The Varicella-Zoster Virus ORFS/L (ORF0) Gene Is Required for Efficient Viral Replication and Contains an Element Involved in DNA Cleavage

Abstract

The genome of varicella-zoster virus (VZV), a human alphaherpesvirus, consists of two unique regions, unique long (U_L) and unique short (U_S), each of which is flanked by inverted repeats. During replication, four isomers of the viral DNA are generated which are distinguished by the relative orientations of U_L and U_S. VZV virions predominantly package two isomeric forms of the genome that have a fixed orientation of U_L. An open reading frame (ORF) of unknown function, ORFS/L, also referred to as ORF0, is located at the extreme terminus of U_L, directly adjacent to the a-like sequences, which are known to be involved in cleavage and packaging of viral DNA. We demonstrate here that the ORFS/L protein localizes to the Golgi network in infected and transfected cells. Furthermore, we were able to demonstrate that deletion of the predicted ORFS/L gene is lethal, while retention of the N-terminal 28 amino acid residues resulted in viable yet replication-impaired virus. The growth defect was only partially attributable to the expression of the ORFS/L product, suggesting that the 5′ region of ORFS/L contains a sequence element crucial for cleavage/packaging of viral DNA. Consequently, mutations introduced into the extreme 5′ terminus of ORFS/L resulted in a defect in DNA cleavage, indicating that the region is indeed involved in the processing of viral DNA. Since the sequence element has no counterpart at the other end of U_L, we concluded that our results can provide an explanation for the almost exclusive orientation of the U_L seen in packaged VZV DNA.

Varicella-zoster virus ([VZV] Human Herpesvirus 3), is a highly cell-associated alphaherpesvirus that causes chicken pox (varicella) upon infection of naïve individuals (2). During primary infection, VZV is able to establish latency in cranial nerves, as well as dorsal root and autonomic ganglia, where it remains dormant until a reactivation event occurs (11). Reactivation of VZV occurs primarily in elderly or immunocompromised individuals and results in the development of shingles (herpes zoster), which is often associated with severe pain and postherpetic neuralgia (1).

The VZV genome, the smallest among the human herpesviruses, is approximately 125 kbp in size and encodes at least 70 unique open reading frames (ORFs) (1). As has been reported for all alphaherpesviruses, the VZV genome consists of two unique regions, unique long (U_L) and unique short (U_S), each flanked by inverted repeat regions (TR_L, IR_L, TR_S, and IR_S) (9). In contrast to herpes simplex virus type 1 (HSV-1), the prototype alphaherpesvirus, VZV contains only very short repeats (88 bp) on either end of U_L, characteristic of members of the Varicellovirus genus (6). During alphaherpesvirus replication, four isomers of viral DNA are generated which can be distinguished by the orientation of U_L and U_S relative to each other. While all four possible isomers of HSV-1 DNA are packaged in virions as equimolar populations, virions produced by VZV and other varicelloviruses, such as equine herpesvirus type 1 (EHV-1), contain predominantly only two of the four possible isomeric forms of the genome (6, 10, 12, 15, 23). It was shown by Southern blot analysis of VZV virion DNA that inversion of the U_L region is rare and occurs in only approximately 5% of cases (6), which also may be attributed to a rare circular configuration of the genome within the virion (14). A previous report on EHV-1 suggested that inversion of the U_L region in infected cells is common but that packaging occurs in a directional manner (23). For both VZV and EHV-1, the reason for the more-or-less exclusive orientation of U_L within the virion still remains unknown.

The organization of the VZV genome is similar to that of HSV-1, and over 90% of the VZV ORFs have counterparts in the HSV-1 genome (1, 13). One of the genes with a predicted HSV-1 homologue is ORFS/L, also referred to as ORF0. ORFS/L is predicted to encode a tail-anchored 157-amino-acid (aa) residue type 2 transmembrane protein and was discovered by Kemble and coworkers (13). The gene is located at the very beginning of U_L, directly adjacent to the a-like sequences that contain PacI and PacII sites crucial for the cleavage and packaging of concatameric VZV DNA (Fig. 1) (13, 20). Although no function has yet been attributed to the ORFS/L (ORF0) gene or its product, bioinformatic analysis of the VZV genome indicated that it represents a homologue of HSV-1 UL56 (RefSeq accession no. NC_001348) (7, 8). While UL56 is dispensable for HSV-1 replication in vitro, it plays an important role in pathogenicity in vivo (3, 21). Little is known about the molecular mechanism of UL56 function in the case of HSV-1, but UL56 orthologues are specified by most members of the Alphaherpesvirinae subfamily (26). It was shown that the HSV-2 UL56 product localizes to the Golgi network and interacts with KIF1A, a kinesin motor protein, suggesting a role in vesicular trafficking (16, 17).

FIG. 1.

Overview of the VZV ORFS/L genomic region and the mutants generated. (A) Schematic representation of the VZV genome with a focus on the terminal region containing ORFS/L. Scale bars provide an accurate measure of the genome and the expanded region. (B) Overview of the mutants generated with mutations in the ORFS/L region. A cross indicates the deletion of the corresponding region. Black arrows indicate the loci of stop codon or HA tag insertion.

A previous study of Kemble and coworkers also addressed the localization of the ORFS/L protein using a rabbit polyclonal antibody. It was reported that the ORFS/L product was found exclusively in the cytoplasm, which is contradictory to the findings for the HSV-2 orthologue and also to the localization of the ORFS/L protein based on in silico predictions from the primary sequence (13). ORFS/L of the P-Oka strain was recently shown to be unglycosylated but present in the virion (18). Furthermore, ORFS/L expression was detected in skin lesions of individuals, as well as neurons of dorsal root ganglia, during virus reactivation (13). In addition, the deletion of aa 29 to aa 157 of ORFS/L was shown to have an effect on viral replication in vitro and in vivo in the SCID-hu mouse model with thymus-liver implants. In this study, a virus-encoded luciferase reporter system was used to evaluate the growth properties of several bacterial artificial chromosome (BAC)-derived VZV mutants (28). However, it has remained unknown whether the observed growth defect is dependent on ORFS/L gene function or is due to the deletion of another critical sequence element.

In this study, we sought to perform a systematic analysis of ORFS/L sequences. We were able to demonstrate that the ORFS/L protein localizes to the Golgi network in infected and transfected cells, providing further evidence for its predicted structure as a tail-anchored type 2 transmembrane protein and lending further support to the notion that it is the orthologue of HSV UL56. In addition, we showed that the ORFS/L gene product is important for efficient VZV replication in vitro. However, we also identified a 5′ region of the predicted ORFS/L that is essential for replication and plays a role in cleavage of viral DNA, as previously suggested by Davison and colleagues (6, 7). Since this essential region is not present at the opposite end of U_L, it could provide an explanation for the almost exclusive packaging in VZV virions of two viral DNA isomers with an invariable U_L orientation.

MATERIALS AND METHODS

Cells and viruses.

Human melanoma cells (MeWo) were grown and maintained in growth medium (minimal essential medium [MEM] supplemented with 10% fetal bovine serum [FBS], 100 U/ml penicillin, and 0.1 mg/ml streptomycin) at 37°C under a 5% CO₂ atmosphere (5). Wild-type and mutant viruses were reconstituted, grown, and amplified on MeWo cells by cocultivation of infected with uninfected cells at a ratio of 1:2 to 1:5. Virus stocks were frozen in growth medium supplemented with 8% dimethyl sulfoxide (DMSO) and stored in liquid nitrogen.

Generation of ORFS/L mutants and revertants via en passant mutagenesis.

Mutants with a deletion of ORFS/L (Δaa1-157), a start codon knockout (aa1stop) in which the ATG was replaced by a stop codon (TAG), a C-terminal deletion (Δaa34-157), a C-terminal hemagglutinin (HA)-tagged ORFS/L (S/L_cHA), or a stop codon insertion at amino acid position 3 (aa3stop, TTT to TAA) or 34 (aa34stop, TAC to TAG) were generated based on pP-Oka, an infectious BAC clone of the P-Oka strain (24), via two-step Red-mediated en passant mutagenesis as described previously (25). The HA tag was also inserted at the C terminus of the aa1stop, aa3stop, and aa34stop mutant viruses as described above, resulting in aa1stop-cHA, aa3stop-cHA, and aa34stop-HA. In order to generate revertants of the respective ORFS/L mutants, a transfer vector was generated. Briefly, a region containing ORFS/L and flanking sequences was amplified from pP-Oka by PCR, cloned into the pcDNA3.1 TOPO vector (Invitrogen), and termed prORFS/L. The aphAI-I-SceI cassette was amplified from pEPkan-SII (25) and inserted into prORFS/L using a unique EcoRI restriction site within ORFS/L, resulting in plasmid prORFS/L-aphAI-I-SceI. The entire rORFS/L-aphAI-I-SceI cassette was amplified by PCR and used for two-step Red-mediated mutagenesis. Revertant viruses of Δaa1-157, aa1stop, and Δaa34-157 were termed Δaa1-157-rev, aa1stop-rev, and Δaa34-157-rev, respectively. All clones were confirmed by DNA sequencing of the ORFS/L region (Fig. 1A), as well as multiple restriction fragment length polymorphism analyses (RFLP), to ensure the integrity of the genome (data not shown). All oligonucleotides used are given in Table 1.

TABLE 1.

Primers used for cloning and mutagenesis

Construct	Direction	Sequence (5′ → 3′)a
Δaa1-157	Forward	CCCACCTCCCCGCGCGTTTGCGGGGCGACCATCGGGGGGGTGAAACTACTGTCCGGAAGGGTAGGGATAACAGGGTAATCGATTTATTC
	Reverseerse	GCAAGCGAGAATAAATACCTTCCCCTTCCGGACAGTAGTTTCACCCCCCCGATGGTCGCCCCGCGCCAGTGTTACAACCAATTAACC
Δaa1stop	Forward	CCCCACCTCCCCGCGCGTTTGCGGGGCGACCATCGGGGGGGTAGGGGATTTTTTGCCGGGAAACCTAGGGATAACAGGGTAATCGATTTA
	Reverse	GTTAAAGGCTGGCGGGGGGGGTTTCCCGGCAAAAAATCCCCTACCCCCCCGATGGTCGCCCCGCGCCAGTGTTACAACCAATTAACCAA
Δaa34-157	Forward	GCGTCCACCCCTCGTTTACTGCTCGGATGGCGACCGTGCACTGAAACTACTGTCCGGAAGGGGTAGGGATAACAGGGTAATCGATTT
	Reverse	GCAAGCGAGAATAAATACCTTCCCCTTCCGGACAGTAGTTTCAGTGCACGGTCGCCATCCGAGCGCCAGTGTTACAACCAATTAACC
Δaa3stop	Forward	CCCGCGCGTTTGCGGGGCGACCATCGGGGGGGATGGGATAATTTGCCGGGAAACCCCCTAGGGATAACAGGGTAATCGATTT
	Reverse	GGGTTTTGTTAAAGGCTGGCGGGGGGGGTTTCCCGGCAAATTATCCCATCCCCCCCGATGGTCGCCGCCAGTGTTACAACCAATTAACC
Δaa34stop	Forward	GTCCACCCCTCGTTTACTGCTCGGATGGCGACCGTGCACTAGTCCCGCCGACCTGGGACCCTAGGGATAACAGGGTAATCGATTT
	Reverse	GACGACGTGAGGGTGACCGGCGGGGTCCCAGGTCGGCGGGACTAGTGCACGGTCGCCATCCGGCCAGTGTTACAACCAATTAACC
S/L_cHA	Forward	CCGTTTTTCCCGAGGAACCTCCCAACTCAACTACATATCCGTATGATGTGCCGGATTATGCGTGAAACTAGGGATAACAGGGTAATCGAT
	Reverse	GAATAAATACCTTCCCCTTCCGGACAGTAGTTTCACGCATAATCCGGCACATCATACGGATATGTAGGCCAGTGTTACAACCAATTAACC
prORFS/L	Forward	AGCGACCCCACCTCCCC
	Reverse	CGACAAGCTGCAAGCGAGAA
prORFS/L-aphAI-I-SceI	Forward	CTAAGAATTCGCAAATGCTGTGTACCGGCTAGGGATAACAGGGTAATCGATTT
	Reverse	TTGCGAATTCTTAGAAAAGCCAGCTGAAGTCTGGCCAGTGTTACAACCAATTAACC
pCDNA-ORFS/L	Forward	ATGGGATTTTTTGCCGGG
	Reverse	TGTAGTTGAGTTGGGAGGTTCCTC
Southern probe VZV	Forward	GACGCACCGGGGTCATC
terminus	Reverse	TGTAGTTGAGTTGGGAGGTTCCTC

^aUnderlined sequences indicate restriction enzyme sites. Bold indicates mutated sequences.

Reconstitution of VZV from BAC DNA.

BAC DNA used for transfection was isolated with the Qiagen Midiprep system according to the manufacturer's (Qiagen) instructions. Subsequently, MeWo cells were transfected with Lipofectamine 2000 (Invitrogen) as described previously (24). Briefly, 1 μg BAC DNA was cotransfected with 200 ng pCMV62, a plasmid which contains the VZV immediate-early (IE) gene ORF62 under the control of the major IE promoter of human cytomegalovirus (CMV) (kindly provided by Kip Kinchington, University of Pittsburgh Medical School). The DNA-Lipofectamine solution was added to the cells and incubated for 4 h. The transfection medium was then replaced with growth medium. The resulting viruses were termed vΔaa1-157, vΔaa1-157-rev, vaa1stop, vaa1stop-rev, vΔaa34-157, vΔaa34-157-rev, vaa3stop, vaa34stop, vS/L_cHA, vaa1stop-cHA, vaa3stop-cHA, and vaa34stop-cHA.

Multistep growth kinetics and plaque size assay.

One million MeWo cells were inoculated with 100 PFU of cell-associated viruses. For multistep growth kinetics, infected cells were trypsinized at 24, 48, 72, 96, or 120 h postinfection (p.i.) and titrated in 10-fold dilutions with fresh MeWo cells, and the number of plaques was determined by indirect immunofluorescence (IIF) using an anti-gB antibody (United States Biological). Three independent experiments were performed in triplicate. For plaque size assays, cells were fixed 6 days p.i. and stained and plaques imaged with a digital camera (Zeiss Axiovert 25 and Axiocam). Areas of 60 individual plaques were evaluated with Axiovision software (Zeiss).

Generation of ORFS/L expression plasmids.

ORFS/L was amplified from pP-Oka and inserted into pcDNA3.1/V5-His TOPO vector (Invitrogen). The resulting plasmid was sequenced and termed pORFS/L-His. It was then transfected with Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen).

Indirect immunofluorescence labeling and confocal microscopy.

MeWo cells were fixed with 3% paraformaldehyde (PFA) and permeabilized with 0.1% saponin at 48 h after infection or transfection. Cells were stained with mouse monoclonal anti-GM130 antibody (BD Transduction Laboratories), rabbit polyclonal anti-His antibodies (Genscript Cooperation), or rabbit polyclonal anti-HA antibodies (Zymed Laboratory) at 1:200 dilutions. Secondary antibodies, including Alexa Fluor 568-conjugated goat anti-mouse and Alexa Fluor 488-conjugated goat anti-rabbit (Molecular probes), were diluted 1:1,000. Cells were washed with phosphate-buffered saline (PBS) and mounted with 4′,6′-diamidino-2-phenylindole (DAPI) Vectashield (Vector Laboratories). Cells were examined using an SP5 confocal microscope system (Leica). Collected images were arranged using Photoshop 7.0 (Adobe).

Western blot assay.

MeWo cells were infected with vP-Oka, vS/L_cHA, vaa1stop-cHA, vaa3stop-cHA, or vaa34stop-cHA. Infected cells were harvested after infection for 72 to 96 h, separated by sodium dodecyl sulfate (SDS)-15% polyacrylamide gel electrophoresis (PAGE), and analyzed by Western blotting using a polyclonal rabbit anti-HA (Zymed Laboratory) or a monoclonal rabbit anti-β-actin (Cell Signaling Technology) antibody, each at a 1:1,000 dilution. Target proteins were visualized using an anti-rabbit peroxidase-conjugated antibody (Sigma-Aldrich) and enhanced chemiluminescence (ECL; Pharmacia-Amersham), and the signal was recorded on X-ray film (Amersham Biosciences) as described previously (22).

Cleavage assay.

Ten million MeWo cells were infected with 1 × 10⁴ PFU of vP-Oka, vaa1stop, vaa1stop-rev, vaa3stop, or vaa34stop, harvested when complete cytopathic effect was observed (72 h for the wild type and 96 h for vaa1stop), and documented via bright-field microscopy. Cells were washed with ice-cold PBS and lysed in buffer A (10 mM Tris, pH 7.4, 10 mM NaCl, 3 mM MgCl₂, 0.5% NP-40). Either purified nuclei or whole-cell lysates were digested with proteinase K (Qiagen) in the presence of 1% SDS and 5 mM EDTA, and DNA was purified by phenol-chloroform extraction (22). Equivalent amounts of purified nuclear or whole-cell DNA were digested with BamHI overnight and separated by agarose gel electrophoresis. Southern blot analysis allowed the detection of VZV terminal fragments using a digoxigenin (DIG)-labeled probe, generated with a PCR DIG synthesis kit (Roche) according to the manufacturer's instructions. The oligonucleotides used for amplification are given in Table 1. Southern blot signals were detected by chemiluminescence as recorded with a ChemiGenius bioimaging system and quantified with GeneTool software (Syngene, Cambridge, United Kingdom).

RESULTS

Analysis of ORFS/L in infected cells.

ORFS/L, predicted to encode a protein of 157 aa in length, harbors two alternative start codons that could initiate translation at aa 29 or aa 51, respectively. In order to identify protein species generated by the ORFS/L open reading frame, we inserted an HA tag at the C terminus (pS/L_cHA) in pP-Oka, an infectious BAC clone of the P-Oka strain (Fig. 1A and B) (24). Multistep growth kinetics and plaque size assays demonstrated that S/L_cHA virus (vS/L_cHA) is capable of replicating with kinetics comparable to those of parental BAC-derived vP-Oka, indicating that HA tag insertion had no effect on viral replication in vitro (Fig. 2 A and B). Western blot analysis of vS/L_cHA-infected MeWo cells revealed that ORFS/L is expressed as a single species of about 18 kDa, corresponding well to the predicted molecular mass of the full-length, 157-aa protein (Fig. 2C).

FIG. 2.

Growth properties of vS/L_cHA and size determination of ORFS/L. (A) Multistep growth kinetics of vS/L_cHA and vP-Oka. Shown are the means and standard errors (error bars) of the results of three independent experiments. (B) Plaque size measurements of vS/L_cHA and vP-Oka. Shown are relative average plaque areas of 60 individual plaques with standard deviations (error bars), with the sizes of vP-Oka plaques set at 100%. (C) Western blot analysis of cells infected with vP-Oka (lane 1) or vS/L_cHA (lane 2). The arrow indicates the full-length ORFS/L protein, which has the predicted molecular mass.

ORFS/L localizes to the trans-Golgi network in infected and transfected cells.

To determine the subcellular localization of ORFS/L in VZV-infected cells, we infected MeWo cells with vS/L_cHA. Confocal microscopy revealed that ORFS/L colocalizes with GM130, a marker for the Golgi apparatus, in infected MeWo cells (Fig. 3 A, upper panel). ORFS/L also localized to the Golgi network in virus-induced syncytia, as well as adjacent infected cells (Fig. 3A, middle panel). In addition to that, ORFS/L was also localized to the nuclear envelope upon syncytium formation (Fig. 3A, middle and lower panels). To address the question of whether the localization of ORFS/L to the Golgi network is dependent on other viral proteins, we determined the localization of ORFS/L in transfected cells. MeWo cells were transfected with pcDNA-ORFS/L-His. Similar to the situation in infected cells, ORFS/L was localized to the Golgi network after expression of the His-tagged protein under a strong herpesvirus (CMV-IE) promoter. We concluded, therefore, that the localization of the ORFS/L protein to the Golgi apparatus is not dependent on the presence of other viral proteins (Fig. 3B) and that its presence at cellular membranes is consistent with in silico predictions suggesting that ORFS/L represents an orthologue of HSV-1 UL56.

FIG. 3.

Localization of ORFS/L in infected and transfected cells. (A) Localization of ORFS/L (green) is shown, along with GM130 (red), a marker for the Golgi apparatus, and DAPI (blue), for single infected MeWo cells (upper panels) or in syncytia (middle panels). The lower panels show a focus on the nuclei within a syncytium that shows colocalization of ORFS/L protein with the nuclear envelope. Scale bars correspond to 30 μm (upper panels) and 100 μm (middle panels). (B) MeWo cells were transfected with expression plasmid pORFS/L-His and analyzed 48 h after transfection. ORFS/L (green) and GM130 (red) were detected with the indicated antibodies. The transfected cells are representative of the cell population. Scale bar corresponds to 20 μm.

Deletion of the entire ORFS/L is lethal for VZV replication in vitro.

Previously, a recombinant virus containing a deletion of the C-terminal 129 aa of the 157-aa protein downstream of the second start codon of ORFS/L was reported to have an effect on viral replication in vitro and in vivo (28). To confirm the role of ORFS/L in VZV replication, we deleted the entire predicted ORF (aa 1 to aa 157), corresponding to nucleotide positions 88 to 558 of pP-Oka (Fig. 1) (24). In addition, a revertant BAC clone (pΔaa1-157-rev) was generated in which the original ORFS/L sequence was restored. Subsequently, the constructs were transfected into MeWo cells, resulting in the reconstitution of recombinant viruses vΔaa1-157 and vΔaa1-157-rev. Upon virus reconstitution, two independent vΔaa1-157 clones exhibited a severe replication defect, while the revertant virus grew with kinetics that were virtually indistinguishable from those of the parental vP-Oka. Plaque size measurements confirmed this significant growth defect (Fig. 4 A and B). The replication defect of both vΔaa1-157 clones was so severe that the viruses could not be amplified by passaging of the virus.

FIG. 4.

Growth properties of viruses lacking the entire ORFS/L. (A) Plaque size measurements of vΔaa1-157 (clone 1 [c1] and c2), vP-Oka, and revertant vΔaa1-157-rev generated from clone 1. Recombinant viruses were reconstituted in MeWo cells, IIF was performed 7 days after transfection, and images were recorded. Twenty individual plaque areas were measured and are shown as averages (vP-Oka plaques were set at 100%) with standard deviations (error bars). *, Plaque areas induced by Δaa1-157 mutants were significantly reduced (P < 0.0001) compared to those of parental vP-Oka or the revertant virus by Student's t test. (B) Representative plaque images for vΔaa1-157 (clones 1 and 2), vP-Oka, and vΔaa1-157-rev. Scale bars correspond to 200 μm.

ORFS/L gene product plays a role in replication in vitro.

To determine whether the observed growth effect was due to the lack of the ORFS/L gene product or an essential DNA element within ORFS/L, we generated a series of additional mutant viruses. In order to abrogate ORFS/L gene expression, we replaced the 1st start codon (vaa1stop), the codon for amino acid 3 (vaa3stop), or the codon for amino acid 34 (vaa34stop), just downstream of the 2nd start codon, with a stop codon (Fig. 1). We also generated a C-terminal deletion that results in the absence of aa 34 to aa 157 (vΔaa34-157). The latter mutant is very similar to two mutants generated in previous reports and served as a control (13, 28). In addition, revertant viruses of vaa1stop (vaa1stop-rev) and vΔaa34-157 (vΔaa34-157-rev) were generated. Multistep growth kinetics revealed that vaa1stop, vaa3stop, vaa34stop, and vΔaa34-157 were significantly impaired in viral replication compared to vP-Oka or revertant viruses (Fig. 5 A). While vaa3stop, vaa34stop, and vΔaa34-157 replication was reduced by about 5-fold, the replication of vaa1stop was reduced more and resulted in an approximately 10-fold reduction of virus progeny at all time points analyzed. In order to confirm the differences in growth defects, we also performed plaque size assays. In agreement with the multistep growth kinetics, vaa1stop, vaa3stop, vaa34stop, and vΔaa34-157 showed significant defects in plaque formation compared to that of vP-Oka or revertant viruses (Fig. 5B). The mean plaque areas of vaa1stop, vaa3stop, vaa34stop, and vΔaa34-157 were reduced by 69%, 31%, 45%, and 38%, respectively, compared with the plaque sizes of parental vP-Oka or the revertant viruses. To determine whether ORFS/L expression is abrogated in cells infected with vaa1stop, vaa3stop, or vaa34stop, we inserted an HA tag at the C terminus of ORFS/L, analogous to vS/L_cHA. Western blotting demonstrated that ORFS/L expression was absent in cells infected with vaa34stop-cHA. Unexpectedly, however, both vaa1stop-cHA and vaa3stop-cHA still expressed the ORFS/L protein, suggesting that the second start codon (aa 29) is used for the initiation of translation. The replication defect seen with vaa34stop confirmed that the ORFS/L gene product is important for efficient VZV replication. It was apparent that the insertion of stop codons at aa1 or aa3 also resulted in a growth defect which could not be attributed to absence of the ORFS/L product. We concluded from the results that the severe replication defect seen in vΔaa1-157 and vaa1stop and the less pronounced replication defect in vaa3stop were caused by a sequence element within the N-terminal 33 aa of the predicted ORFS/L.

FIG. 5.

Growth properties of a panel of ORFS/L mutants. (A) Multistep growth kinetics of indicated viruses. Virus replication of vaa1stop, vaa34stop, and vΔaa34-157 was significantly reduced (P < 0.05) at the indicated time points (asterisks) compared to that of vP-Oka or the corresponding revertant virus as determined by Student's t test. (B) Plaque size measurements of indicated viruses. *, Plaque areas of vaa1stop, vaa3stop, vaa34stop, and vΔaa34-157 were significantly reduced (P < 0.001) compared to those of vP-Oka (set to 100%) or the corresponding revertant virus as determined by Student's t test. Shown are the mean areas and standard deviations (error bars) for 60 individual plaques per virus. (C) Western blot analysis of cells infected with vP-Oka, vS/L_cHA, vaa1stop-cHA, vaa3stop-cHA, or vaa34stop-cHA. Samples were separated by SDS-15% PAGE and analyzed by Western blotting with anti-HA antibodies.

Cleavage defect of vaa1stop contributes to its growth defect.

To elucidate whether the replication defect of vaa1stop and vaa3stop (Fig. 5A and B) was caused by an alteration of a structural element present in the extreme 5′ end of the predicted ORFS/L, we addressed the cleavage of VZV genomes from concatemeric replication intermediates in cells infected with mutant or parental viruses. We infected MeWo cells with vaa1stop, vaa1stop-rev, vaa3stop, vaa34stop, or vP-Oka, harvested the cells at 90 to 100% cytopathic effect, prepared nuclear or whole-cell DNA, digested it with BamHI, and probed for the genomic termini (Fig. 6 A). While vaa1stop-rev viruses showed a cleavage pattern comparable to that of the parental vP-Oka, viral DNA from cells infected with vaa1stop showed an increase of uncleaved genomic termini in both whole-cell (Fig. 6B) and nuclear (Fig. 6C) VZV DNA. No cleavage defect was detected with vaa34stop, suggesting that the elevated levels of uncleaved VZV genomic termini in vaa1stop are not caused by reduced viral replication (Fig. 6C). Cleavage was only slightly, albeit discernibly, reduced in cells infected with vaa3stop, indicating that the two base pairs at this position are not as important as the two nucleotides changed in vaa1stop for the generation of unit-length genomes in infected cells (Fig. 6C). The relative quantity of uncleaved vaa1stop genomes was significantly increased, by more than 3.6-fold in whole-cellular and 2.7-fold in nuclear DNA, compared to the quantities of vP-Oka and vaa1stop-rev (Fig. 6D and E). Taken together, we concluded from the results of the experiments that the extreme 5′ region of the predicted ORFS/L is involved in cleavage of unit-length genomes from replicative-form concatemeric DNA before they are packaged into newly formed nucleocapsids. This reduction in DNA cleavage could subsequently result in impaired packaging of VZV genomes and correlates well with the growth defects of vaa1stop and vaa3stop. Taken together, the results indicate that the extreme 5′ terminus of ORFS/L contains a sequence element important for virus replication that is likely involved in the cleavage and packaging of viral DNA.

FIG. 6.

Cleavage of the viral genome in cells infected with mutant virus. (A) Schematic representation of the terminal fragments, TR_S and U_L, generated after restriction enzyme digestion with BamHI. The probe used to detect the genomic termini by Southern blotting is indicated. The scale bar provides an accurate measure of the sizes of the uncleaved (2.8 kbp), the TR_S (1.9 kbp), and the TR_L (0.9 kbp) fragments expected after cleavage and of the probe. (B) Cleavage analysis of whole-cell DNA derived from cells infected with vP-Oka, vaa1stop, or vaa1stop-rev. The P-Oka BAC (pP-Oka) served as a standard for uncleaved termini. The Southern blot shown is representative of the results of three independent experiments. (C) Cleavage analysis of nuclear DNA derived from cells infected with vP-Oka, vaa1stop, vaa1stop-rev, vaa3stop, or vaa34stop. The P-Oka BAC (pP-Oka) served as a standard for uncleaved termini. The Southern blot shown is representative of two independent experiments. (D) Quantification of band intensities of three independent cleavage assays using whole-cell DNA. The ratio of uncleaved to cleaved TR_L DNA fragments is shown relative to the results for vP-Oka. *, The relative amount of uncleaved termini of vaa1stop was significantly increased (P < 0.05) compared to the results for vP-Oka and vaa1stop-rev as determined by Student's t test. (E) Quantification of band intensities of two independent cleavage assays using nuclear DNA. The ratio of uncleaved to cleaved TR_L DNA fragments is shown relative to the results for vP-Oka.

DISCUSSION

Although the molecular tools available to study VZV replication in vitro and in vivo have improved considerably over the past decade, the functions of several of the 70 unique VZV ORFs still remain unknown. While sequence similarities between herpesviruses ORFs can often provide valuable information on protein localization and function, such predictions only provide testable hypotheses, not formal proof of the role these proteins or genetic elements play in related viruses.

For example, the function of ORFS/L, an ORF located at the very end of U_L, has remained enigmatic. Previously, it was demonstrated that a deletion of the C-terminal portion of ORFS/L resulted in a viral growth defect in vitro and in vivo. It has remained unclear, however, whether this defect is due to ORFS/L gene function or a critical sequence element that is independent of protein function per se. A second study also suggested that the ORFS/L protein localizes to the cytoplasm. Here, we chose to revisit both ORFS/L function and the localization of the encoded protein and also to dissect putatively overlapping functions of this genomic region. We surmised that important functions are attributable to nucleotide sequences specified in this region, which has close proximity to the DNA processing elements involved in cleavage and packaging of the viral DNA into newly formed nucleocapsids.

We first addressed the subcellular distribution of the ORFS/L protein and were able to demonstrate that it localizes to the Golgi apparatus in infected and transfected cells, which supports previous bioinformatic predictions that suggested it is a homologue of the HSV-1 and HSV-2 UL56 gene products. Besides its subcellular localization, the position of ORFS/L within the VZV genome, in close proximity to ORF3 that represents the VZV homologue of UL55, also supports this assumption (7). In addition, the ORFS/L protein shares 20% sequence identity with HSV-1 and -2 and contains two of the three conserved PY motives (L/PPXY). The PY motifs of HSV-2 UL56 were shown to facilitate binding to Nedd4, an E3 ubiquitin ligase involved in protein sorting and trafficking (4, 26, 27). Although we show here that the subcellular localization of the ORFS/L protein is consistent with an involvement of Nedd4-dependent sorting, further studies will be necessary to analyze the exact molecular functions of the ORFS/L product and its interaction with cellular proteins. The putative interaction partners include KIF1A, a member of the kinesin family that is involved in vesicular trafficking along microtubules and for which an interaction with the HSV-2 UL56 product was identified (17).

Western blot analysis showed that the P-Oka ORFS/L is expressed as a single protein species, and the apparent molecular mass of 18 kDa, as determined by SDS-PAGE and Western blotting, corresponded nicely to the predicted molecular mass of the full-length HA-tagged protein (M_r = 18,207). However, the data accumulated here indicate that translation is initiated from the 2nd and not the 1st start codon of the predicted ORFS/L. This finding is in agreement with the results of a recent study that demonstrated that plasmid-based transient expression of P-Oka ORFS/L initiated from the 2nd predicted start codon resulted in a protein with an apparent molecular mass of approximately 17 kDa (18), which is 3 kDa larger than predicted. This report also confirmed that the discrepancy between the predicted and apparent molecular mass determined here for the P-Oka ORFS/L protein is not due to glycosylation (18). Similarly, in silico predictions indicate that ORFS/L is not myristoylated, which could also account for a deviation of the apparent from the predicted molecular mass. The lack of a signal peptide indicates that ORFS/L is likely not translated at the rough endoplasmic reticulum (ER) or modified in the ER or Golgi network. Similar to the HSV-1 and HSV-2 UL56 proteins, the VZV ORFS/L product is predicted to encode a C-terminally anchored, type II transmembrane protein. Type II transmembrane proteins do not posses N-terminal signal sequences that would provide a signal for membrane insertion. Instead, they contain a C-terminal hydrophobic region facilitating insertion and orienting the N terminus of the protein toward the cytoplasm (19). In the case of the HSV-2 UL56 protein, the C-terminal hydrophobic region was indeed shown to be responsible for membrane insertion and its localization to the Golgi apparatus (16, 17).

It is notable that, in contrast to the 17 wild-type VZV strain sequences available in GenBank (http://www.ncbi.nlm.nih.gov/), the vaccine strains V-Oka, VariVax, and VarilRix harbor a mutation in the stop codon that extends the ORF by 276 bp (92 aa). In contrast to the ORFS/L product of P-Oka, that of V-Oka was shown to be glycosylated (18), but the extended C-terminal domain in V-Oka still allows its insertion into membranes and incorporation into the virion (18).

Mutations of ORFS/L immediately downstream of the determined start codon confirmed that the predicted ORFS/L gene product plays an important albeit not essential role in VZV replication. The involvement in vesicular trafficking, as shown for HSV-2 UL56, could account for the growth defect observed in cultured MeWo and HFF cells. In contrast, partial and complete deletions of ORFS/L sequences revealed that the 5′ region of ORFS/L is essential for replication. Analysis of the status of viral DNA in cells infected with the vaa1stop and vaa3stop mutant viruses showed that a sequence element contained in the predicted ORFS/L is involved in the cleavage and, consequently, packaging of single-unit genomes from concatemeric replication intermediates. In our experiments, comparable amounts of cleaved TR_S and TR_L fragments were present in vaa1stop-infected cells and cells infected with the parental vP-Oka. This apparent conundrum is likely caused by the extended time of about 96 h, until complete cytopathic effect was reached, allowed for infection in the case of vaa1stop. In some experiments, we also detected a minimal size difference in the vaa1stop TR_L fragment, which could potentially be caused by terminal cleavage at noncanonical sequences.

Intriguingly, the sequence that we showed is necessary for efficient cleavage of viral DNA is not present at the opposite end of the U_L, which could result in preferential packaging of viral DNA with only one orientation of the U_L. The asymmetry of the ends of the VZV U_L region was first detected and discussed by Davison and coworkers, who predicted a cleavage element within the U_L region that resides at least 90 bp from the genomic terminus, which exactly correlates with the 5′ region of ORFS/L (6, 7). Whether a similar cleavage element at the beginning of the U_L region is responsible for the directional packaging of other members of the Varicellovirus genus still remains a possibility.

In conclusion, our study provides further evidence that the ORFS/L gene product plays a role in VZV replication and that the 5′ region is involved in cleavage and packaging. Further studies of ORFS/L function and its potential interaction partners will shed light on its detailed role in VZV replication. In addition, defining the essential sequence elements within the 5′ region of ORFS/L will increase the understanding of its role in cleavage and packaging, as well as the almost exclusive orientation of the U_L in VZV virions.