that the termini are not critical for the folding or stability of HsmtSSB, as predicted by the crystallographic data [3].

Next, we analyzed the ssDNA-binding properties of the terminal deletion variants using a GMSA approach. The lack of either or both termini did not alter the ssDNA-binding affinity of HsmtSSB, which is relatively high as observed for SSBs from various sources [21]. This is particularly relevant because we have shown previously that ssDNA-binding variants of DmmtSSB fail to stimulate Dmpol γ efficiently in vitro, and promote mtDNA depletion and cell growth defects in Drosophila Schneider cells [13]. Our findings distinguish biochemically the role of the C-terminal region of mtSSBs as compared to prokaryotic forms. The crystal structures of viral, eubacterial, eukaryotic nuclear and mitochondrial SSBs show that these proteins share a common structural domain for binding to ssDNA, the OB-fold [2], [3], [4], [5], [6], although they share no sequence homology. In addition, eubacterial and bacteriophage SSBs do share another structural feature: a long acidic C-terminal tail, which is essential for DNA replication and viability of the organisms [22], [23], [24]. The removal of the C-termini of EcSSB, T7 gp2.5 and T4 gp32 increases their ssDNA-binding affinities significantly [22], [24], [25] but at the same time, abolishes interactions with other components of their cognate replication machinery [1], [26], [27], [28]. Recently, Shereda et al. [29] showed that proteins that interact with the C-terminus of E. coli SSB share a similar structural surface where the interaction occurs, demonstrating the presence of a signature contact structure. Interaction with the C-terminus of E. coli SSB via this signature structure appears to be highly regulated, because progressive truncations from its C-terminal end cause a progressive loss of both physical and functional interactions. Marintcheva et al. [30] showed that the acidic C-terminus of T7 gp2.5 and ssDNA actually compete for binding to the ssDNA-binding cleft of the protein, which is located in the N-terminal OB-fold domain. A functional model proposes that in absence of DNA, the C-terminal region binds to the ssDNA-binding cleft, and is then displaced upon ssDNA binding, rendering it available for protein-protein interactions. Such an interaction between the C-terminus and the ssDNA-binding cleft is suggested to create an electrostatic shield that protects the binding cleft from random charged surfaces inside the cell. Our data shows clearly that the C-terminal region of HsmtSSB does not influence the ssDNA-binding affinity of the protein, suggesting that this region of the eubacterial-like mtSSBs serves a role that differs from those of EcSSB, T7 gp2.5 and T4 gp32. Indeed, in this sense, HsmtSSB resembles the nuclear replication protein A (reviewed in [31]); binding of random charged molecules to the ssDNA-binding cleft of eukaryotic SSBs is thus most likely prevented by a distinct mechanism.

To investigate further the functional properties of the N- and C-terminal regions of HsmtSSB, we performed stimulation assays of Hspol γ and HsmtDNA helicase under varying conditions. We found that the stimulation of the DNA polymerase activity of Hspol γ by HsmtSSBwt is moderate (∼3 fold) and observed only at low KCl concentrations (20 mM). Increasing KCl concentrations resulted in concentration-dependent inhibition, suggesting that electrostatic forces govern the functional interactions between Hspol γ and HsmtSSB. Interestingly, in vitro stimulation (up to 20 fold) of the DNA polymerase activity of Dmpol γ by DmmtSSB is observed over a broad range of KCl concentrations (0 to 130 mM) [8]. We speculate that this difference in the human and Drosophila systems likely reflects the different subunit composition of the mammalian and insect pol γs. Hspol γ is a heterotrimeric enzyme comprising one catalytic and two accessory subunits (αβ2) [32], [33]; the α and dimeric β subunits can be expressed in heterologous systems and purified independently [15], [18], and the holoenzyme is subsequently reconstituted in vitro. In contrast, Dmpol γ has a heterodimeric composition, with one catalytic and one accessory subunit (αβ) [34]; both folding and stability are interdependent, as evidenced by the fact that in a heterologous system, the two subunits must be co-expressed to reconstitute the Dmpol γ holoenzyme [35]. Furthermore, subunit interactions in the insect enzyme occur at multiple sites along the polypeptides [36]. That the differences in pol γ stimulation by the fly and human mtSSBs results from differences in pol γ structure is supported by the fact that both DmmtSSB and EcSSB stimulate similarly Dmpol γ [37]. Additional support for this hypothesis is also provided by a recent report, which shows that each protomer of the dimeric human accessory subunit serves distinct roles in DNA synthesis by Hspol γ [38]. Thus, we speculate that the function of the Hspol γ-β dimer in the human mtDNA replisome is at least in part performed by DmmtSSB in the Drosophila system. Further investigation of the mechanism of pol γ stimulation by mtSSB is clearly warranted to promote understanding of the species-specific roles of these proteins at the mtDNA replication fork.

Our analysis of stimulation of Hspol γ by the deletion variants of HsmtSSB revealed an interesting and surprising feature: the lack of the N- and/or C-terminus of HsmtSSB increases its capacity to stimulate Hspol γ under low ionic strength conditions. This suggests that both termini may actually modulate the DNA polymerase activity of Hspol γ by inhibiting its stimulation by HsmtSSBwt. Whether this modulation is mediated through physical or functional interactions only remains to be determined, but it is clear that the relevant interactions do not involve a positive regulation, as is the case for EcSSB, T7 gp2.5 and T4 gp32, and their respective DNA polymerase partners at the replication fork. In considering the electrostatic forces that may govern functional interactions, we examined the predicted isoelectric points (pIs) for various structural elements in Hspol γ-α and wild-type HsmtSSB. We were especially interested in a fragment of the spacer region domain of Hspol γ-α assigned as the intrinsic processivity (IP) sub-domain in the recent crystal structure [33], because earlier studies from our lab suggested that residues in this sub-domain are important for the functional interaction between Drosophila pol γ and its cognate mtSSB [39]. Consistent with the hypothesis that the functional interactions between Hspol γ and HsmtSSB are electrostatic, we found a pI of 8.2 for wild-type HsmtSSB, and 5.7 for the IP sub-domain of Hspol γ-α, suggesting that increasing salt in the pol assays disrupts the electrostatic forces that allow Hspol γ to displace HsmtSSB from ssDNA. The only other domain of Hspol γ-α that carries an overall negative charge is the accessory-interacting domain (pI 4.7), which interacts tightly with the proximal protomer of the pol γ-β dimer. In examining the terminal deletion variants of HsmtSSB we found pIs of 9.0 (ΔC), 9.2 (ΔN) and 9.5 (ΔNΔC), suggesting that lack of either or both termini causes a significant increase in the overall positive charges of the protein that may strengthen its interactions with Hspol γ, stimulating DNA synthesis and allowing Hspol γ to displace it from the ssDNA. At the same time, the ssDNA-binding affinities of the variant HsmtSSBs are unaffected over the range of 20–100 mM KCl (Fig. 4 and data not shown). As the HsmtSSB becomes more positively charged without its termini, the electrostatic forces between Hspol γ and HsmtSSB likely increase at 20 mM KCl, increasing the stimulation and the ability of Hspol γ to displace the HsmtSSB variants more easily. However, whereas ssDNA binding by HsmtSSB is stable at 50 mM KCl, this salt concentration is apparently sufficient to disturb interactions between Hspol γ and both the wild-type and variant forms of HsmtSSB, giving rise to its inhibitory effects. Although the effects we observe are modest, it seems possible that given the fluctuating ionic conditions that occur in the mitochondrion [40], [41], they may play a role in regulating the interactions between Hspol γ and HsmtSSB in vivo.

In contrast with Hspol γ, the stimulation of HsmtDNA helicase by HsmtSSB proteins is not salt-dependent, and the deletion variants of HsmtSSB do not show a higher stimulatory effect than HsmtSSBwt on the DNA unwinding activity of HsmtDNA helicase. Taking into consideration that EcSSB may not stimulate HsmtDNA helicase as well as its cognate SSB [9], this result argues that the N- and C-terminal regions of HsmtSSB are not involved directly in the 8-fold stimulation of HsmtDNA helicase. However, it has been shown that EcSSB can replace T7 gp2.5 in vitro to stimulate the T7 DNA polymerase holoenzyme activity on a singly-primed ssDNA template and in strand-displacement assays (the latter also involves the function of T7 gp4 primase-helicase), but it fails to promote either coupled leading and lagging strand synthesis in vitro, or the growth of bacteriophage T7 mutants lacking the gp 2.5 gene, both of which require the coordinated function of the T7 replisome [42], [43]. Therefore, our assays may be limited in assessing biochemically the possible defects of HsmtSSB variants. In any case, one might argue that the mtDNA replication fork most likely comprises other unidentified components in addition to pol γ, mtDNA helicase and mtSSB, especially given the complexity of the myriad processes that occur in the mitochondrion [44], and the various modes of mtDNA replication that operate in vivo [45], [46], [47], which ensure appropriate mtDNA copy number and mitochondrial gene expression. Thus, physiological analysis of these and other mtSSB mutants, in addition to development of new in vitro assays that reconstitute fully the mtDNA replisome, will be informative in understanding the mechanism of mtDNA replication.

Materials and Methods

Nucleotides and nucleic acids

Unlabeled deoxy- and ribonucleotides were purchased from Amersham Bioscience. [α-32P]dATP and [γ-32P]ATP were purchased from MP Biomedicals. Recombinant M13 (10,650 nt) and pBSKS+ (2,958 nt) DNAs were prepared by standard laboratory methods. Oligodeoxynucleotides complementary to these DNAs were synthesized in an Applied Biosystems oligonucleotide synthesizer. The singly-primed M13 DNA used in DNA polymerase assays was prepared as described previously [13]. For the DNA unwinding assays, a 60-mer oligodeoxyribonucleotide (5′T(40)AGGTCGTTCGCTCCAAGCT3′) was radiolabeled at its 5′-end. The kinase reaction (50 µL) contained 50 mM Tris-HCl, pH 8.3, 10 mM MgCl2, 0.1 mM EDTA, 5 mM dithiothreitol (DTT), 0.1 mM spermidine, [γ-32P]ATP (0.66 µM, 4500 Ci/mmol), 700 pmol (as nt) of oligonucleotide, and 20 units of T4 polynucleotide kinase (New England BioLabs). Incubation was for 30 min at 37°C, and the 5′-end-labeled 60-mer oligonucleotide was purified using a Micro Bio-Spin P-30 Tris chromatography column (Bio-Rad), and annealed to pBSKS+ single-stranded plasmid DNA at 65°C for 60 min, followed by incubation at 37°C for 30 min, to generate a 20 bp double-stranded region with a 40-nt 5′-tail (the DNA unwinding substrate). The 48-mer oligodeoxynucleotide (5′GGACTATTTATTAAATATATTTAAGAACTAATTCCAGCTGAGCGCCGG3′) used in gel mobility shift assays was radiolabeled at its 5′-end as described above.

Mutagenesis and purification of HsmtSSB proteins

The HsmtSSB deletion variants were constructed by cloning of PCR fragments containing the coding region for HsmtSSBΔN, ΔC and ΔNΔC into the NdeI site of the pET11a vector. PCRs were performed using the coding region of the mature HsmtSSBwt cloned in pET11a vector as template, Pfu DNA polymerase (Stratagene) and standard laboratory methods. The oligonucleotides used for PCR mutagenesis were: 5′CCCGGGCATatgCTTGAAAGATCCCTGAATCG3′ and 5′CCCGGGCATATGCTACTCCTTCTCTTTCGTCTGG3′ for HsmtSSBΔN; 5′CCCGGGCATATGGAGTCCGAAACAACTACCAG3′ and 5′CCCGGGCATATGctaACTCAGAAATATAATATTATCAG3′ for HsmtSSBΔC; and 5′CCCGGGCATatgCTTGAAAGATCCCTGAATCG3′ and 5′CCCGGGCATATGctaACTCAGAAATATAATATTATCAG3′ for HsmtSSBΔNΔC. The underlined sequences correspond to NdeI restriction sites, and the lower case letters indicate the sites where mutations were introduced into the HsmtSSB cDNA to create new start and stop codons. BL21(DE3) cells containing pET-11a plasmid expressing HsmtSSBwt and deletion variants were grown at 37°C with aeration in L-broth containing 0.1 mg/mL of ampicillin. When the bacterial cell culture reached an optical density of 0.6 at 595 nm, isopropyl β-D-1-thiogalactopyranoside was added to 0.2 mM, and the culture was incubated further for 3 hr. Cells were harvested by centrifugation, washed in 50 mM Tris-HCl, pH 7.5, 10% sucrose (Tris-sucrose), frozen in liquid nitrogen, and stored at -80°C. All further steps were performed at 0–4°C, and all buffers contained 5 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 10 mM sodium metabisulfite, and 2 ug/mL leupeptin. The cell pellet was thawed on ice, and cells were resuspended in 1/25 volume of original cell culture in Tris-sucrose and lysed by addition of 5 X lysis buffer (1 M NaCl, 10 mM EDTA, and 10% sodium cholate – for HsmtSSBΔC purification, 7.5% n-dodecyl-β-D-maltoside instead of 10% sodium cholate) to a final 1 X concentration, followed by incubation for 30 min on ice and freezing in liquid nitrogen. After thawing on ice, the suspension was centrifuged at 17500×g for 30 min. The supernatant (soluble Fr I) was loaded onto a Blue Sepharose column equilibrated with 10 column volumes (CV) of 35 mM Tris-HCl, pH 7.5, 10% glycerol, 2 mM EDTA, 0.2 M NaCl at a packing ratio of 5–7 mg of total protein per mL of resin. The column was washed with 1 CV of equilibration buffer and 3 CV of 35 mM Tris-HCl, pH 7.5, 10% glycerol, 2 mM EDTA, 0.25 M NaSCN. The bound protein was eluted with 8 CV of a 0.4–1.2 M NaSCN linear gradient, followed by a final elution step of 1.5 M NaSCN buffer (2 CV). Fractions containing HsmtSSB were pooled (Fr II) and dialysed against buffer containing 60 mM KPO4, pH 7.6, 10% glycerol, 2 mM EDTA (Fr IIb) (for HsmtSSBΔC, dialysis buffer contained 40 mM KPO4, pH 7.6). Fr IIb was then loaded onto a phosphocellulose column equilibrated with dialysis buffer at a packing ratio of 0.5 mg of total protein per mL of resin. The column was washed with 2.5 CV of the same buffer and the proteins were eluted with 5 CV of a 60–150 mM KPO4 linear gradient, followed by a final step of 350 mM KPO4 buffer (2 CV). The HsmtSSB proteins typically elute at ∼80 mM KPO4. Pooled fractions (Fr III) were concentrated to ∼1 mg/mL of protein in a Centricon-30 spin concentrator (Amicon) treated with 5% Tween 20 (Fr IIIb). Fr IIIb was frozen in liquid nitrogen and stored at −80°C.

Purification of Hspol γ and HsmtDNA helicase

Recombinant human pol γ-α exo and pol γ-β were prepared from Sf9 and bacterial cells, respectively, as described by Oliveira and Kaguni [15]. Recombinant human mtDNA helicase was prepared from Sf9 cells, as described by Ziebarth et al. [48].

Glycerol gradient sedimentation and gel filtration

HsmtSSBwt and variants (100 µg) were layered onto preformed 12–30% glycerol gradients (10 mL) containing 35 mM Tris-HCl, pH 7.5, 100 mM NaCl, 2 mM EDTA, 5 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 10 mM sodium metabisulfite, and 2 ug/mL leupeptin. Centrifugation was at 264,000×g for 63 hrs at 4°C in a Beckman SW41 rotor. Fractions were analyzed by SDS-PAGE and Coomassie blue staining. For Superdex 75 gel filtration, 200 µg HsmtSSBwt and variants were chromatographed on a column equilibrated with the buffer described above containing 8% glycerol at a flow rate of 0.25 mL/min at 4°C. Fractions were analyzed by SDS-PAGE and Coomassie blue staining to confirm UV trace recordings. Standard protein markers used in both procedures were: bovine serum albumine (BSA, 4.85 S, RS  = 3.61 nm), carbonic anhydrase (CA, 3.23 S, RS  = 2.43 nm) and lysozyme (LYS, 1.91 S, RS  = 1.5 nm). The data were plotted as S value versus fraction number to obtain a sedimentation coefficient, and as RS value versus the peak of protein elution in mL to obtain the Stokes radii for the HsmtSSB proteins. The native molecular mass of the proteins were calculated using the formula: MW  = 3.909 x S value x RS.

ssDNA binding and gel mobility shift assay

Reaction mixtures (20 µL) contained 20 mM Tris-HCl, pH 7.5, 1 mM DTT, 4 mM MgCl2, 50 mM NaCl, 36 fmol 5′-end-labeled 48-mer, and the indicated amounts of the HsmtSSB proteins. Incubation was at 20°C for 10 min. Samples were processed and electrophoresed in 6% native polyacrylamide gels. The amounts of shifted and free oligonucleotide were quantitated as follows: % ssDNA bound  =  (VS/(VS+VF)) ×100, where VS represents the volume of the shifted and VF the volume of unshifted oligonucleotide in the sample lane of interest.

DNA polymerase γ stimulation assays

Reaction mixtures (50 µL) contained 50 mM Tris-HCl, pH 8.5, 4 mM MgCl2, 400 µg/ml bovine serum albumin, 10 mM DTT, 20–100 mM KCl, 20 µM each dGTP, dATP, dCTP and dTTP, [α-32P]dATP (2 µCi), 10 µM (as nt) singly-primed recombinant M13 DNA, 10 ng Hspol γ-α exo Fr IV, 48 ng Hspol γ-β Fr III, and the indicated amounts of HsmtSSB proteins. Incubation was at 37°C for 30 min. Samples were processed and nucleotide incorporation was quantitated in a liquid scintillation counter.

DNA unwinding assays

Reaction mixtures (50 µL) contained 20 mM Tris-HCl, pH 7.5, 10% glycerol, 500 µg/mL bovine serum albumin, 10 mM DTT, 4 mM MgCl2, 3 mM ATP, 50 mM KCl (unless stated otherwise), 0.4 nM of DNA unwinding substrate, 3.5 nM of mtDNA helicase (as hexamer), and the indicated concentrations of HsmtSSB proteins. The reactions were pre-incubated at 37°C for 10 min prior to the addition of the helicase. Once the helicase was added, the reactions were incubated further at 37°C for 30 min and then stopped by the addition of 5 µL of 10 X stop solution (6% SDS, 100 mM EDTA, pH 8.0), followed by 5 µL of 10 X loading buffer (50% glycerol, 0.25% bromophenol blue). DNA products were fractionated from substrate by electrophoresis in a 22% polyacrylamide gel (59∶1 acrylamide/bisacrylamide) using 1 X TBE (90 mM Tris-HCl-borate, 2 mM EDTA) at 600 V for ∼30 min. After electrophoresis, the gel was dried under vacuum with heat, and exposed to a Phosphor Screen (Amersham Biosciences). The data were analyzed by scanning the Phosphor Screen using a Storm 820 Scanner (Amersham Biosciences), and the volume of each band were determined, and background subtracted, by computer integration analysis using ImageQuant version 5.2 software (Amersham Biosciences). For all reactions, DNA unwinding is defined as the fraction of radiolabeled DNA species that is single-stranded (product), as follows: % unwinding  =  (VP/(VS + VP)) ×100, where VP represents the volume of the product and VS the volume of unreacted substrate in the sample lane of interest.

Acknowledgments

We thank Dr. Yuichi Matsushima for construction of plasmids carrying the genes for the terminal deletion mutants of HsmtSSB.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: This work was supported by National Institutes of Health Grant GM45295. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Shereda RD, Kozlov AG, Lohman TM, Cox MM, Keck JL. SSB as an organizer/mobilizer of genome maintenance complexes. Crit Rev Biochem Mol Biol. 2008;43:289–318. doi: 10.1080/10409230802341296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Shamoo Y, Friedman AM, Parsons MR, Konigsberg WH, Steitz TA. Crystal structure of a replication fork single-stranded DNA binding protein (T4 gp32) complexed to DNA. Nature. 1995;376:362–366. doi: 10.1038/376362a0. [DOI] [PubMed] [Google Scholar]
  • 3.Yang C, Curth U, Urbanke C, Kang C. Crystal structure of human mitochondrial single-stranded DNA binding protein at 2.4 A resolution. Nat Struct Biol. 1997;4:153–157. doi: 10.1038/nsb0297-153. [DOI] [PubMed] [Google Scholar]
  • 4.Raghunathan S, Ricard CS, Lohman TM, Waksman G. Crystal structure of the homo-tetrameric DNA binding domain of Escherichia coli single-stranded DNA-binding protein determined by multiwavelength x-ray diffraction on the selenomethionyl protein at 2.9-A resolution. Proc Natl Acad Sci U S A. 1997;94:6652–6657. doi: 10.1073/pnas.94.13.6652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bochkarev A, Pfuetzner RA, Edwards AM, Frappier L. Structure of the single-stranded-DNA-binding domain of replication protein A bound to DNA. Nature. 1997;385:176–181. doi: 10.1038/385176a0. [DOI] [PubMed] [Google Scholar]
  • 6.Hollis T, Stattel JM, Walther DS, Richardson CC, Ellenberger T. Structure of the gene 2.5 protein, a single-stranded DNA binding protein encoded by bacteriophage T7. Proc Natl Acad Sci U S A. 2001;98:9557–9562. doi: 10.1073/pnas.171317698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gray MW, Burger G, Lang BF. Mitochondrial evolution. Science. 1999;283:1476–1481. doi: 10.1126/science.283.5407.1476. [DOI] [PubMed] [Google Scholar]
  • 8.Farr CL, Wang Y, Kaguni LS. Functional interactions of mitochondrial DNA polymerase and single-stranded DNA-binding protein. Template-primer DNA binding and initiation and elongation of DNA strand synthesis. J Biol Chem. 1999;274:14779–14785. doi: 10.1074/jbc.274.21.14779. [DOI] [PubMed] [Google Scholar]
  • 9.Korhonen JA, Gaspari M, Falkenberg M. TWINKLE Has 5′ ->3′ DNA helicase activity and is specifically stimulated by mitochondrial single-stranded DNA-binding protein. J Biol Chem. 2003;278:48627–48632. doi: 10.1074/jbc.M306981200. [DOI] [PubMed] [Google Scholar]
  • 10.Korhonen JA, Pham XH, Pellegrini M, Falkenberg M. Reconstitution of a minimal mtDNA replisome in vitro. EMBO J. 2004;23:2423–2429. doi: 10.1038/sj.emboj.7600257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Maier D, Farr CL, Poeck B, Alahari A, Vogel M, et al. Mitochondrial single-stranded DNA-binding protein is required for mitochondrial DNA replication and development in Drosophila melanogaster. Mol Biol Cell. 2001;12:821–830. doi: 10.1091/mbc.12.4.821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Van Dyck E, Foury F, Stillman B, Brill SJ. A single-stranded DNA binding protein required for mitochondrial DNA replication in S. cerevisiae is homologous to E. coli SSB. EMBO J. 1992;11:3421–3430. doi: 10.1002/j.1460-2075.1992.tb05421.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Farr CL, Matsushima Y, Lagina AT, 3rd, Luo N, Kaguni LS. Physiological and biochemical defects in functional interactions of mitochondrial DNA polymerase and DNA-binding mutants of single-stranded DNA-binding protein. J Biol Chem. 2004;279:17047–17053. doi: 10.1074/jbc.M400283200. [DOI] [PubMed] [Google Scholar]
  • 14.Ruhanen H, Borrie S, Szabadkai G, Tyynismaa H, Jones AW, et al. Mitochondrial single-stranded DNA binding protein is required for maintenance of mitochondrial DNA and 7S DNA but is not required for mitochondrial nucleoid organisation. Biochim Biophys Acta. 2010;1803:931–939. doi: 10.1016/j.bbamcr.2010.04.008. [DOI] [PubMed] [Google Scholar]
  • 15.Oliveira MT, Kaguni LS. Comparative purification strategies for Drosophila and human mitochondrial DNA replication proteins: DNA polymerase gamma and mitochondrial single-stranded DNA-binding protein. Methods Mol Biol. 2009;554:37–58. doi: 10.1007/978-1-59745-521-3_3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Curth U, Urbanke C, Greipel J, Gerberding H, Tiranti V, et al. Single-stranded-DNA-binding proteins from human mitochondria and Escherichia coli have analogous physicochemical properties. Eur J Biochem. 1994;221:435–443. doi: 10.1111/j.1432-1033.1994.tb18756.x. [DOI] [PubMed] [Google Scholar]
  • 17.Kozlov AG, Cox MM, Lohman TM. Regulation of single-stranded DNA binding by the C termini of Escherichia coli single-stranded DNA-binding (SSB) protein. J Biol Chem. 2010;285:17246–17252. doi: 10.1074/jbc.M110.118273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lim SE, Longley MJ, Copeland WC. The mitochondrial p55 accessory subunit of human DNA polymerase gamma enhances DNA binding, promotes processive DNA synthesis, and confers N-ethylmaleimide resistance. J Biol Chem. 1999;274:38197–38203. doi: 10.1074/jbc.274.53.38197. [DOI] [PubMed] [Google Scholar]
  • 19.Thommes P, Farr CL, Marton RF, Kaguni LS, Cotterill S. Mitochondrial single-stranded DNA-binding protein from Drosophila embryos. Physical and biochemical characterization. J Biol Chem. 1995;270:21137–21143. doi: 10.1074/jbc.270.36.21137. [DOI] [PubMed] [Google Scholar]
  • 20.Tomaska L, Nosek J, Kucejova B. Mitochondrial single-stranded DNA-binding proteins: in search for new functions. Biol Chem. 2001;382:179–186. doi: 10.1515/BC.2001.025. [DOI] [PubMed] [Google Scholar]
  • 21.Kornberg A, Baker TA. New York: Freeman.; 1992. DNA replication. p. xiv, 931 s. p. [Google Scholar]
  • 22.Burke RL, Alberts BM, Hosoda J. Proteolytic removal of the COOH terminus of the T4 gene 32 helix-destabilizing protein alters the T4 in vitro replication complex. J Biol Chem. 1980;255:11484–11493. [PubMed] [Google Scholar]
  • 23.Kim YT, Richardson CC. Acidic carboxyl-terminal domain of gene 2.5 protein of bacteriophage T7 is essential for protein-protein interactions. J Biol Chem. 1994;269:5270–5278. [PubMed] [Google Scholar]
  • 24.Curth U, Genschel J, Urbanke C, Greipel J. In vitro and in vivo function of the C-terminus of Escherichia coli single-stranded DNA binding protein. Nucleic Acids Res. 1996;24:2706–2711. doi: 10.1093/nar/24.14.2706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kim YT, Tabor S, Bortner C, Griffith JD, Richardson CC. Purification and characterization of the bacteriophage T7 gene 2.5 protein. A single-stranded DNA-binding protein. J Biol Chem. 1992;267:15022–15031. [PubMed] [Google Scholar]
  • 26.Krassa KB, Green LS, Gold L. Protein-protein interactions with the acidic COOH terminus of the single-stranded DNA-binding protein of the bacteriophage T4. Proc Natl Acad Sci U S A. 1991;88:4010–4014. doi: 10.1073/pnas.88.9.4010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Hyland EM, Rezende LF, Richardson CC. The DNA binding domain of the gene 2.5 single-stranded DNA-binding protein of bacteriophage T7. J Biol Chem. 2003;278:7247–7256. doi: 10.1074/jbc.M210605200. [DOI] [PubMed] [Google Scholar]
  • 28.He ZG, Rezende LF, Willcox S, Griffith JD, Richardson CC. The carboxyl-terminal domain of bacteriophage T7 single-stranded DNA-binding protein modulates DNA binding and interaction with T7 DNA polymerase. J Biol Chem. 2003;278:29538–29545. doi: 10.1074/jbc.M304318200. [DOI] [PubMed] [Google Scholar]
  • 29.Shereda RD, Reiter NJ, Butcher SE, Keck JL. Identification of the SSB binding site on E. coli RecQ reveals a conserved surface for binding SSB's C terminus. J Mol Biol. 2009;386:612–625. doi: 10.1016/j.jmb.2008.12.065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Marintcheva B, Marintchev A, Wagner G, Richardson CC. Acidic C-terminal tail of the ssDNA-binding protein of bacteriophage T7 and ssDNA compete for the same binding surface. Proc Natl Acad Sci U S A. 2008;105:1855–1860. doi: 10.1073/pnas.0711919105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wold MS. Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism. Annu Rev Biochem. 1997;66:61–92. doi: 10.1146/annurev.biochem.66.1.61. [DOI] [PubMed] [Google Scholar]
  • 32.Yakubovskaya E, Chen Z, Carrodeguas JA, Kisker C, Bogenhagen DF. Functional human mitochondrial DNA polymerase gamma forms a heterotrimer. J Biol Chem. 2006;281:374–382. doi: 10.1074/jbc.M509730200. [DOI] [PubMed] [Google Scholar]
  • 33.Lee YS, Kennedy WD, Yin YW. Structural insight into processive human mitochondrial DNA synthesis and disease-related polymerase mutations. Cell. 2009;139:312–324. doi: 10.1016/j.cell.2009.07.050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wernette CM, Kaguni LS. A mitochondrial DNA polymerase from embryos of Drosophila melanogaster. Purification, subunit structure, and partial characterization. J Biol Chem. 1986;261:14764–14770. [PubMed] [Google Scholar]
  • 35.Wang Y, Kaguni LS. Baculovirus expression reconstitutes Drosophila mitochondrial DNA polymerase. J Biol Chem. 1999;274:28972–28977. doi: 10.1074/jbc.274.41.28972. [DOI] [PubMed] [Google Scholar]
  • 36.Fan L, Kaguni LS. Multiple regions of subunit interaction in Drosophila mitochondrial DNA polymerase: three functional domains in the accessory subunit. Biochemistry. 2001;40:4780–4791. doi: 10.1021/bi010102h. [DOI] [PubMed] [Google Scholar]
  • 37.Williams AJ, Kaguni LS. Stimulation of Drosophila mitochondrial DNA polymerase by single-stranded DNA-binding protein. J Biol Chem. 1995;270:860–865. doi: 10.1074/jbc.270.2.860. [DOI] [PubMed] [Google Scholar]
  • 38.Lee YS, Lee S, Demeler B, Molineux IJ, Johnson KA, et al. Each monomer of the dimeric accessory protein for human mitochondrial DNA polymerase has a distinct role in conferring processivity. J Biol Chem. 2009. [DOI] [PMC free article] [PubMed]
  • 39.Luo N, Kaguni LS. Mutations in the spacer region of Drosophila mitochondrial DNA polymerase affect DNA binding, processivity, and the balance between Pol and Exo function. J Biol Chem. 2005;280:2491–2497. doi: 10.1074/jbc.M411447200. [DOI] [PubMed] [Google Scholar]
  • 40.Hackenbrock CR. Chemical and physical fixation of isolated mitochondria in low-energy and high-energy states. Proc Natl Acad Sci U S A. 1968;61:598–605. doi: 10.1073/pnas.61.2.598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Srere PA. The Infrastructure of the Mitochondrial Matrix. Trends in Biochemical Sciences. 1980;5:120–121. [Google Scholar]
  • 42.Nakai H, Richardson CC. The effect of the T7 and Escherichia coli DNA-binding proteins at the replication fork of bacteriophage T7. J Biol Chem. 1988;263:9831–9839. [PubMed] [Google Scholar]
  • 43.Kim YT, Richardson CC. Bacteriophage T7 gene 2.5 protein: an essential protein for DNA replication. Proc Natl Acad Sci U S A. 1993;90:10173–10177. doi: 10.1073/pnas.90.21.10173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wallace DC, Fan W. Energetics, epigenetics, mitochondrial genetics. Mitochondrion. 2010;10:12–31. doi: 10.1016/j.mito.2009.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Clayton DA. Replication of animal mitochondrial DNA. Cell. 1982;28:693–705. doi: 10.1016/0092-8674(82)90049-6. [DOI] [PubMed] [Google Scholar]
  • 46.Holt IJ, Lorimer HE, Jacobs HT. Coupled leading- and lagging-strand synthesis of mammalian mitochondrial DNA. Cell. 2000;100:515–524. doi: 10.1016/s0092-8674(00)80688-1. [DOI] [PubMed] [Google Scholar]
  • 47.Yang MY, Bowmaker M, Reyes A, Vergani L, Angeli P, et al. Biased incorporation of ribonucleotides on the mitochondrial L-strand accounts for apparent strand-asymmetric DNA replication. Cell. 2002;111:495–505. doi: 10.1016/s0092-8674(02)01075-9. [DOI] [PubMed] [Google Scholar]
  • 48.Ziebarth TD, Farr CL, Kaguni LS. Modular architecture of the hexameric human mitochondrial DNA helicase. J Mol Biol. 2007;367:1382–1391. doi: 10.1016/j.jmb.2007.01.079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–4882. doi: 10.1093/nar/25.24.4876. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES