Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Nov 18.
Published in final edited form as: Hepatology. 2002 Aug;36(2):284–296. doi: 10.1053/jhep.2002.34432

Regulation of Ca2+ Signaling in Rat Bile Duct Epithelia by Inositol 1,4,5-Trisphosphate Receptor Isoforms

Keiji Hirata 1, Jean-François Dufour 2, Kazunori Shibao 1, Roy Knickelbein 1, Allison F O'Neill 1, Hans-Peter Bode 3, Doris Cassio 4, Marie V St-Pierre 5, Nicholas F LaRusso 6, M Fatima Leite 7, Michael H Nathanson 1
PMCID: PMC2987686  NIHMSID: NIHMS251671  PMID: 12143036

Abstract

Cytosolic Ca2+ (Cai2+) regulates secretion of bicarbonate and other ions in the cholangiocyte. In other cell types, this second messenger acts through Ca2+ waves, Ca2+ oscillations, and other subcellular Ca2+ signaling patterns, but little is known about the subcellular organization of Ca2+ signaling in cholangiocytes. Therefore, we examined Ca2+ signaling and the subcellular distribution of Ca2+ release channels in cholangiocytes and in a model cholangiocyte cell line. The expression and subcellular distribution of inositol 1,4,5-trisphosphate (InsP3) receptor (InsP3R) isoforms and the ryanodine receptor (RyR) were determined in cholangiocytes from normal rat liver and in the normal rat cholangiocyte (NRC) polarized bile duct cell line. Subcellular Ca2+ signaling in cholangiocytes was examined by confocal microscopy. All 3 InsP3R isoforms were expressed in cholangiocytes, whereas RyR was not expressed. The type III InsP3R was the most heavily expressed isoform at the protein level and was concentrated apically, whereas the type I and type II isoforms were expressed more uniformly. The type III InsP3R was expressed even more heavily in NRC cells but was concentrated apically in these cells as well. Adenosine triphosphate (ATP), which increases Ca2+ via InsP3 in cholangiocytes, induced Ca2+ oscillations in both cholangiocytes and NRC cells. Acetylcholine (ACh) induced apical-to-basal Ca2+ waves. In conclusion, Ca2+ signaling in cholangiocytes occurs as polarized Ca2+ waves that begin in the region of the type III InsP3R. Differential subcellular localization of InsP3R isoforms may be an important molecular mechanism for the formation of Ca2+ waves and oscillations in cholangiocytes. Because Cai2+ is in part responsible for regulating ductular secretion, these findings also may have implications for the molecular basis of cholestatic disorders.


Cytosolic Ca2+ (Cai2+) regulates a wide range of functions in the liver. One way in which Cai2+ simultaneously regulates multiple cell functions is through spatial and temporal Cai2+ signaling patterns, such as Cai2+ waves and oscillations. For example, localized subplasmalemmal increases in Cai2+ direct secretion,1-3 whereas Cai2+ gradients direct cell motion.4-7 Temporal Cai2+ signaling patterns such as oscillations also can regulate cell functions, including gene expression8,9 and secretion.10 Although Cai2+ oscillations can be induced in cholangiocytes,11 it is unknown whether Cai2+ waves or other subcellular Cai2+ signaling patterns also occur in this cell type.

The formation of Cai2+ waves in polarized epithelia is believed to depend largely on intracellular Ca2+ stores rather than plasma membrane Ca2+ channels, because neither the orientation nor the speed of such waves is altered in Ca2+-free media.12 The 2 intracellular Ca2+ channels principally responsible for Cai2+ signaling are the inositol 1,4,5-trisphosphate (InsP3) receptor (InsP3R) and the ryanodine receptor (RyR). It was previously believed that RyRs regulate Cai2+ signaling only in myocytes, whereas InsP3Rs regulate Cai2+ signaling in nonexcitable epithelia. However, many cell types express both RyR and InsP3R,13,14 including polarized epithelia.15,16 Moreover, there are multiple isoforms of both of these receptors, each of which displays distinct functional properties.17-20 Thus, the formation of Cai2+ waves likely depends not only on the expression and subcellular distribution of RyRs and InsP3Rs, but on the distribution of individual isoforms of each of these receptors as well. Here we examine the expression and subcellular distribution of these Ca2+ release channels in cholangiocytes from rat liver and in normal rat cholangiocyte (NRC) cells, a polarized rat cholangiocyte cell line used as a model for cholangiocyte function.21

Materials and Methods

Animals and Materials

Male Sprague-Dawley rats (250-300 g; Camm Research Lab Animals, Wayne, NJ) were used for all animal studies. Acetylcholine (ACh), adenosine triphosphate (ATP), propidium iodide, deoxyribonuclease, hyaluronidase, bovine serum albumin, penicillin-streptomycin, and insulin were obtained from Sigma Chemical Co. (St. Louis, MO). Fluo-4 and fura-2 in acetoxymethyl ester form, Pluronic F-127, and rhodamine-conjugated phalloidin were obtained from Molecular Probes (Eugene, OR). SuperScript II ribonuclease H− reverse transcriptase, colcemid, minimal essential medium (MEM), α-MEM, Liebowitz 15 (L-15), gentamicin, and other tissue culture reagents were from Gibco BRL (Life Technologies AG, Basel, Switzerland). Collagen-coated flasks were from Becton Dickinson, Bedford, MA. RQ1 ribonuclease-free deoxyribonuclease was from Promega (Wallisellen, Switzerland). Pronase was from Calbiochem (La Jolla, CA).

Antibodies

Each InsP3R isoform was labeled using isoform-specific antibodies. Type I InsP3R antibodies were from affinity-purified specific rabbit polyclonal antiserum directed against the 19 C-terminal residues of the mouse type I InsP3R22 and were produced by Research Genetics (Huntsville, AL). Type II InsP3R antibodies were from affinity-purified specific rabbit polyclonal antiserum directed against the 18 C-terminal residues of the rat type II InsP3R23 and were kindly provided by Richard Wojcikiewicz (SUNY, Syracuse, NY). A commercially available monoclonal antibody was used to label the N-terminal region of the human type III InsP3R17 (Transduction Laboratories, Lexington, KY).

Cell Isolation and Cell Culture

Cholangiocytes and isolated rat bile duct units were isolated from normal rat liver as described previously.11 Briefly, rats were anesthetized with pentobarbital sodium (50 mg/kg body wt intraperitoneally) and then their livers were perfused with Ca2+- and Mg2+-free Hank's buffer/0.019% ethylenediaminetetraacetic acid followed by Hank's buffer containing 0.05% collagenase (Boehringer Mannheim Biochemicals, Indianapolis, IN). The portal tissue residue was then either cut into strips for Cai2+ measurements or processed further to obtain isolated cholangiocytes. For Cai2+ studies, the long wavelength lipophilic dye 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine perchlorate (DiD; Molecular Probes) was first injected into the common bile duct to facilitate identification of cholangiocytes within portal strips (see below). To isolate cholangiocytes, the tissue was finely minced, digested further, and then filtered through nylon screens (Tetko, Lancaster, NY). The suspension was subjected to centrifugation in a Percoll density gradient.11 Cells banding at densities 1.060 to 1.075 were collected, elutriated, and then used for Western blot analysis. This resulted in more than 107 cells per liver, ~70% of which stained positive for γ-glutamyl transpeptidase and more than 90% of which were viable by trypan blue exclusion.

The NRC cell line was maintained in culture for separate studies. This polarized cell line is derived from normal rat cholangiocytes.21 Cells were maintained in culture on collagen in cholangiocyte growth medium.21

Immunoblot Analysis

Protein concentration of cell homogenate was determined as described.24 Cholangiocyte or NRC cell proteins were separated by electrophoresis using a 5% polyacrylamide gel and transferred to nitrocellulose membranes. The membranes were blocked at 4°C overnight and probed for 2 hours with the primary antibody. The antibody against InsP3R isoform I was used at a dilution of 1:60, the antibody against InsP3R isoform II was used at a dilution of 1:100, and the antibody against InsP3R isoform III was used at a dilution of 1:1,000. Peroxidase-conjugated secondary antibodies were from Pierce (Rockford, IL). The membranes were washed, incubated for 1 hour with peroxidase-conjugated secondary antibody immunoglobulin G anti-rabbit (1: 1,000) or anti-mouse (1:3,000), and shown by enhanced chemiluminescence (Amersham, Arlington Heights, IL). For quantitative analyses, immunoblotting was performed on samples of rat cholangiocytes or NRC cells along with positive controls containing known concentrations of InsP3R isoforms.23 For each immunoblot, type I, II, and III InsP3R immunoreactivity was then quantified using a BioRad GS-700 imaging densitometer (Richmond, CA). InsP3R isoform protein expression in cholangiocytes and controls was compared directly to yield the relative abundance of each isoform in cholangiocytes.23 Specifically, the ratio of cholangiocyte or NRC cell band intensity divided by control cell band intensity was multiplied by the InsP3R isoform concentration in the control cells or tissue to obtain the InsP3R isoform concentration in cholangiocytes or NRC cells. Cerebellum was used as a standard for type I InsP3R (129.6 ng/10 μg protein), whole liver was used for type II InsP3R (0.65 ng/10 μg protein), and the RIN cell line was used for type III InsP3R (14.1 ng/10 μg protein).23 The relationship between band intensity and amount of InsP3R loaded onto gels was linear over the range seen in the present study.

Confocal Immunofluorescence Microscopy

Immunochemistry was performed on 4-μm-thick frozen sections of rat liver hilum containing bile ducts or on NRC cells grown on coverslips. Specimens were fixed by cold acetone, methanol, or 3% formaldehyde followed by methanol permeabilization. After blocking steps, specimens were labeled with primary antibody, rinsed with phosphate-buffered saline, and incubated with Alexa 488 – or Alexa 568 – conjugated secondary antibody (Molecular Probes). Bile ducts also were stained with rhoda-mine-conjugated phalloidin to label actin, which is most concentrated beneath the plasma membrane,12,15,25 or with propidium iodide to stain the nucleus.26 For negative control studies, tissue was incubated with secondary antibodies but anti-InsP3R (primary) antibodies were omitted. Specimens were examined using a Zeiss LSM 510 confocal microscope equipped with a krypton/argon laser (Thornwood, NY). To ensure specificity of staining, images were obtained using confocal machine settings that detected no fluorescence in negative controls. NRC cells were examined using either a Zeiss Axioskop microscope or a BioRad Microradiance AG-2 confocal system.

RNA Isolation and Reverse Transcription

Total RNA was extracted as described.27 The concentration of RNA collected from the cholangiocytes or NRC cells was determined by absorbance at 260 nm, and the quality was controlled by running an aliquot on a 1% agarose form-aldehyde gel.

Polymerase Chain Reaction Analyses

Two types of polymerase chain reaction (PCR) analyses were performed. Reverse transcription (RT) PCR was performed to determine whether cholangiocytes or NRC cells express RyR, whereas real-time quantitative PCR was performed to examine relative amounts of InsP3R isoforms in cholangiocytes and NRC cells. For RT-PCR, 5 μg of total RNA was treated with RQ1 ribonuclease-free deoxyribonuclease and reverse transcribed by the SuperScript II ribonuclease H− reverse transcriptase with an oligo(dT) primer. Two control complementary DNA reactions were performed; RNA but no reverse transcriptase was added (RNA control) in one, and no RNA was added (DNA control) in the other. PCR amplification was performed using a PTC-100 automated thermocycler (MJ Research, Inc., Watertown, MA) using 2 μL of the first strand complementary DNA reaction, 150 pmol of each degenerate primer, 50 μmol/L deoxynucleoside triphosphates, 2.5 U AmpliTaq DNA polymerase in 10 mmol/L Tris-HCl (pH 8.3) containing 50 mmol/L KCl, and 2.5 mmol/L MgCl2 in a total volume of 100 μL. Following hot start (2 minutes at 94°C), the samples were subjected to 30 cycles of 45 seconds at 94°C, 1 minute at 50°C, and 1 minute at 72°C. This was followed by a final extension at 72°C for 10 minutes. The degenerate primers were designed to amplify a 530 – base pair product from the 3′ region of all 3 known RyRs.15 In selected experiments, primers were designed to probe for each of the 3 RyR isoforms. For those studies, TCAAGCGGAAGGTTCTGGA was the sequence used for rRyR1-20-5′, TGACGGATGAAAGGATGGTG was used for rRyR1-352-3′, CATGGATAAGGTCGCACTGGA was used for rRyR2-75-5′, CGAGCTGTTTGCCATTATGG was used for rRyR2-364-3′, TTGGACAAAAATGCCCTGGA was used for rRyR3-88-5′, and GGTCTTAAAGCCCATGGCAATA was used for rRyR3-324-3′. Each PCR product was analyzed by agarose gel electrophoresis.

Real-time quantitative PCR analysis of InsP3R iso-forms and glyceraldehyde-3-phosphate dehydrogenase was performed with a PE Applied Biosystems 7700 Sequence Detector (Perkin Elmer, Shelton, CT) as described previously.28 Complementary DNA was amplified in a 50 μL volume containing 25 μL of the 2× TaqMan Universal PCR Master Mix (Perkin Elmer), 100 nmol/L probe, and 300 nmol/L of each primer. After a denaturing step of 10 minutes at 95°C, 40 cycles were performed: 95°C for 15 seconds and 60°C for 1 minute. The mathematical analysis of the results was performed as recommended by the manufacturer.

Cai2+ Measurements

Confocal microscopy was used to measure Cai2+ in cholangiocytes because cells were within thick segments of the bile duct or in isolated bile duct units. Epifluorescence microscopy was used to monitor Cai2+ in NRC cell monolayers. For confocal imaging, DiD (25 μmol/L) and the Ca2+ dye fluo-4/acetoxymethyl ester (18 μmol/L) were coinjected into the common bile duct, and then bile duct segments were isolated as previously described. The bile duct segments were observed using a BioRad MRC 1024 confocal imaging system. Tissue was excited at 647 nm and observed at more than 680 nm to identify DiD-labeled cholangiocytes, and then Cai2+ was monitored by exciting the specimen at 488 nm and detecting emission signals greater than 515 nm. Images were obtained at a rate of 1 image per second to identify hormone-responsive cells,26 and then confocal line scanning29,30 was performed to identify the speed and direction of Cai2+ waves. Cells were observed using a 20×, 0.75 NA objective (zoom factor, 5), resulting in a spatial resolution of 0.20 μm/pixel and a temporal resolution of 6 milliseconds. Increases in Cai2+ were expressed as percent increase in fluo-4 fluorescence intensity.11,26,29 Velocities of Cai2+ waves were determined from the rate at which fluorescence increases moved along the scan line.29,30

For NRC cell studies, cells were loaded with fura-2 (5 μmol/L) and then observed using a Zeiss Axiovert 135 inverted microscope. Measurements of Cai2+ were performed using a Zeiss Attofluor imaging system. Cells were excited at 334 and 380 nm, and emission signals greater than 520 nm were observed with an intensified CCD camera. Cai2+ was calculated from the excitation ratio R according to the following equation31:

Cai2+=(R−Rmin)∕(Rmax−R)×Kd×(Sf2∕Sb2).

Calibrations were performed using standards containing Ca2+-saturated and Ca2+-free fura-2, respectively. This yielded Rmax, Rmin, Sf2, and Sb2. A value of 224 nmol/L was used for Kd. NRC cells were measured before confluence, when the cells were present in large (>20 cells) islands. The traces shown represent values from regions of interest covering approximately one cell each.

Statistics

Results are expressed as mean ± SD. Comparisons between groups were made using Student's t test, and a P value less than .05 indicates a significant difference.

Results

Expression of InsP3Rs and RyR in Cholangiocytes and NRC Cells

Expression of all 3 InsP3R isoforms was detected in cholangiocytes by quantitative measurement of messenger RNA (mRNA). Using this approach, 40.8% of InsP3R mRNA was for the type I isoform, 38.0% was for type II, and 21.2% was for type III (Fig. 1). Expression of all 3 InsP3R isoforms was also detected in NRC cells by this approach. The relative mRNA distribution of the InsP3R in NRC cells was 20% for the type I isoform, 13% for type II, and 67% for type III (Fig. 2). This finding is consistent with the observation that expression of the type III InsP3R is increased in cell lines relative to what is observed in the corresponding native tissue.32 In contrast to the InsP3R, RyR expression could not be detected in cholangiocyte mRNA using RT-PCR (Fig. 3). RT-PCR was also performed with NRC cell mRNA using primers specific for each of the 3 known isoforms of the RyR (Fig. 4). RyR-2 and RyR-3 were absent from NRC cells. A faint band for RyR-1 was detected after 35 cycles, suggesting that this isoform also is not expressed or is expressed only minimally. Together, these findings suggest that the InsP3R is the principal intracellular Ca2+ release channel in cholangiocytes as well as NRC cells.

Fig. 1.

Fig. 1

InsP3R isoforms in cholangiocytes measured by real-time quantitative PCR using primers and probes specific for each isoform. Each of the 3 InsP3R isoforms was expressed; 40.8% of the InsP3 receptor mRNA was for the type I isoform, 38.0% was for type II, and 21.2% was for type III.

Fig. 2.

Fig. 2

InsP3R isoforms in NRC cells measured by real-time quantitative PCR. Examination of the relative mRNA distribution for each InsP3 receptor isoform showed that the type III isoform is most abundant in NRC cells, representing 67%. Isoforms I and II represented 20% and 13%, respectively.

Fig. 3.

Fig. 3

RT-PCR fails to detect RyR in cholangiocytes. Using isoformspecific primers, a single 530 – base pair product common to all known RyR isoforms was identified in cardiac RNA (positive control) but not in cholangiocyte RNA or in negative controls. (A) Cardiac RNA after (1) 20, (2) 25, or (3) 30 PCR cycles. (B) Cholangiocyte mRNA after (1) 20, (2) 25, or (3) 30 PCR cycles. (C) Control reactions: (1) DNA control, (2) RNA control, and (3) actin band (500 base pairs), showing that the cholangiocyte RNA is intact.

Fig. 4.

Fig. 4

RT-PCR assessment of RyR in NRC cells. Using isoform-specific primers, single products were identified in the positive controls, rat skeletal muscle (RyR-1), rat heart (RyR-2), and rat diaphragm (RyR-3). A faint RyR-1 band was seen in NRC cells after 35 PCR cycles, and no band was seen in NRC cells for RyR-2 or RyR-3. A single band is seen for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in NRC cells, showing that the NRC cell RNA is intact.

Immunoblots were performed to determine whether cholangiocytes express all 3 InsP3R isoforms at the protein level (Fig. 5). Determination of the relative protein level of each isoform is complicated by the fact that each iso-form-specific antibody has a different affinity for its epitopes. Therefore, to estimate relative protein levels, quantitative immunoblots for each isoform were performed along with blots from tissues that express known concentrations of each InsP3R isoform.23 Densitometric quantification of immunoreactivity that comigrated with each positive control showed that cholangiocytes expressed 1.37 ± 0.17 ng of the type III InsP3R per 10 μg cell protein (mean ± SD) but only 0.12 ± 0.12 ng/10 μg protein of type I and only 0.15 ± 0.07 ng/10 μg protein of type II (Fig. 5D). Thus, most InsP3Rs in cholangiocytes (84%) are the type III isoform, with lesser amounts of types I (7%) and II (9%). This confirms that all 3 InsP3R isoforms are expressed in cholangiocytes; however, in contrast to the findings of our PCR studies, these results suggest that the type III InsP3R is the predominant isoform at the protein level. Immunoblots were also performed to determine whether NRC cells express all 3 InsP3R isoforms at the protein level. NRC cells expressed 7.6 ± 0.5 ng/10 μg protein of the type III InsP3R, but neither the type I nor type II isoform could be detected (Fig. 6). This suggests that, at the protein level, nearly all InsP3Rs in NRC cells are the type III isoform.

Fig. 5.

Fig. 5

Cholangiocytes express all 3 InsP3R isoforms. (A) Western analysis using a type I–specific InsP3R antibody identifies a single band of the same size in lysates from cholangiocytes (60 μg) and the positive control, rat cerebellum (8.6 μg). (B) Type II–specific InsP3R antibody CT2 identifies a single band of the same size in lysates from cholangiocytes and the positive control, rat liver (60 μg each). (C) A monoclonal type III–specific InsP3R antibody identifies a single band of the same size in lysates from cholangiocytes and the positive control, RIN-5F cells (60 μg each). (D) Quantitative densitometric analysis of InsP3R isoforms in cholangiocytes. Expression of the type III isoform is significantly greater than either of the other 2 isoforms (*P < .001). Blots were quantified in their linear range, and results are the mean ± SD of n = 5 blots for InsP3R-1, n = 4 for InsP3R-2, and n = 3 for InsP3R-3.

Fig. 6.

Fig. 6

NRC cells express only the type III InsP3 receptor. (A) A type I–specific InsP3R antibody identifies a single band in lysates from the positive control, rat cerebellum (8.6 μg), but not in lysates from NRC cells (40 μg). (B) Type II–specific InsP3R antibody CT2 identifies a single band in lysates from the positive control, rat liver (60 μg each), but not in NRC cell lysates (40 μg). (C) A monoclonal type III–specific InsP3R antibody identifies a single band of the same size in lysates from NRC cells (40 μg) and the positive control, RIN-5F cells (60 μg). (D) Densitometric analysis of InsP3R isoforms in NRC cells. Expression of the type III isoform is greater than the amount observed in cholangiocytes. Blots were quantified in their linear range, and results are the mean ± SD of triplicate blots for each isoform (*P < .001).

Subcellular Localization of InsP3R Isoforms

The subcellular distribution of the type I, II, and III InsP3Rs was investigated in cholangiocytes and NRC cells by confocal immunofluorescence histochemistry. Rat liver sections were labeled with isoform-specific InsP3R antibodies and colabeled with rhodamine-conjugated phalloidin to identify the actin network beneath apical and basolateral membrane or propidium iodide to identify the nucleus of cholangiocytes (Fig. 7). Type I and II InsP3Rs were uniformly distributed throughout the cytosol (Fig. 7A and B). Although type III InsP3R immunofluorescence was also seen throughout the cytosol, labeling was most intense in the apical region (Fig. 7D and E). No labeling was seen in negative control tissues stained with secondary but not primary antibodies (Fig. 7C and F). The mean apical and basolateral fluorescence intensity of each isoform was determined to quantify these observations (Fig. 7G). The ratio of apical/basolateral fluorescence was 1.10 ± 0.04 for the type I InsP3R and 1.14 ± 0.04 for type II but 2.63 ± 0.31 for type III (P < .0002 relative to the type I and II isoforms; n = 8 measurements for each group). This suggests that the subcellular pattern of distribution of the type III InsP3R differs from that of the type I and II InsP3Rs in cholangiocytes. Confocal immunofluorescence was also used to examine the subcellular distribution of the type III InsP3R in NRC cells. Optical sections obtained near the apical membrane showed a diffuse pattern of InsP3R labeling (Fig. 8A-C), whereas sections obtained in the basolateral region showed minimal labeling (Fig. 8D-F). As with cholangiocytes, NRC cells thus express the type III InsP3R to a greater extent in the apical region. Thus, cholangiocytes and NRC cells share certain key features in the expression and subcellular distribution of InsP3R isoforms, although there are differences as well.

Fig. 7.

Fig. 7

Subcellular distributions of InsP3R isoforms in cholangiocytes as determined by confocal immunofluorescence labeling of rat liver. (A) Distribution of the type I InsP3R (green). The specimen is colabeled with rhodamine-phalloidin (red) to identify actin, which outlines the plasma membranes of cholangiocytes. InsP3R labeling is seen throughout each cholangiocyte. (Scale bar, 10 μm.) (B) Distribution of the type II InsP3R (green) plus rhodamine-phalloidin (red) to identify actin, which is predominantly along the plasma membrane. Labeling of this isoform is also seen throughout each cholangiocyte. (C) Double-labeled image of a separate liver section stained with rhodamine-phalloidin (red) plus the anti-rabbit secondary antibody used to counterstain the primary antibodies for the type I and type II InsP3R (green). The lack of nonspecific staining by the secondary antibody is evident. (D) Distribution of the type III InsP3R(green) plus rhodamine-phalloidin (red) to identify actin, which is near the plasma membrane. Labeling of this isoform is diffusely distributed throughout the cytosol but is most intense along the apical membrane of the cholangiocyte. (E) Distribution of the type III InsP3R (green) plus propidium iodide (red) to identify the nucleus. This double-labeled image also shows that the type III InsP3R is most concentrated near the apical membrane. (F) Double-labeled image of a separate liver section stained with propidium iodide (red) plus the anti-mouse secondary antibody used to counterstain the primary antibody for the type III InsP3R (green). The lack of nonspecific staining by this secondary antibody is evident as well. (G) Quantification of InsP3R immunofluorescence. For each isoform, apical and basolateral immunofluorescence was quantified and the ratio was obtained. The apical and basolateral regions are labeled to a similar extent for both the type I and type II InsP3R, but fluorescence labeling is more than twice as intense in the apical region than in the basolateral region for the type III receptor (*P < .0002).

Fig. 8.

Fig. 8

Subcellular distribution of the type III InsP3R in NRC cells as determined by confocal immunofluorescence. Optical sections were obtained in NRC monolayers double labeled with antibodies directed against the type III InsP3R (green) and the tight junction protein ZO-1 (red), which identifies the apical region. Type III InsP3R staining is both intense and diffusely distributed in optical sections near (A-C) the apical membrane but is minimal in optical sections near (D-F) the basolateral membrane.

Ca2+ Signaling in Cholangiocytes and NRC Cells

To examine Cai2+ signaling, cells were stimulated with ATP, which is known to increase Cai2+ through activation of InsP3Rs in cholangiocytes.11 NRC cells were exposed to ATP apically, because only the apical side of these cells is exposed and because both cholangiocytes33 and NRC cells34 express apical P2Y receptors that link to InsP3 formation. Apical exposure of NRC cells to extracellular ATP (1-100 μmol/L) elicited an immediate increase in Cai2+ followed by Cai2+ oscillations (Fig. 9A and B). These oscillations terminated quickly on removal of the agonist. For comparison, the effect of ATP on Cai2+ signaling was examined in individual cholangiocytes within isolated bile duct units (Fig. 9C). ATP induced Cai2+ oscillations in cholangiocytes, similar to what has been observed in cholangiocytes previously11 and in NRC cells here. Because of technical constraints, the current studies compared Cai2+ signals induced by stimulation of apical ATP receptors in NRC cells with basolateral ATP receptors in cholangiocytes. Although the response of cholangiocytes to ATP is attenuated when the cells are stimulated basolaterally rather than apically, cholangiocytes nonetheless express the same subtypes of P2Y ATP receptors on their apical and basolateral membrane.33 These findings thus show that there are functional as well as structural similarities in Cai2+ signaling between cholangiocytes and NRC cells.

Fig. 9.

Fig. 9

Ca2+ oscillations in (A and B) NRC cells and (C) cholangiocytes. NRC cells were loaded with fura-2 and then exposed apically to ATP and examined by fluorescence microscopy, whereas cholangiocytes were loaded with fluo-4 and then exposed basolaterally to ATP and examined by confocal microscopy. (A) ATP (100 μmol/L) triggered a large increase in Cai2+ followed by Cai2+ oscillations. The Cai2+ signal stopped with removal of the agonist. (B) A lower concentration of ATP (1 μmol/L) elicited only a small initial increase in Cai2+, but this was followed by Cai2+ oscillations of the same magnitude and frequency as induced by 100 μmol/L ATP. (C) ATP (10 μmol/L) also induces Cai2+ oscillations in cholangiocytes. This tracing was obtained by monitoring a single cholangiocyte within an isolated bile duct unit using confocal microscopy. The result is representative of that seen in 15 cells.

Subcellular Ca2+ Signaling Patterns in cholangiocytes

To determine the relationship between the distribution of InsP3R isoforms and subcellular Cai2+ signaling patterns, fluo-4–loaded cholangiocytes were examined by confocal line scanning microscopy.29,30 This imaging approach was used because it is well suited to detect subcellular Cai2+ signals, which typically occur on a millisecond timescale.35,36 Because confocal line scanning microscopy of polarized epithelia requires the apical-to-basal axis of the cells to be within the focal plane,29,30,37 we examined Cai2+ signaling in cholangiocytes within microdissected segments of intrahepatic bile ducts. However, Cai2+ signaling in NRC cells could not be examined by this approach because their apical-to-basal axis is perpendicular to the plane of focus. Individual cholangiocytes within intrahepatic bile duct segments were double labeled by retrograde injection of fluo-4 plus DiD before microdis-section to facilitate identification of the cells (Fig. 10). Bile duct segments then were stimulated with either ACh or ATPγS, both of which cause an InsP3-mediated increase in Cai2+ in this cell type.11 The nonhydrolyzable form of ATP was used here because nucleotides otherwise are rapidly hydrolyzed at the basolateral membrane of cholangiocytes.33 ACh (100 μmol/L) caused an increase in Cai2+ throughout the cholangiocyte. The increase in Cai2+ began in the apical region and then spread rapidly (22.5 ± 9.3 μm/s; n = 40) to the basolateral region (Fig. 11). Both the direction and speed of this Cai2+ wave were unchanged in Ca2+-free medium (21.5 ± 7.9 μm/s; n = 8; P > .35). Progressive, apical-to-basal increases in Cai2+ also were observed in cholangiocytes stimulated with ATPγS (Fig. 11E). These findings suggest that InsP3-mediated Cai2+ signals in cholangiocytes begin in the apical region and then spread as polarized, apical-to-basal Cai2+ waves.

Fig. 10.

Fig. 10

Identification of live cholangiocytes within strips of portal tracts. The common bile duct was coinfused with the Ca2+ dye fluo-4 and the lipophilic dye DiD, and then strips of portal tracts were isolated and examined by confocal microscopy. The left panel shows cholangiocytes and adjacent interstitium stained with DiD. The middle panel shows staining with fluo-4 (scale bar, 20 μm). The right panel shows the merged (superimposed) image.

Fig. 11.

Fig. 11

Fig. 11

ACh-induced Cai2+ waves in cholangiocytes visualized by confocal line scanning microscopy. (A) Confocal image of a portal tract segment. The cells have been loaded with DiD to facilitate identification. (B) Confocal image of the same segment excited at a lower wavelength to show loading with fluo-4. The line used for line scanning is shown in white. Note that the line crosses the apical-to-basal axis of one of the cells. This and the subsequent image are pseudocolored according to the color scale shown below. (C) Confocal line scanning image of the cell shown in B. The tissue was stimulated with ACh (100 μmol/L) as confocal fluorescence along the line was collected every 6 milliseconds. An increase in fluorescence occurs throughout the cholangiocyte, which begins in the apical region and then spreads rapidly to the basolateral region, representing a Cai2+ wave that crosses from the apical to the basolateral pole of the cell.

(D) Tracing of subcellular Cai2+ signals in the same cell. The apical increase in Cai2+ (left arrow) precedes the basolateral Cai2+ increase (right arrow) by approximately 100 milliseconds, reflecting an apical-to-basal Cai2+ wave. Notice that the final increase in Cai2+ is similar in the apical and basolateral poles, reflecting the fact that the Cai2+ wave does not diminish as it crosses the cell. The result is representative of that seen in 40 cells. (E) ACh-induced Cai2+ waves are not affected by extracellular Ca2+. Results are mean ± SEM of 40 cells in Ca2+-containing medium and 8 cells in Ca2+-free medium. (F) Tracing of subcellular Cai2+ signals in a separate cell stimulated with ATPγS (100 μmol/L). A regenerative, apical-to-basal Cai2+ wave is seen (left arrow indicates onset of apical Ca2+ signal, right arrow indicates onset of basolateral signal), similar to what is observed in cells stimulated with ACh. The result is representative of that seen in 5 cells.

Discussion

There are 3 isoforms of the InsP3R, and it was previously reported that the type III isoform is expressed in cholangiocytes.28 Here we report that cholangiocytes actually express all 3 isoforms of the InsP3R but in different amounts and subcellular distributions. Specifically, the type III isoform was most concentrated apically, whereas the other 2 isoforms were distributed more uniformly throughout the cytosol. Although quantitative PCR studies suggested that each isoform is expressed to a similar extent, immunoblotting instead suggested that the type III isoform is expressed most heavily. There are several possible reasons for this apparent discrepancy. First, mRNA levels do not always reflect protein levels. Second, cholangiocyte mRNA could have been contaminated with mRNA from hepatocytes, which predominantly express the type I and II isoforms.23,28 Finally, errors may have been introduced by our method of estimating InsP3R protein levels. However, our immunofluorescence examination of bile ducts plus the quantitative PCR studies of NRC cells together support the conclusion that the type III InsP3R is indeed the most heavily expressed iso-form. It was previously reported based on quantitative PCR studies that cholangiocytes lose the type III InsP3R but gain type II InsP3R after bile duct ligation.28 In hepatocytes, the type II InsP3R comprises 80% of the total pool of InsP3R and the remainder is the type I isoform.23 Therefore, the profile of InsP3R isoforms in cholangiocytes becomes similar to hepatocytes after bile duct ligation. Together, these findings suggest that the expression and subcellular distribution of InsP3Rs in cholangiocytes is more similar to what is found in NRC cells than in cholangiocytes following bile duct ligation.

The current findings also show that Cai2+ signals begin in the apical region of cholangiocytes, even though InsP3 presumably is generated basolaterally when cells are stimulated with ACh. There are several observations that may explain this finding. First, the range of InsP3 is up to 25 μm in cytosol,38 so it is feasible for InsP3 to act at a site different from where it is produced. Second, we observed that InsP3Rs are more concentrated in the apical region of cholangiocytes, and InsP -mediated Cai2+ signals may begin in regions where the InsP3R is clustered.39 Finally, Cai2+ signals in cholangiocytes begin in the region where the type III InsP3R is concentrated. This is consistent with the idea that the type III isoform of the InsP3R acts as a molecular trigger for Cai2+ signals, because Ca2+ released from this isoform stimulates further Ca2+ release in a positive feedback fashion.17 This isoform is localized to the apex of a number of epithelia in addition to cholangiocytes, including pancreatic and salivary acinar cells40-42 and the nonpigmented epithelium of the ciliary bilayer of the eye,25 and the apical region serves as the initiation site for Cai2+ waves in each of these cell types. Furthermore, hormone-induced Cai2+ waves spread from the apical to the basal pole in each of these cell types, as it does in cholangiocytes. However, there are at least 2 different mechanisms by which polarized Cai2+ waves may spread. In acinar cells, all 3 InsP3R isoforms are apical,40-42 whereas the RyR is basolateral.15 The InsP3R is required for apical initiation of the Cai2+ signal, whereas the RyR is needed for this signal to spread into the basolateral region.30,37,43,44 In contrast, nonpigmented epithelium cells express only the type III InsP3R apically and express the type I InsP3R basolaterally.25 Thus, the type I InsP3R rather than the RyR is responsible for the spread of Cai2+ waves into the basolateral region in that cell type. Because cholangiocytes express type I and II InsP3Rs in the baso-lateral region and do not express the RyR, the molecular basis for Cai2+ waves in cholangiocytes seems similar to what occurs in nonpigmented epithelium cells.

How does the current study increase our understanding of bile duct cell function? Evidence from other polarized epithelia suggests that apical Cai2+ signals and apical-to-basal Cai2+ waves regulate secretion. For example, apical increases in Cai2+ in pancreatic acinar cells lead to targeting of vesicles to the apical membrane and thus induce exocytosis.3 Bile ductular secretion depends on apical insertion of water channels45,46 and other membrane fusion events,47,48 which establishes a potential role for apical Cai2+ signals in cholangiocytes. In addition, apical-to-basal Cai2+ waves direct luminal Cl− secretion in acinar cells.3,49 Because Cai2+ mediates apical bicarbonate secretion in cholangiocytes33,50 and cholangiocytes express apical, Ca2+-activated Cl− channels,51,52 polarized Cai2+ waves may similarly direct fluid and electrolyte secretion in bile ducts. The small size and intrahepatic location of cholangiocytes limits the ability to relate Cai2+ signaling to secretion directly in these cells. However, NRC cells are known to form polarized monolayers that exhibit well-defined apical and basolateral domains21 and have been used to monitor secretion induced by Cai2+ agonists.34 Here we furthermore show that the predominant InsP3R in NRC cells is the type III isoform, which is more concentrated apically, and that biliary solutes such as ATP53 can induce Cai2+ oscillations in these cells. Thus, the asymmetric distribution of InsP3R isoforms may enable Cai2+ to regulate secretion by cholangiocytes, and NRC cells seem to be an appropriate model in which to examine this.

Acknowledgment

The authors thank Dr. R. Wojcikiewicz for graciously providing the polyclonal antibodies CT1 and CT2 as well as A. Mennone and M. Lüthi for technical assistance.

Supported by grants from the National Institutes of Health (DK45710, DK57751, TW01451, and DK34989), the Cystic Fibrosis Foundation, and the American Heart Association (to M.H.N.); Swiss National Foundation grant 3100-063696.00 (to J.-F.D.); Swiss National Foundation grant 3234055037.98 (to M.V.S.); and grants from Association pour la Recherche sur le Cancer (6551) and INSERM (contrat PRISME 98-09) (to D.C.).

Abbreviations

Cai2+

cytosolic Ca2+

InsP3

inositol 1,4,5-trisphosphate

IP3R

inositol 1,4,5-trisphosphate receptor

RyR

ryanodine receptor

NRC

normal rat cholangiocyte

ACh

acetylcholine

ATP

adenosine triphosphate

PCR

polymerase chain reaction

RT

reverse transcription

DiD

1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine perchlorate

mRNA

messenger RNA

References

  • 1.Fernandez-Chacon R, Konigstorfer A, Gerber S, Garcia J, Matos M, Stevens C, Brose N, et al. Synaptotagmin I functions as a calcium regulator of release probability. Nature. 2001;410:41–49. doi: 10.1038/35065004. [DOI] [PubMed] [Google Scholar]
  • 2.Cheek TR, Jackson TR, O'Sullivan AJ, Moreton RB, Berridge MJ, Burgoyne RD. Simultaneous measurements of cytosolic calcium and secretion in single bovine adrenal chromaffin cells by fluorescent imaging of fura-2 in cocultured cells. J Cell Biol. 1989;109:1219–1227. doi: 10.1083/jcb.109.3.1219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ito K, Miyashita Y, Kasai H. Micromolar and submicromolar Ca2+ spikes regulating distinct cellular functions in pancreatic acinar cells. EMBO J. 1997;16:242–251. doi: 10.1093/emboj/16.2.242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Gomez TM, Spitzer NC. In vivo regulation of axon extension and path-finding by growth-cone calcium transients. Nature. 1999;397:350–355. doi: 10.1038/16927. [DOI] [PubMed] [Google Scholar]
  • 5.Zheng JQ. Turning of nerve growth cones induced by localized increases in intracellular calcium ions. Nature. 2000;403:89–93. doi: 10.1038/47501. [DOI] [PubMed] [Google Scholar]
  • 6.Hahn K, DeBiasio R, Taylor DL. Patterns of elevated free calcium and calmodulin activation in living cells. Nature. 1992;359:736–738. doi: 10.1038/359736a0. [DOI] [PubMed] [Google Scholar]
  • 7.Lee J, Ishihara A, Oxford G, Johnson B, Jacobson K. Regulation of cell movement is mediated by stretch-activated calcium channels. Nature. 1999;400:382–386. doi: 10.1038/22578. [DOI] [PubMed] [Google Scholar]
  • 8.Dolmetsch RE, Xu K, Lewis RS. Calcium oscillations increase the efficiency and specificity of gene expression. Nature. 1998;392:933–936. doi: 10.1038/31960. [DOI] [PubMed] [Google Scholar]
  • 9.Li W, Llopis J, Whitney M, Zlokarnik G, Tsien RY. Cell-permeant caged InsP3 ester shows that Ca2+ spike frequency can optimize gene expression. Nature. 1998;392:936–941. doi: 10.1038/31965. [DOI] [PubMed] [Google Scholar]
  • 10.Maruyama Y, Inooka G, Li YX, Miyashita Y, Kasai H. Agonist-induced localized Ca2+ spikes directly triggering exocytotic secretion in exocrine pancreas. EMBO J. 1993;12:3017–3022. doi: 10.1002/j.1460-2075.1993.tb05970.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Nathanson MH, Burgstahler AD, Mennone A, Boyer JL. Characterization of cytosolic Ca2+ signaling in rat bile duct epithelia. Am J Physiol. 1996;271:G86–G96. doi: 10.1152/ajpgi.1996.271.1.G86. [DOI] [PubMed] [Google Scholar]
  • 12.Nathanson MH, Burgstahler AD, Fallon MB. Multi-step mechanism of polarized Ca2+ wave patterns in hepatocytes. Am J Physiol. 1994;267:G338–G349. doi: 10.1152/ajpgi.1994.267.3.G338. [DOI] [PubMed] [Google Scholar]
  • 13.Giannini G, Conti A, Mammarella S, Scrobogna M, Sorrentino V. The ryanodine receptor/calcium channel genes are widely and differentially expressed in murine brain and peripheral tissues. J Cell Biol. 1995;128:893–904. doi: 10.1083/jcb.128.5.893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Bennett DL, Cheek TR, Berridge MJ, De Smedt H, Parys JB, Missiaen L, Bootman MD. Expression and function of ryanodine receptors in nonexcitable cells. J Biol Chem. 1996;271:6356–6362. doi: 10.1074/jbc.271.11.6356. [DOI] [PubMed] [Google Scholar]
  • 15.Leite MF, Dranoff JA, Gao L, Nathanson MH. Expression and subcellular localization of the ryanodine receptor in rat pancreatic acinar cells. Biochem J. 1999;337:305–309. [PMC free article] [PubMed] [Google Scholar]
  • 16.Verma V, Carter C, Keable S, Bennett D, Thorn P. Identification and function of type-2 and type-3 ryanodine receptors in gut epithelial cells. Biochem J. 1996;319:449–454. doi: 10.1042/bj3190449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hagar RE, Burgstahler AD, Nathanson MH, Ehrlich BE. Type III InsP3 receptor channel stays open in the presence of increased calcium. Nature. 1998;396:81–84. doi: 10.1038/23954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ramos-Franco J, Fill M, Mignery GA. Isoform-specific function of single inositol 1,4,5-trisphosphate receptor channels. Biophys J. 1998;75:834–839. doi: 10.1016/S0006-3495(98)77572-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Bezprozvanny I, Watras J, Ehrlich BE. Bell-shaped calcium-response curves of Ins(1,4,5)P3- and calcium-gated channels from endoplasmic reticulum of cerebellum. Nature. 1991;351:751–754. doi: 10.1038/351751a0. [DOI] [PubMed] [Google Scholar]
  • 20.Sonnleitner A, Conti A, Bertocchini F, Schindler H, Sorrentino V. Functional properties of the ryanodine receptor type 3 (RyR3) Ca2+ release channel. EMBO J. 1998;17:2790–2798. doi: 10.1093/emboj/17.10.2790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Vroman B, LaRusso NF. Development and characterization of polarized primary cultures of rat intrahepatic bile duct epithelial cells. Lab Invest. 1996;74:303–313. [PubMed] [Google Scholar]
  • 22.Mignery GA, Sudhof TC, Takei K, De Camilli P. Putative receptor for inositol 1,4,5-trisphosphate similar to ryanodine receptor. Nature. 1989;342:192–195. doi: 10.1038/342192a0. [DOI] [PubMed] [Google Scholar]
  • 23.Wojcikiewicz RJH. Type I, II, and III inositol 1,4,5-trisphosphate receptors are unequally susceptible to down-regulation and are expressed in markedly different proportions in different cell types. J Biol Chem. 1995;270:11678–11683. doi: 10.1074/jbc.270.19.11678. [DOI] [PubMed] [Google Scholar]
  • 24.Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680–685. doi: 10.1038/227680a0. [DOI] [PubMed] [Google Scholar]
  • 25.Hirata K, Nathanson MH, Burgstahler AD, Okazaki K, Mattei E, Sears ML. Relationship between inositol 1,4,5-trisphosphate receptor isoforms and subcellular Ca2+ signaling patterns in nonpigmented ciliary epithelia. Invest Ophthalmol Vis Sci. 1999;40:2046–2053. [PubMed] [Google Scholar]
  • 26.Schlosser SF, Burgstahler AD, Nathanson MH. Isolated rat hepatocytes can signal to other hepatocytes and bile duct cells by release of nucleotides. Proc Natl Acad Sci U S A. 1996;93:9948–9953. doi: 10.1073/pnas.93.18.9948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
  • 28.Dufour J-F, Luthi M, Forestier M, Magnino F. Expression of inositol 1,4,5-trisphosphate receptor isoforms in rat cirrhosis. Hepatology. 1999;30:1018–1026. doi: 10.1002/hep.510300421. [DOI] [PubMed] [Google Scholar]
  • 29.Hirata K, Nathanson MH, Sears ML. Novel paracrine signaling mechanism in the ocular ciliary epithelium. Proc Natl Acad Sci U S A. 1998;95:8381–8386. doi: 10.1073/pnas.95.14.8381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nathanson MH, Padfield PJ, O'Sullivan AJ, Burgstahler AD, Jamieson JD. Mechanism of Ca2+ wave propagation in pancreatic acinar cells. J Biol Chem. 1992;267:18118–18121. [PubMed] [Google Scholar]
  • 31.Grynkiewicz G, Poenie M, Tsien RY. A new generation of Ca+ indicators with greatly improved fluorescence properties. J Biol Chem. 1985;260:3440–3450. [PubMed] [Google Scholar]
  • 32.Blondel O, Takeda J, Janssen H, Seino S, Bell GI. Sequence and functional characterization of a third inositol trisphosphate receptor subtype, IP3R-3, expressed in pancreatic islets, kidney, gastrointestinal tract, and other tissues. J Biol Chem. 1993;268:11356–11363. [PubMed] [Google Scholar]
  • 33.Dranoff JA, Masyuk AI, Kruglov EA, LaRusso NF, Nathanson MH. Polarized expression and function of P2Y ATP receptors in rat bile duct epithelia. Am J Physiol. 2001;281:G1059–G1067. doi: 10.1152/ajpgi.2001.281.4.G1059. [DOI] [PubMed] [Google Scholar]
  • 34.Schlenker T, Romac J, Sharara AI, Roman RM, Kim S, LaRusso NF, Liddle R, et al. Regulation of biliary secretion through apical purinergic receptors in cultured rat cholangiocytes. Am J Physiol. 1997;273:G1108–G1117. doi: 10.1152/ajpgi.1997.273.5.G1108. [DOI] [PubMed] [Google Scholar]
  • 35.Nathanson MH. Cellular and subcellular calcium signaling in gastrointestinal epithelium. Gastroenterology. 1994;106:1349–1364. doi: 10.1016/0016-5085(94)90030-2. [DOI] [PubMed] [Google Scholar]
  • 36.Leite MF, Nathanson MH. Calcium signaling in the hepatocyte. In: Arias IM, editor. The Liver: Biology and Pathobiology. 4th ed. Raven; Philadelphia: 2001. [Google Scholar]
  • 37.Leite MF, Burgstahler AD, Nathanson MH. Ca2+ waves require sequential activation of inositol 1,4,5-trisphosphate receptors and ryanodine receptors in pancreatic acinar cells. Gastroenterology. 2002;122:415–427. doi: 10.1053/gast.2002.30982. [DOI] [PubMed] [Google Scholar]
  • 38.Allbritton NL, Meyer T, Stryer L. Range of messenger action of calcium ion and inositol 1, 4,5-trisphosphate. Science. 1992;258:1812–1815. doi: 10.1126/science.1465619. [DOI] [PubMed] [Google Scholar]
  • 39.Marchant JS, Parker I. Role of elementary Ca2+ puffs in generating repetitive Ca2+ oscillations. EMBO J. 2001;20:65–76. doi: 10.1093/emboj/20.1.65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yule DI, Ernst SA, Ohnishi H, Wojcikiewicz RJH. Evidence that zymogen granules are not a physiologically relevant calcium pool — defining the distribution of inositol 1,4,5-trisphosphate receptors in pancreatic acinar cells. J Biol Chem. 1997;272:9093–9098. doi: 10.1074/jbc.272.14.9093. [DOI] [PubMed] [Google Scholar]
  • 41.Nathanson MH, Fallon MB, Padfield PJ, Maranto AR. Localization of the type 3 inositol 1,4,5-trisphosphate receptor in the Ca2+ wave trigger zone of pancreatic acinar cells. J Biol Chem. 1994;269:4693–4696. [PubMed] [Google Scholar]
  • 42.Lee MG, Xu X, Zeng WZ, Diaz J, Wojcikiewicz RJH, Kuo TH, Wuytack F, et al. Polarized expression of Ca2+ channels in pancreatic and salivary gland cells — correlation with initiation and propagation of [Ca2+]i waves. J Biol Chem. 1997;272:15765–15770. doi: 10.1074/jbc.272.25.15765. [DOI] [PubMed] [Google Scholar]
  • 43.Kasai H, Li YX, Miyashita Y. Subcellular distribution of Ca2+ release channels underlying Ca2+ waves and oscillations in exocrine pancreas. Cell. 1993;74:669–677. doi: 10.1016/0092-8674(93)90514-q. [DOI] [PubMed] [Google Scholar]
  • 44.Thorn P, Lawrie AM, Smith PM, Gallacher DV, Petersen OH. Local and global cytosolic Ca2+ oscillations in exocrine cells evoked by agonists and inositol trisphosphate. Cell. 1993;74:661–668. doi: 10.1016/0092-8674(93)90513-p. [DOI] [PubMed] [Google Scholar]
  • 45.Marinelli RA, Pham L, Agre P, LaRusso NF. Secretin promotes osmotic water transport in rat cholangiocytes by increasing aquaporin-1 water channels in plasma membrane. Evidence for a secretin-induced vesicular translocation of aquaporin-1. J Biol Chem. 1997;272:12984–12988. doi: 10.1074/jbc.272.20.12984. [DOI] [PubMed] [Google Scholar]
  • 46.Roberts SK, Yano M, Ueno Y, Pham L, Alpini G, Agre P, LaRusso NF. Cholangiocytes express the aquaporin CHIP and transport water via a channel-mediated mechanism. Proc Natl Acad Sci U S A. 1994;91:13009–13013. doi: 10.1073/pnas.91.26.13009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Tietz PS, Alpini G, Pham LD, LaRusso NF. Somatostatin inhibits secretin-induced ductal hypercholeresis and exocytosis by cholangiocytes. Am J Physiol. 1995;269:G110–G118. doi: 10.1152/ajpgi.1995.269.1.G110. [DOI] [PubMed] [Google Scholar]
  • 48.Kato A, Gores GJ, LaRusso NF. Secretin stimulates exocytosis in isolated bile duct epithelial cells by a cyclic AMP-mediated mechanism. J Biol Chem. 1992;267:15523–15529. [PubMed] [Google Scholar]
  • 49.Kasai H, Augustine GJ. Cytosolic Ca2+ gradients triggering unidirectional fluid secretion from exocrine pancreas. Nature. 1990;348:735–738. doi: 10.1038/348735a0. [DOI] [PubMed] [Google Scholar]
  • 50.Hirata K, Nathanson MH. Bile duct epithelia regulate biliary bicarbonate excretion in normal rat liver. Gastroenterology. 2001;121:396–406. doi: 10.1053/gast.2001.26280. [DOI] [PubMed] [Google Scholar]
  • 51.Fitz JG, Basavappa S, McGill J, Melhus O, Cohn JA. Regulation of membrane chloride currents in rat bile duct epithelial cells. J Clin Invest. 1993;91:319–328. doi: 10.1172/JCI116188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.McGill J, Basavappa S, Mangel AW, Shimokura GH, Middleton JP, Fitz JG. Adenosine triphosphate activates ion permeabilities in biliary epithelial cells. Gastroenterology. 1994;107:236–243. doi: 10.1016/0016-5085(94)90082-5. [DOI] [PubMed] [Google Scholar]
  • 53.Chari RS, Schutz SM, Haebig JE, Shimokura GH, Cotton PB, Fitz JG, Meyers WC. Adenosine nucleotides in bile. Am J Physiol. 1996;270:G246–G252. doi: 10.1152/ajpgi.1996.270.2.G246. [DOI] [PubMed] [Google Scholar]

RESOURCES