Skip to main content
NCBI home page
European Journal of Human Genetics logoLink to European Journal of Human Genetics
. 2009 May 27;17(11):1471–1480. doi: 10.1038/ejhg.2009.89

Impact of BRCA1 and BRCA2 variants on splicing: clues from an allelic imbalance study

Virginie Caux-Moncoutier 1, Sabine Pagès-Berhouet 1, Dorothée Michaux 1, Bernard Asselain 2, Laurent Castéra 1, Antoine De Pauw 1, Bruno Buecher 1, Marion Gauthier-Villars 1, Dominique Stoppa-Lyonnet 1,3,4, Claude Houdayer 1,5,*
PMCID: PMC2986693  PMID: 19471317

Abstract

Nearly one-half of BRCA1 and BRCA2 sequence variations are variants of uncertain significance (VUSs) and are candidates for splice alterations for example, by disrupting/creating splice sites. As out-of-frame splicing defects lead to a marked reduction of the level of the mutant mRNA cleared through nonsense-mediated mRNA decay, a cDNA-based test was developed to show the resulting allelic imbalance (AI). Fifty-four VUSs identified in 53 hereditary breast/ovarian cancer (HBOC) patients without BRCA1/2 mutation were included in the study. Two frequent exonic single-nucleotide polymorphisms on both BRCA1 and BRCA2 were investigated by using a semiquantitative single-nucleotide primer extension approach and the cDNA allelic ratios obtained were corrected using genomic DNA ratios from the same sample. A total of five samples showed AI. Subsequent transcript analyses ruled out the implication of VUS on AI and identified a deletion encompassing BRCA2 exons 12 and 13 in one sample. No sequence abnormality was found in the remaining four samples, suggesting implication of cis- or trans-acting factors in allelic expression regulation that might be disease causative in these HBOC patients. Overall, this study showed that AI screening is a simple way to detect deleterious splicing defects and that a major role for VUSs and deep intronic mutations in splicing anomalies is unlikely in BRCA1/2 genes. Methods to analyze gene expression and identify regulatory elements in BRCA1/2 are now needed to complement standard approaches to mutational analysis.

Keywords: variants of uncertain significance, BRCA1, BRCA2, allelic imbalance, mutation screening, regulatory elements

Introduction

Molecular testing is now becoming a routine part of the medical management of patients affected by genetic diseases. In some cases, interpretation of the results from mutation screening is straightforward, for example truncating mutations and large rearrangements, and leads to clinical management options. However, in other cases, a variant of uncertain significance (VUS) is found and its contribution to disease risk has yet to be defined. Classification of these VUSs is therefore a major issue in molecular diagnosis and certain guidelines have been proposed.1 Germline mutations in BRCA1 (MIM 113705) and BRCA2 (MIM 600185) result in hereditary predisposition to breast and ovarian cancer (HBOC).2 Unfortunately, one-half of the variations observed in the BRCA1/2 genes are VUSs,3 making biological and clinical interpretation a challenging task and consequently leading to clinically and emotionally difficult situations. A striking example is that of a translationally silent nucleotide modification that would be classified as neutral despite the fact that it could be deleterious by affecting normal pre-mRNA splicing.4 A key issue raised in molecular diagnosis in the context of VUS interpretation is therefore their putative impact on splicing.5

Mutant mRNAs containing premature stop codons are eliminated or destabilized by nonsense-mediated mRNA decay (NMD), leading to a state of haploinsufficiency.6 As a result, the ratios between the expression levels from mutant alleles and the corresponding wild-type alleles are significantly decreased, resulting in allelic imbalance (AI), as shown in a number of genes, including BRCA1 and BRCA2.7, 8, 9 In an attempt to rapidly detect a deleterious impact of BRCA1 and BRCA2 VUSs on splicing, a SNaPshot assay has been designed to show this type of AI resulting from NMD. The SNaPshot assay is designed to interrogate single-nucleotide polymorphisms (SNPs) at known locations in a single tube. An unlabeled oligonucleotide primer is annealed to a PCR product 3′ to the SNP and extended by a single dideoxynucleotide triphosphate (ddNTP) complementary to the base of interest. The high specificity of single ddNTP incorporation makes the SNaPshot assay a powerful tool for quantitative SNP analyses. A relative quantification of allele-specific extended primers allows accurate determination of the initial ratio of the corresponding template sequences.10, 11, 12

Fifty-four VUSs identified in 53 HBOC patients without BRCA1/2 mutation were screened for allelic variations. As BRCA1/2 genes may commonly exhibit allele-specific expression differences,13 this natural variation range was defined in a control population consisting of retinoblastoma patients. Instead of targeting each VUS individually by the SNaPshot assay, which would considerably decrease the throughput and increase the costs, AIs were screened at four frequent BRCA1 and BRCA2 SNPs. Following AI detection, the samples were thoroughly investigated at the cDNA level to characterize the splicing defect using a two-step strategy. Analysis initially focused on the surrounding coding regions of the VUS, as this VUS was expected to cause the out-of-frame splicing defect leading to AI. Second, when no anomaly was found, the whole coding sequence of BRCA1 or BRCA2 was investigated at the cDNA level to look for a deep intronic mutation that could cause the splicing defect.14

Patients and methods

More than 3500 consecutive patients, mostly of Caucasian descent, diagnosed with HBOC, underwent constitutional molecular analysis of the BRCA1 and BRCA2 genes at the Institut Curie, following appropriate genetic counseling and written informed consent.15 In this series, 54 cases were selected on the following grounds: (i) lymphoblastoid cell line availability (ii) without BRCA1/2 mutation (iii) bearing at least one VUS (Tables 1a and 1b) (iv) polymorphic on one SNP (at least). As Institut Curie is also a reference center for retinoblastoma (MIM180200), a panel of lymphoblastoid cell lines from retinoblastoma patients heterozygous for the SNPs of interest were used as the control group.

Table 1a. Controls, patients and VUS tested on BRCA1.

    SNP used for allelic imbalance assay and normalized ratioa
Controls Mutations c.2612C>T (exon 11) (normal range: 0.78–1.10) c.4308T>C (exon 13) (normal range: 0.68–1.35)
Control 1 c.135-2A>G/intronic retention of 58 bp 2.45 Homozygous
Control 2 c.1266T>G/p.Tyr422X 0.52 2.05
Control 3 c.1504_1508del/p.Lys503AlafsX2 0.51 2.96
Control 4 c.1961dupA/p.Tyr655ValfsX18 0.43 2.88
Control 5 c.1965C>A/p.Tyr655X 0.45 2.80
Control 6 c.2071delA/p.Arg691AspfsX10 2.11 0.53
Control 7 c.2670delG/p.Gly890GlyfsX3 2.18 0.57
Control 8 c.2776_2777insTA/p.Thr926IlefsX75 0.50 2.58
Control 9 c.2800C>T/p.Gln934X 2.44 0.47
Control 10 c.3841C>T/p.Gln1281X 0.46 2.81
Control 11 c.4088C>G/p.Ser1363X Homozygous 2.07
Control 12 c.4484G>A/exon 14 skipping 1.65 1.92
       
Patient ID VUS    
133A c.1927A>G/p.Ser643Gly 0.96 1.04
3878A c.212+23T>A 1.10 Homozygous
3885A c.5277+48_59dup12 0.99 Homozygous
14126A c.3608G>A/p.Arg1203Gln 0.92 Homozygous
14161A c.1137T>G/p.Ile379Met 0.90 Homozygous
14756A c.5194-105insG 0.92 1.10
15470A c.5277+48_59dup12 1.70a 1.42a
16506A c.135-49T>C 0.94 1.03
18893A c.5074+68T>C 0.94 1.07
20958A c.557C>A/p.Ser186Tyr Homozygous 1.16
20958A c.3823A>G/p.Ile1275Val Homozygous 1.16
21665A c.2595T>C/p.Arg866Cys 0.88 1.17
24017A c.2315T>C/p.Val772Ala 1.05 1.53a
25032A c.114G>A/p.Lys38Lys 1.10 1.23
27328A c.1001C>T/p.Pro334Leu 1.05 1.02
27559A c.5252G>A/p.Arg1751Gln 1.07 0.96
27559A c.1263A>C/p.Glu421Asp 1.07 0.96
33859A c.5277+48_59dup12 1.06 1.24
Open in a new tab

Nucleotide position was numbered on the basis of the cDNA sequence NM_007294.2 according to HGVS guidelines.

a

See text and Table 4a for detailed description of ratio calculation.

Table 1b. Controls, patients and VUS tested on BRCA2.

    SNP used for allelic imbalance assay and normalized ratioa
Controls Mutations c.3807T>C (exon 11) (normal range: 0.92–1.61) c.7242A>G (exon 14) (normal range: 0.70–1.65)
Control 1 c.631+3A>G/exon 7 skipping 1.85 Homozygous
Control 2 c.1310_1313del4/p.Lys437IlefsX22 0.71 0.63
Control 3 c.1929delG/p.Val643ValfsX17 1.99 2.22
Control 4 c.2808_2811del/p.Gln937LysfsX23 Homozygous 0.57
Control 5 c.3455T>G/p.Leu1152X Complete imbalance Homozygous
Control 6 c.4285_4286insT/p.Gln1429LeufsX9 1.96 Homozygous
Control 7 c.5263G>T/p.Glu1755stop 0.42 0.60
Control 8 c.5576_5579del/p.Ile1859LysfsX3 0.67 Homozygous
Control 9 c.7322delG/p.Gly2441AlafsX28 2.16 2.80
Control 10 c.7806-7C>G/exon 18 skipping and 6 bp intronic retention Homozygous 1.68
Control 11 c.8364G>A/p.Trp2788X 2.08 Homozygous
       
Patient ID VUS    
3794A c.2363G>A/p.Gly788Asp Homozygous 1.12
3941A c.8111C>T/p.Ser2704Phe Homozygous 0.79
8680A c.9116C>T/p.Pro3039Leu 1.27 Homozygous
9100A c.7463G>A/p.Arg2488Lys 1.07 Homozygous
9408A c.4585G>A/p.Gly1529Arg Homozygous 1.11
10647A c.8149G>T/p.Ala2717Ser Homozygous 1.06
10647A c.9226G>C/p.Gly3076Arg Homozygous 1.06
16072A c.1964C>G/p.Pro655Arg Homozygous 1.10
16555A c.9613GC>CT/p.Ala3205Leu 1.35 Homozygous
16982A c.8632-16C>G 1.37 1.31
17073A c.8149G>T/p.Ala2717Ser 1.37 Homozygous
19054A c.9275A>G/p.Tyr3092Cys 1.55 Homozygous
19320A c.3462C>T/p.Thr1154Thr 1.51 1.28
20020A c.4187A>G/p.Gln1396Arg 1.30 1.23
20020A c.8460A>C/p.Val2820Val 1.30 1.23
20853A c.1792A>G/p.Thr598Ala 1.25 1.27
20909A c.280C>T/p.Pro94Ser Homozygous 0.94
21784A c.8567A>C/p.Glu2856Ala Homozygous 1.19
23324A c.425+33A>G 1.44 Homozygous
23576A c.3088T>G/p.Phe1030Val 1.33 1.27
23877A c.1151C>T/p.Ser384Phe 1.68a 0.67a
23919A c.223G>C/p.Ala75Pro 1.44 Homozygous
24311A c.2739C>T/p.Asp913Asp 1.17 1.34
25039A c.5312G>A/p.Gly1771Asp 1.26 1.32
25606A c.10110G>A/p.Arg3370Arg 1.51 Homozygous
25977A c.4570T>G/p.Phe1524Val 0.99 0.98
26355A c.4686A>G/p.Gln1562Gln Homozygous 0.97
26558A c.10188T>C/p.Ser3396Ser 0.93 Homozygous
27580A c.1514T>C/p.Ile505Thr Homozygous 1.03
28357A c.1786G>C/p.Asp596His Homozygous 1.13
29050A c.9038C>T/p.Thr3013Ile 1.40 Homozygous
29183A c.6739A>G/p.Ser2247Gly 1.27 1.37
30709A c.425+29T>C 1.22 1.20
30856A c.67+57A>C 1.45 1.27
31052A c.631+25C>T Homozygous 1.09
31080A c.5987C>G/p.Ala1996Gly Homozygous 0.60a
31248A c.6323G>A/p.Glu2108His 1.73a Homozygous
31577A c.4584C>T/p.Ser1528Ser Homozygous 1.12
32536A c.8850G>T/p.Lys2950Asn Homozygous 1.04
Open in a new tab

Nucleotide position was numbered on the basis of the cDNA sequence NM_000059.3 according to HGVS guidelines.

a

See text and Table 4b for detailed description of ratio calculation.

Routine genomic screening

Patients were screened for point mutations on BRCA1 and BRCA2 using denaturing high-performance liquid chromatography.16 Large rearrangements on BRCA1 were also investigated by using quantitative multiplex PCR of short fluorescent fragments.17 A panel of 53 DNAs from retinoblastoma patients were screened to identify polymorphic controls for the SNPs of interest. Nucleotide position was numbered according to the HGVS guidelines on the basis of the cDNA sequences NM_007294.2 and NM_000059.3 for BRCA1 and BRCA2, respectively.

RNA extraction, reverse transcription and PCR amplification (RT-PCR)

RNA extracted from lymphoblastoid cell lines was used, as validated earlier.11, 18, 19 RNA was extracted from lymphoblastoid cell lines using TRIzol reagent according to the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA). RNAs were further processed to remove any contaminating DNA (Turbo DNA free; Ambion, Austin, TX, USA). Following quantification using a spectrophotometer (NanoDrop; Thermo Scientific, Courtaboeuf, France), 2 μg of total RNA from each sample was used for reverse transcription in a 40 μl reaction using the GeneAmp RNA PCR Core kit and according to the manufacturer's instructions (Applied Biosystems, Foster City, CA, USA). The fragments containing the four SNPs were PCR amplified in separate vials using 100 ng of cDNA in a 10 μl final volume with standard, unlabeled primers (Table 2), and then run on a GeneAmp PCR system 9700 (Applied Biosystems). Limiting PCR conditions were used (25–28 cycles, depending on the SNPs) to remain in the exponential phase of amplification. Signal strength was therefore directly dependent on the target copy number, so that relative allelic dosage could be obtained by comparing peak heights of the two alleles. Following amplification, unincorporated primers and dNTPs were removed by ExoSAP-IT according to the manufacturer's instructions (Amersham Bioscience, Orsay, France).

Table 2. cDNA primers used for SNP amplification and SNaPshot assays.

Gene SNP Amplification forward primer (5′–3′) Amplification reverse primer (5′–3′) SNaPshot primer (5′–3′)
BRCA1 c.2612C>T CAAGGGACTAATTCAT GGTTG AACTGTCTGTACAGGCTTGAT ACATTCAAGGTTTCAAAGCGCCAGT CATTTGCTC
  c.4308T>C GAAACAAGCGTCTCTGAA GACT TTCTGGATTCTGGCTTATAGGG ACCCTTCCATCATAAGTGACTC
         
BRCA2 c.3807T>C GCTGTGAAACTG TTTAGTGA GCAAGTCCGTTTCATCTTTA CCAATAAGTTTATCTTCAAGTAAATGT CATGATTCTGT
  c.7242A>G TATGAACATCTGACTT TGGAA GGCATTCTGAAGACTTGTAA AGTCTTTGTTCCACCTTTTAA AACTAAATC
Open in a new tab

Quantitative SNaPshot assay

Seven microliters of the purified RT-PCR products were used in the SNaPshot quantitative primer extension assay (Applied Biosystems) according to the manufacturer's instructions and using the primers shown in Table 2. Following purification by SAP-IT (Amersham Bioscience), separation and detection of SNaPshot products were performed on an ABI PRISM 3130XL Genetic Analyzer (Applied Biosystems). The injection cocktail, consisting of 0.5 μl of the GeneScan-120 LIZ size standard (Applied Biosystems) and 19.5 μl of formamide-EDTA, was mixed with 2 μl of SNaPshot products, heat denatured and then chilled on ice. Products were injected for 18 s at 1.2 kV, then electrophoresed for 1300 s at 15 kV using Performance Optimized Polymer 6 and a 36-cm length-to-detector uncoated capillary. Data were analyzed using the Genemapper (version 4) software program (Applied Biosystems) to collect both area and peak height for each sample.

AI measurement

The peak/area ratios were measured between the two allelic versions that is, c.2612C to c.2612T/p.Pro871Leu (rs799917) and c.4308T to c.4308C/p.Ser1436Ser (rs1060915) for BRCA1, and c.3807T to c.3807C/p.Val1269Val (rs543304) and c.7242A to c.7242G/p.Ser2414Ser (rs1799955) for BRCA2. cDNA ratios were then normalized with respect to the values obtained on genomic DNA (cDNA ratios/gDNA ratios) to correct from putative variations in dye incorporation induced by the nucleotide sequence. As cis/trans-acting inherited variations in gene expression are known to be relatively common,11, 12, 13 a control population was used to define the physiological expression variation at these SNPs. A panel of retinoblastoma patients heterozygous for the tested SNPs (13–20 depending on the SNPs) were screened by the SNaPshot assay and the physiological expression range was defined as the mean of the normalized ratio ±2 SD. Twenty-three samples with BRCA1/2 truncating mutations were used as positive controls.

cDNA screening following AI detection

RNA was extracted from lymphoblastoid cell lines with and without puromycin treatment. Puromycin treatment was used to inhibit NMD20 to allow the identification of the out-of-frame splicing defect. Following reverse transcription (see above), the surrounding coding regions of the VUS were PCR amplified (primers available on request), purified by Nucleofast 96 PCR plates (Macherey Nagel, Hoerdt, France) and sequenced on an ABI 3130 XL using the Big Dye terminator kit (Applied Biosystems) and the primers used for amplification. When no anomaly was found, the same cDNA sample was used for whole BRCA1/2 coding sequence amplification. BRCA1 and BRCA2 were studied in 7 and 10 overlapping fragments (exon 11 excluded), respectively (primer sequences available on request). Amplicons were purified and sequenced as described above.

In silico analysis

As a complementary investigation, the impact of the 56 VUSs on splicing was tested in silico using a set of previously evaluated web-based tools5 that is, Splice Site Prediction by Neural Network (NNSplice available at http://www.fruitfly.org/seq_tools/splice.html),21 Splice Site Finder (SSF no longer supported, but similar algorithms are now available on Alamut (Interactive Biosoftware, Rouen, France)), Automated Splice Site Analysis (ASSA available at https://splice.uwo.ca)22 and MaxEntScan with the maximum entropy model (MES available at http://genes.mit.edu/burgelab/maxent/Xmaxentscan_scoreseq.html).23

Results

Development and validation of a quantitative AI assay for BRCA1 and BRCA2

Instead of targeting each VUS individually, which would be time consuming, costly and barely applicable to intronic VUSs, the presence of AI was screened at four BRCA1/2 SNPs. These SNPS were chosen because they are relatively common (see NCBI website available at http://www.ncbi.nlm.nih.gov/SNP). RNA extracted from lymphoblastoid cell lines and a robust, widely used, primer-extension assay developed by Applied Biosystems were used.

Assay performance

To determine whether our SNaPshot assay was able to quantitatively measure AI at BRCA1 and BRCA2, DNAs from two individuals determined by sequence analysis to be homozygous for either BRCA1-c.2612C/C or BRCA1-c.2612T/T, and BRCA2-c.3807T/T or BRCA2-c.3807C/C, were mixed at the following ratios (100:0, 80:20, 60:40, 50:50, 40:60, 20:80 and 0:100), then SNaPshot was tested. Regression equations and R2 were calculated for peak height and area. Measurements based on peak height were found to be more robust than measurements based on peak area, although both results were good (Table 3). Therefore, peak height was used throughout the study. Following these results, SNaPshot assaying two other SNPs on both BRCA1 and BRCA2 were designed for the study. However, two of them were subsequently withdrawn from further analysis (BRCA1 SNP c.4837A>G and BRCA2 SNP c.1114A>C) because double peaks for one allele were randomly observed in a number of samples tested (data not shown). This lack of robustness was confirmed using a serial dilution experiment (see earlier) showing R2=0.888 for BRCA1 SNP c.4837A>G and R2=0.786 for BRCA2 SNP c.1114A>C. A total of four SNPs were therefore used for this study (Tables 4a and 4b).

Table 3. Performance of the assay, based on serial dilutions (100:0, 80:20, 60:40, 50:50, 40:60, 20:80 and 0:100) of two DNA samples homozygous for the frequent and minor allele of two SNPs (BRCA1, c.2612C>T and BRCA2, c.3807T>C).
  Based on peak area Based on peak height
Gene, SNP Regression equation R2 Regression equation R2
BRCA1 c.2612C>T/p.Pro871Leu y=1.2593x+0.0396 0.995 y=1.2397x+0.0662 0.996
BRCA2 c.3807T>C/p.Val1269Val y=0.9986x+0.0731 0.996 y=1.0369x+0.0564 0.997
Open in a new tab

Regression equations and R2 are indicated for peak height and area. The fluorescent signal increases as a function of sample load.

Table 4a. Samples showing allelic imbalances on BRCA1.
SNP tested and normal variation range (1): c.2612C>T – 0.78 to 1.10
Patient and VUS Height peak ‘C' Height peak ‘T' Ratio ‘C/T' Normalized ratio cDNA/gDNA Normalized ratio cDNA/gDNA following NMD inhibition (3)
  cDNA gDNA cDNA gDNA cDNA gDNA    
15470A, c.5277+48_59dup12 1522 1515 1349 2282 1.13 0.66 1.70 1.76
                 
SNP tested and normal variation range (2): c.4308T>C – 0.68 to 1.35
Patient and VUS Height peak ‘T' Height peak ‘C' Ratio ‘T/C' Normalized ratio cDNA/gDNA Normalized ratio cDNA/gDNA following NMD inhibition (3)
  cDNA gDNA cDNA gDNA cDNA gDNA    
15470A, c.5277+48_59dup12 1224 1268 551 814 2.22 1.56 1.42 1.43
24017A, c.2315T>C/p.Val772Ala 1004 787 463 556 2.17 1.41 1.53 1.51
Open in a new tab

Normal variation range was defined as the mean of normalized ratio ±2 SD and determined on a panel of (1) 17 and (2) 20 control samples heterozygous for the SNP of interest. Peak height is in RFU. Peak heights are not indicated for these ratios.

Table 4b. Samples showing allelic imbalances on BRCA2.
SNP tested and normal variation range (1): c.3807T>C – 0.92–1.61
Patient and VUS Height peak ‘T' Height peak ‘C' Ratio ‘T/C' Normalized ratio cDNA/gDNA Normalized ratio cDNA/gDNA following NMD inhibition (3)
  cDNA gDNA cDNA gDNA cDNA gDNA    
23877A c.1151C>T/p.Ser384Phe 2533 3762 1283 3223 1.97 1.17 1.68 1.67
31080A c.5987C>G/p.Ala1996Gly Homozygous, not tested
31248A c.6323G>A/p.Glu2108His 3803 2973 1926 2608 1.97 1.14 1.73 1.69
                 
SNP tested and normal variation range (2): c.7242A>G – 0.70–1.65
Patient and VUS Height peak ‘T' Height peak ‘C' Ratio ‘T/C' Normalized ratio cDNA/gDNA Normalized ratio cDNA/gDNA following NMD inhibition (3)
  cDNA gDNA cDNA gDNA cDNA gDNA    
23877A c.1151C>T/p.Ser384Phe 4231 5858 6660 6243 0.63 0.94 0.67 0.65
31080A c.5987C>G/p.Ala1996Gly 4016 1797 7668 2077 0.52 0.86 0.60 1.12
31248A c.6323G>A/p.Glu2108His Homozygous, not tested
Open in a new tab

Normal variation range was defined as the mean of normalized ratio ±2 SD and determined on a panel of (1) 12 and (2) 13 control samples heterozygous for the SNP of interest. Peak height is in RFU. (3) Peak heights are not indicated for these ratios.

Detection of AI caused by NMD

Before testing the putative impact of VUSs, the first step of the study consisted of checking that samples with truncating mutations inducing NMD were correctly detected with an expected AI. A total of 23 control DNAs and RNAs from HBOC patients bearing mutations leading to an out-of-frame defect and previously characterized for molecular diagnostic purposes were used (Tables 1a and 1b). Among them, the BRCA2 splice mutation c.7806-7C>G/p.Tyr2658_Arg2659insSerPhe+p.Tyr2660PhefsX43 (6-bp intronic retention plus exon 18 skipping) was a very challenging case for detection through AI. This mutation indeed results in a mixture of in-frame and out-of-frame defects (data available on request, presented at the 2004 American Society of Human Genetics meeting http://www.ashg.org/genetics/abstracts/abs04/f537.htm). These mutated controls were heterozygous for one or both SNPs of interest and showed a strong AI, except for c.7806-7C>G, which was just above the cutoff value (see Discussion).

Sample analysis

AI measurement: BRCA1

Sixteen patients bearing 16 different VUSs were tested (Table 1a). All patients were found to be heterozygous at SNP c.2612C>T, c.4308T>C or both. AI was screened by using SNPs c.2612C>T (normal variation range: 0.78–1.10) and c.4308T>C (normal variation range: 0.68–1.35). Two samples fell outside these ranges (Table 4a). Patient 15470A (Figure 1), bearing the c.5277+48_59dup12 VUS, was heterozygous on both SNPs and AI was found on both SNPs, although it was much more pronounced at c.2612C>T (1.70) than at c.4308T>C (1.42). Patient 24017A, bearing the c.2315T>C/p.Val772Ala VUS, showed AI at the c.4308T>C SNP (1.53), but its normalized ratio remained in the upper normal range at the c.2612C>T SNP (1.05). All samples, apart from 15470A, showed less marked imbalance compared with the mutated controls.

Figure 1.

Figure 1

Open in a new tab

SNaPshot results for patient 15470A, at the c.2612C>T SNP on BRCA1. x axis: size in bp; y axis: fluorescence intensity (arbitrary units). Data are from cDNA (left panel) and gDNA (right panel). Allelic variants are labeled at the bottom of their corresponding peak (the rightmost peak is the ‘T' peak).

AI measurement: BRCA2

Thirty-seven patients bearing 38 different VUSs were tested (Table 1b). All patients were found to be heterozygous at SNP c.3807C>T, c.7242A>G or both. AI was screened by using SNPs c.3807C>T (normal variation range: 0.92–1.61) and c.7242A>G (normal variation range: 0.70–1.65). Three samples fell outside these ranges (Table 4b). Patient 23877A, bearing the c.1151C>T/p.Ser384Phe VUS, was heterozygous on both SNPs and a slight AI was found on both SNPs (1.68 and 0.67). Patient 31080A, bearing the c.5987C>G/P.Ala1996Gly VUS, and patient 31248A, bearing the c.6323G>A/p.Glu2108His VUS, showed imbalance on one SNP (0.60 and 1.73, respectively), but this was not confirmed on the remaining SNP (homozygous state).

cDNA screening following AI detection

RNA from the five patients showing AI was extracted from lymphoblastoid cell lines with and without puromycin treatment to identify an out-of-frame splicing defect. RT-PCR and subsequent sequencing of the surrounding regions of the VUSs did not show any anomaly, thus ruling out their implication in the detected imbalance. It was, therefore, postulated that AI could be due to deep intronic mutations that would generate intronic exonization and subsequent frameshifting.14 Consequently, the whole BRCA1 and BRCA2 coding sequences were thoroughly investigated at the cDNA level and a BRCA2 out-of-frame transcript lacking exons 12 and 13 was found in patient 31080A. Genomic analyses using Quantitative Multiplex PCR of Short fluorescent Fragments24 evidenced a genomic deletion encompassing exons 12 and 13, thereby explaining our findings. No anomaly was found in the remaining four patients. To further strengthen these results, AI ratios were also measured following NMD inhibition by puromycin. Similar AI ratios were found in all but one case, patient 31080A, who recovered a corrected ratio in the normal range (1.12 for BRCA2 SNP c.7242A>G).

In silico analyses

All VUSs were subjected to in silico analyses using a previously described protocol.5 No change was observed for 5′–3′ splice sites and branchpoint consensus sequences between the wild-type and mutant sequences. More specifically, the following results were found for the imbalanced samples: VUSs p.Ser384Phe, p.Ala1996Gly, p.Glu2108his and p.Val772Ala are located in large exons of BRCA2 and BRCA1, respectively, and did not lead to the creation of cryptic splice sites. Modifications of exonic splicing enhancer pattern were observed for p.val772Ala (creation of an SF2 motif scored 2.34 using ESE Finder, available at http://rulai.cshl.edu/cgi-bin/tools/ESE3/esefinder.cgi?process=home) and p.Ser384Phe (score increased from 2.69 to 4.04 for an SRp40 motif using ESE Finder). The intronic BRCA1 VUS c.5277+48_59dup12 did not alter the 5′ wild-type splice site and did not create a cryptic splice site.

Discussion

In the context of molecular diagnosis, geneticists are faced everyday with a huge number of nucleotide variations of uncertain significance (VUS) in their favorite genes. One clue in VUS interpretation can be derived from current knowledge suggesting that all types of nucleotide modifications may affect normal splicing through disruption/creation of splice consensus sequences.4, 14, 25, 26 Unfortunately, it appears unrealistic to perform routine RNA screening targeting each VUS to detect a putative splicing anomaly, particularly for genes, such as BRCA1 and BRCA2, that display a large number of VUSs. We have, therefore, developed an AI assay to rapidly detect VUSs that may have a deleterious impact on splicing by generating out-of-frame transcripts degraded by NMD. A large normal variation range was defined to avoid false positives. On the other hand, sensitivity is lowered and some imbalanced patients may have been scored normal. Fifty-four consecutively ascertained carriers of a total of 53 VUSs on BRCA1 or BRCA2 using four common SNPs were tested and five AIs were found. Subsequent transcript analyses ruled out the implication of these VUSs on AI and identified a deletion encompassing BRCA2 exons 12 and 13 in patient 31080A. These findings were strengthened by AI measurements on puromycin-treated samples. The deleted patient recovered a normal ratio, but the remaining four samples displayed similar values with or without NMD inhibition (Tables 4a and 4b), further showing the absence of a hidden truncating mutation and suggesting an underlying cause outside BRCA genes (see below).

Overall, we believe this is a fast and easy-to-implement strategy, as the use of common SNPs allows rapid screening of a large number of patients (the same test may be used for a large number of patients). This assay should now be used on RNA extracted from fresh lymphocytes, which are the preferred source in diagnostic settings. Assaying one gene at a time prevents the burden of multiple testing and modest effects or sample size that is, low statistical power. Consequently, our mutated controls and an NMD-prone mutation were unambiguously detected. More interesting, the normalized ratio for the BRCA2 c.7806-7C>G mutation, which produces in-frame and out-of-frame transcripts, was relatively close to the upper ratio of the normal variation range (1.68 versus 1.65, Table 4b), thereby illustrating the sensitivity of the assay. Unexpectedly, the same range of normal variation was not observed for the two SNPs tested on both BRCA1 and BRCA2. A normal variation range of 0.32 for c.2612C>T and 0.67 for c.4308T>C was found on BRCA1, and this observation held true for BRCA2 (0.69 and 0.95 for c.3807T>C and c.7242A>G, respectively). Alternative splicing may be responsible for these findings for example, the large number of BRCA1 alternative transcripts27 may influence expression measurement levels at a given position on the transcript. For example, discordant results were observed for patient 24017A, who showed AI on BRCA1 for one SNP but not for the other SNP for which a normalized ratio in the upper normal range was found.

This study, designed to determine a putative impact of BRCA1/2 VUSs on splicing, was on two aspects. First, it appears that none of the VUSs tested could be linked to a deleterious, out-of-frame defect, in contrast with earlier data.28, 29, 30, 31, 32 Although very interesting, these previous reports were based on a limited number of cases and may therefore not be representative of the majority of VUSs found in BRCA1 and BRCA2. This study, based on 54 VUSs, is in line with a recent report on 108 VUSs from BRCA1 exon 11, which showed that none of the VUSs tested were found to alter splicing.33 This is also clearly illustrated in this study for the BRCA1 c.5277+48_59dup12 variant, which was tested in three distinct patients, but was found to be imbalanced only in one patient. Lastly, in silico analyses, which appear to be reliable to detect splice mutations,5 did not show any possible effect of these VUSs on splicing. Therefore, overall data do not support a major role for BRCA VUS in splicing defects. Second, it also appears that deep intronic mutations are not an important part of the molecular spectrum of BRCA genes. To our knowledge, there is no deep intronic mutation reported to date in BRCA1/2 and this is perfectly in line with data reported on other genes such as NF14 and RB1,34 showing that deep intronic mutations account for a mere 1% of their mutational spectrum.

The mutation detection rate for BRCA1 and BRCA2 among HBOC families in France was close to 14% in 2006 (http://www.e-cancer.fr/v1/fichiers/public/figures_rapport_oncogenetique_2003_2006.pdf), meaning not only that other genes are probably involved but also that a substantial number of BRCA1/2 mutations have yet to be found outside the coding sequences and intron/exon boundaries, which are screened in routine diagnostic settings. Our study may suggest an alternative mutational mechanism because four patients without structural abnormality of BRCA1 or BRCA2 showed AI at transcribed polymorphisms, thereby suggesting the disruption of long-distance cis-regulatory elements35, 36 or mutations in the 3′-UTR that influence RNA half-life.37 It is worth noting that these four patients have a high probability of bearing a mutation at a general autosomal dominant breast cancer susceptibility locus that is, 48–89% depending on the case, and according to the Claus model modified by Easton.15 However, all belong to female breast cancer-only families. Although highly speculative, it might be hypothesized that disruption of regulatory elements could lead to a less severe phenotype compared with classical deleterious mutations.38 Haplotype and co-segregation analyses need to be performed in the relevant families to confirm the transmission of an altered cis-regulatory element. It could also be of interest to search for BRCA1/2 mutations in the tumor and, in the case of loss of heterozygosity, determine whether the retained allele is the one with low expression. Alternatively, it cannot be excluded that the cases identified in this study are sporadic cases with a rare combination of polymorphisms leading to decreased expression of BRCA1/2 genes. A recent study39 reported AI in a series of 32 HBOC patients versus 40 controls at SNP c.4308T>C for BRCA1, prompting the authors to postulate an involvement of BRCA1 AI in HBOC. No significant difference was found in the present patient population compared with the control group at this SNP (18 and 21 cases, respectively, P=0.59, t-test). It can be concluded that AI at BRCA1/2 genes may sometimes contribute to HBOC.

In summary, this study showed that (i) AI screening at common polymorphisms is a simple way to detect splicing defects, (ii) a major role for VUSs and deep intronic mutations in splicing anomalies is unlikely in BRCA1/2 genes and (iii) methods for analyzing gene expression and identifying regulatory elements are now needed to complement standard approaches to mutational analysis.40, 41

Acknowledgments

We thank Isabelle Eugène, Sandrine Miglierina, Cristelle Postel and Catherine Gilbon for their efficient assistance, the Institut Curie Breast Cancer group for referral of patients and Généthon for cell line establishment.

References

  1. Domchek S, Weber BL. Genetic variants of uncertain significance: flies in the ointment. J Clin Oncol. 2008;26:16–17. doi: 10.1200/JCO.2007.14.4154. [DOI] [PubMed] [Google Scholar]
  2. Antoniou A, Pharoah PD, Narod S, et al. Average risks of breast and ovarian cancer associated with BRCA1 or BRCA2 mutations detected in case series unselected for family history: a combined analysis of 22 studies. Am J Hum Genet. 2003;72:1117–1130. doi: 10.1086/375033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Frank TS, Deffenbaugh AM, Reid JE, et al. Clinical characteristics of individuals with germline mutations in BRCA1 and BRCA2: analysis of 10 000 individuals. J Clin Oncol. 2002;20:1480–1490. doi: 10.1200/JCO.2002.20.6.1480. [DOI] [PubMed] [Google Scholar]
  4. Pros E, Gomez C, Martin T, Fabregas P, Serra E, Lazaro C. Nature and mRNA effect of 282 different NF1 point mutations: focus on splicing alterations. Hum Mutat. 2008;29:E173–E193. doi: 10.1002/humu.20826. [DOI] [PubMed] [Google Scholar]
  5. Houdayer C, Dehainault C, Mattler C, et al. Evaluation of in silico splice tools for decision-making in molecular diagnosis. Hum Mutat. 2008;29:975–982. doi: 10.1002/humu.20765. [DOI] [PubMed] [Google Scholar]
  6. Maquat LE. Nonsense-mediated mRNA decay: splicing, translation and mRNP dynamics. Nat Rev Mol Cell Biol. 2004;5:89–99. doi: 10.1038/nrm1310. [DOI] [PubMed] [Google Scholar]
  7. Ware MD, DeSilva D, Sinilnikova OM, Stoppa-Lyonnet D, Tavtigian SV, Mazoyer S. Does nonsense-mediated mRNA decay explain the ovarian cancer cluster region of the BRCA2 gene. Oncogene. 2006;25:323–328. doi: 10.1038/sj.onc.1209033. [DOI] [PubMed] [Google Scholar]
  8. Chen X, Truong TT, Weaver J, et al. Intronic alterations in BRCA1 and BRCA2: effect on mRNA splicing fidelity and expression. Hum Mutat. 2006;27:427–435. doi: 10.1002/humu.20319. [DOI] [PubMed] [Google Scholar]
  9. Perrin-Vidoz L, Sinilnikova OM, Stoppa-Lyonnet D, Lenoir GM, Mazoyer S. The nonsense-mediated mRNA decay pathway triggers degradation of most BRCA1 mRNAs bearing premature termination codons. Hum Mol Genet. 2002;11:2805–2814. doi: 10.1093/hmg/11.23.2805. [DOI] [PubMed] [Google Scholar]
  10. Matyas G, Giunta C, Steinmann B, Hossle JP, Hellwig R. Quantification of single nucleotide polymorphisms: a novel method that combines primer extension assay and capillary electrophoresis. Hum Mutat. 2002;19:58–68. doi: 10.1002/humu.10013. [DOI] [PubMed] [Google Scholar]
  11. Yan H, Yuan W, Velculescu VE, Vogelstein B, Kinzler KW. Allelic variation in human gene expression. Science. 2002;297:1143. doi: 10.1126/science.1072545. [DOI] [PubMed] [Google Scholar]
  12. Valle L, Serena-Acedo T, Liyanarachchi S, et al. Germline allele-specific expression of TGFBR1 confers an increased risk of colorectal cancer. Science. 2008;321:1361–1365. doi: 10.1126/science.1159397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Buckland PR. Allele-specific gene expression differences in humans. Hum Mol Genet. 2004;13 Spec No 2:R255–R260. doi: 10.1093/hmg/ddh227. [DOI] [PubMed] [Google Scholar]
  14. Dehainault C, Michaux D, Pages-Berhouet S, et al. A deep intronic mutation in the RB1 gene leads to intronic sequence exonisation. Eur J Hum Genet. 2007;15:473–477. doi: 10.1038/sj.ejhg.5201787. [DOI] [PubMed] [Google Scholar]
  15. Stoppa-Lyonnet D, Laurent-Puig P, Essioux L, et al. BRCA1 sequence variations in 160 individuals referred to a breast/ovarian family cancer clinic. Institut Curie Breast Cancer Group. Am J Hum Genet. 1997;60:1021–1030. [PMC free article] [PubMed] [Google Scholar]
  16. Wagner T, Stoppa-Lyonnet D, Fleischmann E, et al. Denaturing high-performance liquid chromatography detects reliably BRCA1 and BRCA2 mutations. Genomics. 1999;62:369–376. doi: 10.1006/geno.1999.6026. [DOI] [PubMed] [Google Scholar]
  17. Casilli F, Di Rocco ZC, Gad S, et al. Rapid detection of novel BRCA1 rearrangements in high-risk breast-ovarian cancer families using multiplex PCR of short fluorescent fragments. Hum Mutat. 2002;20:218–226. doi: 10.1002/humu.10108. [DOI] [PubMed] [Google Scholar]
  18. Pastinen T, Sladek R, Gurd S, et al. A survey of genetic and epigenetic variation affecting human gene expression. Physiol Genomics. 2004;16:184–193. doi: 10.1152/physiolgenomics.00163.2003. [DOI] [PubMed] [Google Scholar]
  19. Serre D, Gurd S, Ge B, et al. Differential allelic expression in the human genome: a robust approach to identify genetic and epigenetic cis-acting mechanisms regulating gene expression. PLoS Genet. 2008;4:e1000006. doi: 10.1371/journal.pgen.1000006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Andreutti-Zaugg C, Scott RJ, Iggo R. Inhibition of nonsense-mediated messenger RNA decay in clinical samples facilitates detection of human MSH2 mutations with an in vivo fusion protein assay and conventional techniques. Cancer Res. 1997;57:3288–3293. [PubMed] [Google Scholar]
  21. Reese MG, Eeckman FH, Kulp D, Haussler D. Improved splice site detection in Genie. J Comput Biol. 1997;4:311–323. doi: 10.1089/cmb.1997.4.311. [DOI] [PubMed] [Google Scholar]
  22. Nalla VK, Rogan PK. Automated splicing mutation analysis by information theory. Hum Mutat. 2005;25:334–342. doi: 10.1002/humu.20151. [DOI] [PubMed] [Google Scholar]
  23. Yeo G, Burge CB. Maximum entropy modeling of short sequence motifs with applications to RNA splicing signals. J Comput Biol. 2004;11:377–394. doi: 10.1089/1066527041410418. [DOI] [PubMed] [Google Scholar]
  24. Casilli F, Tournier I, Sinilnikova OM, et al. The contribution of germline rearrangements to the spectrum of BRCA2 mutations. J Med Genet. 2006;43:e49. doi: 10.1136/jmg.2005.040212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Zatkova A, Messiaen L, Vandenbroucke I, et al. Disruption of exonic splicing enhancer elements is the principal cause of exon skipping associated with seven nonsense or missense alleles of NF1. Hum Mutat. 2004;24:491–501. doi: 10.1002/humu.20103. [DOI] [PubMed] [Google Scholar]
  26. Cartegni L, Chew SL, Krainer AR. Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet. 2002;3:285–298. doi: 10.1038/nrg775. [DOI] [PubMed] [Google Scholar]
  27. Orban TI, Olah E. Emerging roles of BRCA1 alternative splicing. Mol Pathol. 2003;56:191–197. doi: 10.1136/mp.56.4.191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Fackenthal JD, Cartegni L, Krainer AR, Olopade OI. BRCA2 T2722R is a deleterious allele that causes exon skipping. Am J Hum Genet. 2002;71:625–631. doi: 10.1086/342192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Campos B, Diez O, Domenech M, et al. RNA analysis of eight BRCA1 and BRCA2 unclassified variants identified in breast/ovarian cancer families from Spain. Hum Mutat. 2003;22:337. doi: 10.1002/humu.9176. [DOI] [PubMed] [Google Scholar]
  30. Yang Y, Swaminathan S, Martin BK, Sharan SK. Aberrant splicing induced by missense mutations in BRCA1: clues from a humanized mouse model. Hum Mol Genet. 2003;12:2121–2131. doi: 10.1093/hmg/ddg222. [DOI] [PubMed] [Google Scholar]
  31. Vega A, Campos B, Bressac-De-Paillerets B, et al. The R71G BRCA1 is a founder Spanish mutation and leads to aberrant splicing of the transcript. Hum Mutat. 2001;17:520–521. doi: 10.1002/humu.1136. [DOI] [PubMed] [Google Scholar]
  32. Ozcelik H, Nedelcu R, Chan VW, et al. Mutation in the coding region of the BRCA1 gene leads to aberrant splicing of the transcript. Hum Mutat. 1999;14:540–541. doi: 10.1002/(SICI)1098-1004(199912)14:6<540::AID-HUMU13>3.0.CO;2-C. [DOI] [PubMed] [Google Scholar]
  33. Anczukow O, Buisson M, Salles MJ, et al. Unclassified variants identified in BRCA1 exon 11: consequences on splicing. Genes Chromosomes Cancer. 2008;47:418–426. doi: 10.1002/gcc.20546. [DOI] [PubMed] [Google Scholar]
  34. Zhang K, Nowak I, Rushlow D, Gallie BL, Lohmann DR. Patterns of missplicing caused by RB1 gene mutations in patients with retinoblastoma and association with phenotypic expression. Hum Mutat. 2008;29:475–484. doi: 10.1002/humu.20664. [DOI] [PubMed] [Google Scholar]
  35. Liu J, Francke U. Identification of cis-regulatory elements for MECP2 expression. Hum Mol Genet. 2006;15:1769–1782. doi: 10.1093/hmg/ddl099. [DOI] [PubMed] [Google Scholar]
  36. Pezzolesi MG, Zbuk KM, Waite KA, Eng C. Comparative genomic and functional analyses reveal a novel cis-acting PTEN regulatory element as a highly conserved functional E-box motif deleted in Cowden syndrome. Hum Mol Genet. 2007;16:1058–1071. doi: 10.1093/hmg/ddm053. [DOI] [PubMed] [Google Scholar]
  37. Rajasekaran R, Sudandiradoss C, Doss CG, Sethumadhavan R. Identification and in silico analysis of functional SNPs of the BRCA1 gene. Genomics. 2007;90:447–452. doi: 10.1016/j.ygeno.2007.07.004. [DOI] [PubMed] [Google Scholar]
  38. Pfeifer D, Kist R, Dewar K, et al. Campomelic dysplasia translocation breakpoints are scattered over 1 Mb proximal to SOX9: evidence for an extended control region. Am J Hum Genet. 1999;65:111–124. doi: 10.1086/302455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Chen X, Weaver J, Bove BA, et al. Allelic imbalance in BRCA1 and BRCA2 gene expression is associated with an increased breast cancer risk. Hum Mol Genet. 2008;17:1336–1348. doi: 10.1093/hmg/ddn022. [DOI] [PubMed] [Google Scholar]
  40. Chan KY, Liu W, Long JR, et al. Functional polymorphisms in the BRCA1 promoter influence transcription and are associated with decreased risk for breast cancer in Chinese women. J Med Genet. 2009;46:32–39. doi: 10.1136/jmg.2007.057174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Benko S, Fantes JA, Amiel J, et al. Highly conserved non-coding elements on either side of SOX9 associated with Pierre Robin sequence. Nat Genet. 2009;41:359–364. doi: 10.1038/ng.329. [DOI] [PubMed] [Google Scholar]

Articles from European Journal of Human Genetics are provided here courtesy of Nature Publishing Group

RESOURCES