Skip to main content
PLOS One logoLink to PLOS One
. 2010 Nov 18;5(11):e14048. doi: 10.1371/journal.pone.0014048

The Agaricus bisporus cox1 Gene: The Longest Mitochondrial Gene and the Largest Reservoir of Mitochondrial Group I Introns

Cyril Férandon 1, Serge Moukha 2,3, Philippe Callac 3, Jean-Pierre Benedetto 1, Michel Castroviejo 1, Gérard Barroso 1,*
Editor: Jonathan H Badger4
PMCID: PMC2987802  PMID: 21124976

Abstract

In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp) are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II) according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a “Homing Endonuclease Gene” (heg) encoding a DNA endonuclease acting in transfer and site-specific integration (“homing”) and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain) is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt) and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote.

Introduction

Introns have been described in prokaryotes, eukaryotes and even in viral genomes [1], [2], [3], [4]. In eukaryotes, they are present in nuclear, plastidial and mitochondrial genes from several kingdoms and with various sizes and frequencies [5]. Large introns (from 0.1 to 5 kbp) are frequently found in mitochondrial genes of plant and fungal kingdoms [5]. However, they are scarce in the mitochondrial genomes of Metazoa, despite being grouped with fungi among the Fungi/Metazoa (Opisthokonts) super-kingdom. Mitochondrial introns are classified in two main groups (group I and II) according to their RNA secondary structure involved in the intron self-splicing mechanism [5], [6]. Mitochondrial group I and group II introns can be found in the same species and even in the same gene. Fungal mitochondrial genes tend to bear group I introns while plant mitochondrial genes tend to bear group II introns [5]. For example, the cox1 gene of the fungus Podospora anserina possesses 15 group I introns and one group II [7] and the complete mitochondrial genome of the liverwort Marchantia polymorpha carries 25 group II and seven group I [8]. Most of the mitochondrial group I introns carry a “Homing Endonuclease Gene” (heg) encoding a DNA endonuclease (HE) acting in the transfer and site-specific integration (“homing”) of the intron [9], [10], [11]. The presence of these heg allowed the raising of a theory where introns might be mobile elements able to spread and to be gained by genes after lateral transfer even between phylogenetically distant species from different kingdoms [12], [13]. However, this theory does not infer the origin of the mobile intron. Another theory suggests that introns were abundant in the ancestral genes and mainly evolve by loss [14], [15]. However, both hypotheses are matters of much debate about the dynamics of intron loss and gain during evolution [16], [17]. For example, two recent studies dealing with a group I intron widely distributed in plant angiosperms led to conflicting conclusions [16], [17]. Indeed, the history of these sequences is thought to be dominated by numerous events of loss [16] or due to frequent gains after a lateral transfer from a fungal donor [17].

The cox1 gene (encoding the subunit 1 of the cytochrome c oxydase) was widely used in a successful “DNA barcoding” taxonomic method in animals [18]. However, in the related fungal kingdom, this approach is hampered by the presence of several large group I introns [19]. Indeed, the fungal cox1 gene is the mitochondrial gene showing the highest number of introns [19]. Owing to this wealth of introns, few fungal complete cox1 gene sequences are available in databases, especially for species belonging to the Basidiomycota division where only nine sequences (Cryptococcus neoformans var. neoformans, Cryptococcus neoformans var. grubii, Ustilago maydis, Tilletia indica, Moniliophtora perniciosa, Pleurotus ostreatus, Agrocybe aegerita, Schizophyllum commune and Trametes cingulata) have been reported and correctly annotated to date.

To understand the evolution and dynamics of mitochondrial introns in fungi, we decided to determine the sequence and molecular organization of the commonly used cox1 model gene in the most widely cultivated mushroom in the world: Agaricus bisporus.

Results and Discussion

The A. bisporus cox1 gene: the largest mitochondrial intron reservoir

The complete sequence (29.902 nt, GenBank Accession number: EU314927) of the cox1 gene of the button mushroom Agaricus bisporus (Abi) was determined for a subculture (Bs 518) of the traditional brown cultivar C9 from overlapping cloned BamHI and EcoRI restriction fragments and cloned PCR products (Supplementary information file, Figure S1). An alignment of this gene with the cox1 exon sequence (CDS) of the related Agaricales Agrocybe aegerita [12] shows that the Abi cox1 CDS is split by 19 large (>1 kbp) introns. The borders of these introns, their group and sub-group were deduced from the design of each secondary structure (Supplementary information file, Figure S2) and from a comparison of the gene with the Abi cDNA (1,587 nt). The 19 introns are scattered over the whole gene sequence (Figure 1). The size of the exons varies from 3 nt (exon 2) to 288 nt (exon 20), contrasting with the large size of the introns that ranges from 1,057 nt (iAbi13) to 2,736 nt (iAbi2). The intron sequences represent 28,318 nt, i.e. 94.7% of the gene. The Abi cox1 gene is the longest mitochondrial gene reported to date in all kingdoms. Indeed, the next longest mitochondrial genes are the cox1 gene of the Ascomycota Podospora anserina (24,507 nt) which carries 14 group I and one group II introns [7] and the Basidiomycota Trametes cingulata (22,370 nt) with 15 group I introns [20].

Figure 1. Molecular organization of the Abi cox1 gene.

Figure 1

Vertical lines represent exons and their nucleotide (nt) sizes are indicated below the exon E1 to E20. The name and nt size of the introns are indicated in the empty boxes. The putative functional heg in group I introns are shown by vertical hachured boxes, and the eroded reverse transcriptase gene carried by the iAbi2 group II intron by a diagonal hachured box. The invading heg with a cob origin harbored by the iAbi11 intron is shown by a grey box.

Intact versus eroded intron encoded Open Reading Frames (ORFs)

Only one (iAbi2) of the 19 introns belongs to group II (subgroup IIA1). This large intron (2,736 nt) contains an eroded ORF (402 aa) encoding a putative protein possessing significant amino acid (aa) sequence identity (up to 38%) with the central and C-terminal regions of several reverse transcriptases (RT) encoded by plant and fungal mitochondrial group II introns. However, this encoded protein lacks the first 200 aa of the RT N-terminal region. All these RT genes are carried by group II introns possessing the same insertion site in the orthologous cox1 genes. The highest amino acid (aa) identities (id.) and similarities (sim.) of the iAbi2 putatively encoded RT were obtained with the phylogenetically distant Ascomycota Cryphonectria parasitica (38% aa id., 56% aa sim.) and the liverwort (Viridiplantae) Marchantia polymorpha (37% aa id., 54% aa sim.). In Abi, this intron might be undergoing an elimination process, as suggested by the erosion of the encoded reverse transcriptase.

Fifteen out of the 18 group I introns of the Abi cox1 gene harbor intact ORF encoding a putative functional HE, while only three (iAbi6, iAbi11 and iAbi14) contain eroded heg leading to non-functional HE (Figure 1). The eroded heg are characterized by the presence of several length and point mutations leading to frameshifts and to the appearance of stop codons interrupting the ORF.

Evidence for recent invasion of an A. bisporus cox1 intron by a heg arising from another gene

The heg encoded by the iAbi11 intron exhibits a peculiar organization, resulting from the insertion in a cox1 heg of an other invading heg (Figure 1). This intron ORF of 1,800 nt (nt 16,249–18,478) is constituted by the insertion (at nt 16,848) in the iAbi11 cox1 intron heg (recipient) of a second complete heg (invader). Both heg are in an open reading frame.

The iAbi11 recipient heg possesses a percentage of aa identity ranging from 73% with heg encoded by the Ascomycota Podospora anserina i9 or Gibberella zeae i5 to 40% for an orthologous group I intron widely distributed in plants. All these orthologous heg are carried by introns located at the same position in fungal and plant cox1 genes.

The iAbi11 invading heg is orthologous to a heg carried by an intron located in another mitochondrial gene: the cob gene of several Ascomycota species. The highest percentage of aa identity is obtained with G. zeae (50%) and P. anserina (47%).

In these two species, the invading and recipient heg are located in introns of the cob and cox1 genes, respectively. On the contrary, in A. bisporus, both heg are located in the same intron of the cox1 gene.

As the recipient and invading heg do not possess sequence homology, the iAbi11 chimeric heg can not be generated by a recombinational event. Hence, the invasion of the iAbi11 intron heg by a heg arising from an other gene (cob) suggests a recent transfer activity of the enzyme encoded by the mobile invading element, as previously reported in the T4 phage and in the fungus Podospora curvicolla [21], [22].

Landscape of eukaryotic mitochondrial group I introns: a patchy distribution

To understand the origin and dynamics of the Abi group I introns, all the complete cox1 genes in databases were compiled (Figure 2) as described in the Materials and Methods section. This showed that the mitochondrial group I introns have been reported in three kingdoms: Fungi/Metazoa, Viridiplantae and Amoebozoa. In the Fungi/Metazoa, mitochondrial group I introns have been described in a single species of the Choanoflagellida order (Monosiga brevicollis) [23], in one species of the Porifera phylum (Metazoa kingdom) [24] and in numerous species of the fungal kingdom [19]. In contrast, all the cox1 genes from the Eumetazoa lack group I intron, except two different intron types described in Cnidaria [25], [26], [27].

Figure 2. Schematic representation of the distribution of group I introns, according to their Pcl (row) and to the species harboring them (column).

Figure 2

Row “a” indicates the number of introns per species while column “b” shows the number of fungal introns per Pcl. All introns of the same Pcl are in the same row and all introns carried by a given species are in the same column. The first 35 Pcls were named by increasing alphabetic characters from the 5′-end of the cox1 CDS. The 37 rows of the Pcls are organized according to the decreasing number of fungal representatives they contain from the most distributed Pcl K (25 members) to the 12 Pcls of “rare” introns containing either a single member or two (E and AF Pcls) to four members (in both additional Pcls CO1 and CO2) shared by closely related species. Presence of intact and eroded/or absent heg are shown by black and hachured boxes, respectively. Species were organized according to their taxonomic (superkingdoms and kingdoms, phylla, orders) and their phylogenetic positions, as indicated in Figure 4 A and B. Fungi Dikarya Basidiomycota: Agaricus bisporus (EU314927), Aae: Agrocybe aegerita (AF010257), Pos: Pleurotus ostreatus (NC_009905), Mpe: Moniliophthora perniciosa (NC_005927), Tci: Trametes cingulata (NC_013933), Uma: Ustilago maydis (NC_008368), Tin: Tilletia indica (NC_009880), Cnevne: Cryptococcus neoformans var neoformans (AY560609). Ascomycota: Sja: Schizosaccharomyces japonicum (NC_004332), Soc: Schizosaccharomyces octosporus (NC_004312), Spo: Schizosaccharomyces pombe (NC_001326), Cze: Candida zemplinina (NC_005972), Yli: Yarrowia lipolytica (NC_002659), Hur: Hanseniaspora urvum (NC_007780), Dha: Debaryomyces hansenii (NC_010166), Cnee: Candida neerlandica (YP_002122387), Cor: Candida orthopsilosis (DQ026513), Cpa: Candida parapsilosis (NC_005253), Pca: Pichia canadensis (NC_001762), Kla: Kluyveromyces lactis (NC_006077), Kth: Kluyveromyces thermotholerans (NC_006626), Cgl: Candida glabrata (NC_004691), Sca: Saccharomyces castellii (NC_003920), Sce: Saccharomyces cerevisiae (NC_001224), Sse: Saccharomyces servazii (NC_004918), Ncr: Neurospora crassa (X14669), Pan: Podospora anserina (NC_001329), Hje: Hypocrea jecorina (NC_003388), Gze: Gibberella zeae (NC_009493), Cba: Cordyceps bassiana (ABU50156), Cbr: Cordyceps brongniartii (YP_002213602), Efl: Epidermophyton floccosum (NC_007394), Pbr: Paracoccioides brasiliensis (NC_007935), Pma: Penicillium marneffei (NC_005256), Eni: Emericella nidulans (X00790), Atu: Aspergillus tubingensis (NC_007597). Glomeromycota: Gin: Glomus intraradices (NC_012056). Blastocladiomycota: Ama: Allomyces macrogynus (NC_001715), Bem: Blastocladiella emersonii (YP_002274319). Chytridiomycota: Spu: Spizellomyces punctatus (NC_003052), Rsp: Rhizophydium sp. 136 (NC_003053), Msp: Monoblepharella sp. (NC_004624). Fungi incertae sedis: Scu: Smittium culisetae (NC_006837), Mve: Mortierella verticillata (NC_006838), Ror: Rhizopus oryzae (NC_006836). Ichthyosporea: Apa: Amoebidium parasiticum (AAN04062). Eumetazoa: Pjv: Palythoa sp. JVK-2006 (ABF67639). Corals: Mse: Metridium senile (NP_009253), Sra: Siderastrea radians (YP_654418), Rspc: Rhodactis sp. CASIZ 171755 (YP_654290), Rfl: Ricordea florida (YP_654303), Pang: Plakortis angulospiculatus (YP_001648679). Choanoflagellida: Mbr: Monosiga brevicollis (NP_696984). Dictyosteliida: Dci: Dictyostelium citrinum (NC_007787). Viridiplantae: Pwi:Prototheca wickeramii (NP_042244), Cat: Chlorokybus atmophyticus (YP_001315139), Cglo: Chaetosphaeridium globosum (NP_689386), Cvu: Chara vulgaris (NP_943703), Mpo: Marchantia polymorpha (NC_001660), Osat: Oryza sativa (BAD38494), Bvu: Beta vulgaris (NP_064063), Oel: Ochrosia elliptica (ABY83864), Patr: Plantago atrata (ABY83853). The following fungal species have intronless cox1 genes: Schizophyllum commune (NC_003049), Cryptococcus neoformans var grubii (NC_004336), Ashbya gossypii (NC_005789), Beauveria bassiana (YP_001876504), Mycosphaerella graminicola (NC_010222), Hyaloraphidium curvatum (NP_150103), Harpochytrium sp. JEL94 (NC_004760), Harpochytrium sp. JEL105 (NC_004623).

240 group I introns were found in 53 fungal cox1 genes (including three species of the Zygomycota phylum, now fungi incertae sedis). They were sorted in 35 position classes (Pcls) defined first by the same location in the cox1 CDS sequence. This distribution, which is based on the precise insertion site of each intron, is correlated with the highest sequence identities at the nucleotide level as well as with the amino acid identities of the putative encoded HE. Hence, each Pcl is also a sequence identity class. Indeed, each Pcl was shown to be constituted by introns inserted at the same position in the cox1 CDS and, when present, carrying an orthologous heg. The orthologous character was deduced first from BLASTx analysis. When using a heg described in a cox1 intron as a query in a BLASTx search, the homologous sequences with the higher scores (always higher than 80) and consequently, the lowest E-values (<e-20) were analyzed. In the large majority of cases, these sequences corresponded to heg located in introns with the same location in the cox1 CDS. If the sequence of the cox1 gene was complete and fully annotated, these heg were included in the same Pcl. Moreover, the analysis of all these complete cox1 genes allowed the highlight of some additional heg whose encoded protein was eroded or undescribed. The corresponding introns were added to the corresponding Pcl. In a few cases, a sequence with similar E-values but located in a mitochondrial gene different from the cox1 gene (nad5 or cob) was present in the BLAStx results. These sequences have been considered as an invader with a cox1 intron origin and not included in our analysis of the cox1 introns. In all cases, we did not find any non-homologous intron heg located at the same precise site of the cox1 CDS. This is in accordance with the fact that the insertion site of the intron appears to be determined by the DNA sequence precisely recognized by its encoded HE [2], [28]. As expected, the BLASTx results were confirmed by ClustalW alignments of the HE showing that the percentages of aa identity of all the intact HE belonging to a Pcl were always higher than those obtained when aligned with HE from the other Pcls (Supplementary information file, Figure S3).

The 35 Pcls were named in alphabetic order starting from the 5′-end of the cox1 CDS. Since all the 35 Pcls are represented in at least one of the six longest fungal cox1 genes, an alignment of the corresponding COXI proteins is used in Figure 3 to represent their relative positions. The six longest cox1 genes are found in the Basidiomycota Abi (18 group I introns), in the Ascomycota Podospora anserina (Pan: 14 introns) and Gibberella zeae (Gze: 12 introns), in the Chytridiomycota Rhyzophidium sp. (Rsp: 14 introns), in the Blastocladiomycota Allomyces macrogynus (Ama: 11 introns) and in the Glomeromycota Glomus intraradices (Gin: 11 introns).

Figure 3. Comparison of group I intron insertion sites in the amino acid alignment (Clustal W) of the COX1 protein encoded by six long cox1 genes of fungi.

Figure 3

Introns are designated by their Pcl name (From A to Z and from AA to AI) and by their number in each fungal gene starting from the 5′ end of the gene. Closed and open symbols (triangles) indicate introns with intact and eroded heg, respectively. The insertion sites of the coral introns Pcls CO1 and CO2 never reported to date in the fungal kingdom are indicated by an arrow. The symbols “+1” and “+2” indicate that the insertion of the intron occurs inside the indicated codon: between the nt 1 and nt 2 of this codon for “+1” and between the nt 2 and nt 3 for “+2”.

The number of fungal cox1 introns assigned to each Pcl varied greatly from 25 in the Pcl K to a single one in 8 different Pcls (Figure 2). Hence, these introns can be classified as being either rare or widely distributed. Rare introns are those detected either in a single species (8 Pcls) or in two closely related species for the Pcls E and AF, which both contain introns reported in two Blastocladiales. The introns of the remaining 25 Pcls show a wide and patchy distribution ranging from 2 in the Pcl W to 25 in the Pcl K, and they are present in different phyla of the fungal kingdom. At the same time, phylogenetically close species differ by the presence/absence of these introns. For instance, the two representatives of Pcl W have been described in the Glomeromycota Gin and in the distant Ascomycota Pan (Figure 2). The 25 representatives of the largest Pcl K are present in one species (Rsp) out of six Chytridiomycota, in one species out of two Blastocladiella, in the Glomeromycota species, in one out of three species of the basal fungal lineages, in seven out of ten Basidiomycota and in 14 out of 31 Ascomycota. Abi contains15 introns belonging to the 25 widely distributed Pcls, while Schizophyllum commune (Sco) which belongs to the same Agaricales order is intronless. Thus, the observed wide and patchy distribution of the group I fungal introns appears to result from numerous losses and gains of these mobile genetic elements.

Among the 35 fungal intron Pcls, 17 contained orthologous introns defined by the same position in the cox1 CDS in the Viridiplantae, Amoebozoa or Metazoa kingdoms. As previously established with fungal introns (i.e. deduced from BLASTx results and confirmed by percentages of aa identities of the encoded HE that were always higher inside a Pcl than between Pcls), the heg of the introns from all these kingdoms belonging to the same Pcl are orthologous genes. These Pcls represent 49% (17/35) of the Pcls and up to 60% (15/25) of the widely distributed ones. Except for two group I introns specifically harbored by coral species (classes Co1 and Co2), all the cox1 group I introns belong to Pcls previously defined by representatives from the fungal kingdom.

In Figure 2, the species were ordered according to their systematic position indicated in the taxonomic and phylogenetic trees in Figure 4A and B. The phylogenetic relationships of the species were deduced from the six-gene phylogeny established by James et al. [29]. The occurrence of the orthologous introns of the most widely distributed Pcl K is shown in the trees (Figure 4). This clearly shows that the patchy distribution of the species with and without orthologous introns requires a combination of multiple events of intron loss and gain.

Figure 4. Taxonomic and phylogenetic position of species with and without a Pcl K intron.

Figure 4

In Figure 4A and 4B, the species harboring a Pcl K orthologous intron with an intact or an eroded heg are in orange and green, respectively. The species lacking an orthologous intron are in black. The phylogenetic position of each fungal species was established according to the phylogenetic tree reported by James et al. [29] for the fungal kingdom using a six-gene phylogeny. When not present in the tree, species were located according to the nearest taxon (same genus or order) found in the tree.

A high sequence divergence can be seen between the heg sequences of orthologous introns of the same Pcl. The HE encoded by the introns of Pcl K show percentages of aa identity (and similarity) ranging from 31% aa id. (54% aa sim.) between the fungal Ascomycota Gze and the Viridiplantae Mpo to 56% aa id (73% aa sim.) between the Basidiomycota Abi and Aae. These sequence divergences between orthologous introns of the same Pcl, which are distributed over up to four kingdoms but are also observed between closely related species, can be explained by (i) a high divergence of vertically inherited introns maintained in the compared species during the course of evolution or (ii) independent gains due to lateral transfer.

Moreover, most of the Pcls of the widely distributed introns (Figure 2) contain introns with a potentially functional heg and others with an eroded heg. The Pcl AG is an exception containing four representatives with only intact heg. Erosion of the heg is thought to be a preliminary step before the complete elimination of the intron [14]. For each Pcl, the presence of intact and eroded heg, even in closely related species strengthens the hypothesis that numerous events of loss and gain occurred during evolution.

Most cox1 genes of the Viridiplantae, Amoebozoa and Metazoa kingdoms lack intron and only a small number of species harbor 1 to 6 group I introns. On the contrary, the majority (45 genes) of the 53 cox1 sequences of the fungal kingdom possess one to 18 introns, while only eight genes do not contain any intron.

Dynamics of intron mobility

To analyse the dynamics (loss and gain) of group I introns in eukaryotes, a curve (Figure 5) representing the number of species according to the number of introns of their cox1 gene was established. This curve does not fit with the Gaussian distribution that would be expected if the numbers of introns were to reflect random events of losses and gains. The plots can be represented by a theoretical curve showing a logarithmic decrease. Together with the high frequency of eroded heg carried by these introns (68 eroded heg among the 240 fungal introns analyzed), the curve can be interpreted as a trend of these group I introns towards loss from the cox1 genes. However, the six long genes distributed over five different fungal divisions behave as group I intron reservoirs, with 11 to 18 introns. They contain at least one representative of each Pcl, except for the introns reported in corals. As the eight rare introns detected once were reported in five of these six long genes, the ability to bear specific or rare introns appears to be a characteristic of these reservoir species.

Figure 5. Graphical representation of number of eukaryotic species (purple curve) and fungal species (blue curve) as a function of number of introns carried by their cox1 gene.

Figure 5

The red curve shows the logarithmic regression model (y = −5,0316Ln(x) +13,507; R2 = 0.83) with all the eukaryotic species analyzed.

Moreover, most of the introns described in the long cox1 genes from the basal fungal lineages carry eroded heg: 10 introns out of the 11 of Ama, 9 out of the 11 of Gin and 7 out of the 14 of Rsp. This suggests that these introns are being eliminated from these species. In principle, the erosion of the heg should definitively prevent the harboring intron from spreading. On the contrary, most of the introns of the long cox1 genes of Dikarya (16/18, 12/14 and 12/12 for Abi, Pan and Gze, respectively) maintain a putative functional heg.

In this context, the Abi cox1 gene has to be considered as the largest group I intron reservoir described to date. It possesses representatives of more than half (18/35 = 51%) of the Pcls, and more than 64% (16/25) of the widely distributed ones and all but two of its 18 group I introns possess intact and potentially functional heg.

Conclusion

It appears that the evolution of the mitochondrial genome of eukaryotes is still moving in the direction of group I intron loss. However, in some species and particularly in fungi, complete elimination of the group I intron seems counterbalanced by the gain mechanism resulting from the lateral transfer of these mobile genetic elements. Furthermore, the long genes described in the Dikarya fungi, whose the Abi cox1 gene is the most amazing representative to date, pose an appealing and still unresolved question about why and how some fungal species organize their mitochondrial genes in such an expensive manner.

Materials and Methods

DNA manipulation, molecular cloning and sequencing

The Abi cox1 complete gene was sequenced by conventional procedures [30] from cloned mitochondrial restriction fragments and from PCR products as indicated in Supplementary information files Figure S1. All new data sequencing (i.e the complete sequence of the Abi cox1 gene) has been deposited in the GenBank (Accession number EU314927).

The Agaricus bisporus strain Bs518 was cultured in Roux vials containing complete CYM medium supplemented with 10% (v/v) compost extract [31]. Mitochondrial DNA was purified from 5 g of vegetative mycelium according to Fukumasa-Nakaï et al.[32]. BamH1 and EcoRI mitochondrial DNA libraries were constructed in E. coli XL1-Blue [33] using pGEM-7Zf(+) from Promega, according to [30]. Both libraries were screened by hybridization on colonies with probes constituted first by an Abi cox1 cDNA and by cloned PCR products (Supplementary information files Figure S1).

Abi cox1 cDNA was obtained by RT-PCR from 1.5 µg of total RNAs extracted by the “Hot Phenol” procedure [34] using the Access RT-PCR kit from Promega and a set of specific primers (2.5 pmol) designed from the A. aegerita cox1 gene sequence (GenBank Accession number AF010257).

PCR amplifications were carried out using the Go Taq polymerase from Promega Corp. and couples of primers (Supplementary information files Figure S1) deduced from the sequences and synthesized by MWG (Seraing, Germany). PCR were performed in a Programmable Thermal Cycler PTC 200 (MJ Research Inc., Watertown, Mass., USA). Each reaction contained 10 to 30 ng of fungal genomic DNA, 4 µM of both primers, 200 µM of each dNTP, 1 unit of Taq DNA polymerase, in a final volume of 50 µl of the appropriate buffer. Reactions were run for 40 cycles at 95°C for 1 min, then two degrees below the Tm of both oligonucleotides for 1 min, 72°C for 1 min, and one final cycle at 72°C for 5 min. The PCR products were cloned on PGEMT-easy vector from Promega Corp. (Madison, Wisc, USA).

The different probes were recovered after agarose gel electrophoresis by using the “Wizard SV gel Kit”, then labeled with 925 kBq of [α32P] dCTP (110 TBq/mmol) from Amersham Pharmacia Biotech., using the Promega Corp. “Random Primers DNA Labeling Kit”. The probes had a specific radioactivity higher than 108 cpm/µg DNA.

Cloned PCR products and the isolated mitochondrial genomic fragments were sequenced by the primer walking methods using the Big Dye® Terminator Cycle Sequencing kit v 1.1 (Applied Biosystems). Sequencing was performed in the genotyping and sequencing facility at University Victor Segalen Bordeaux 2.

Sequence analyses

The overlapping cox1 sequences were compiled and analyzed with the DNA Strider 1.2 software (Commissariat à l'énergie atomique, Gif-sur-Yvette, France). Comparisons with sequences of the GenBank and EMBL databases were performed using the BLAST search algorithm [35].

Compilation of the complete cox1 gene sequences was performed by compiling the results (orthologous sequences) given by a BLASTx analysis using first the A. bisporus cox1 CDS as query. This analysis revealed most of the fungal cox1 sequences available in the Genbank and also numerous cox1 genes from plants. Second, all the intron heg carried by these sequences were used independently as a query for BLASTx analysis. This allowed the recovery of some additional split cox1 sequences from plants and also from other distant species such as Palythoa sp. JVK-2006 (Porifera), and species belonging to the Ichthyosporea, Choanoflagellida and Dictyosteliida phylla, which have been added to our analysis. Finally, the coral (Cnidaria) cox1 genes were added to the analysis because they contain the only introns reported to date in the Eumetazoa kingdom without homology with introns from other kingdoms. Alignments of nucleotide and protein sequences were carried out with Clustal W (1.8) software [36].

The intron secondary structures (Supplementary information files Figure S2) were deduced from the determination of the conserved sequences P, Q, R and S of the intron cores and of the base-paired regions P1–P9 with the help of RNA-Weasel software, and by direct comparison with the standard scheme for group I introns [37] and with the secondary structures of the database established by Damberger and Gutell.[38].

Supporting Information

Figure S1

Restriction map of the Abi mitochondrial genome region carrying the cox1 gene. The exon sequences are represented by coloured boxes. The cloned BamH1 and EcoRI restriction fragments used to determine the Abi cox1 gene sequence are indicated and named according to the restriction map. The sequenced PCR products and the location of the corresponding primers are indicated (CoxU: ATGAATTGGTTAAATTCTAC; 5'R: TTAAAAATGTAAACTCCTG, CoxR: TTATTAAGATTGCGCAGGT, B17U: TTAGTAGGATCCTCAGAG, E21R: AATATAAAGTACCTAAGGC; B13U: CCTTAAGATTGTAGAGTAG; B6R: ACAACAGATTATTTCTGGC; B6U: AATAAACTAACCCTACCAG; B15R: CTCTTAATATGATAAAGGTG; E19U: ATAAGATACTTAAGTCCCC; E14R: ATAAACTTAGCTACAGCC).

(0.18 MB PPT)

Figure S2

Secondary structures of the A. bisporus introns iAbi1 to iAbi19. Exonic sequences and intronic sequences are in lower-case and upper-case letters, respectively. The base-paired regions P1 to P9 are shown on the secondary structures, according to the standard scheme for group I introns described by Michel and Westhof [37]. For the group II intron iAbi2, the structural domains are indicated by roman numerals.

(0.74 MB PPT)

Figure S3

Alignement (A) and representation of the Total Score (B) obtained when comparing the 21 intact HE of the most widely distributed Pcl K. The Total Scores higher than 200 are in red, those between 80 and 200 in pink. In C are reported the percentages of aa identity (a) and aa similarity (b) between I-AbiVII-P and the 20 others orthologous HE.

(0.07 MB DOC)

Acknowledgments

The authors are grateful to James B. Anderson and Jianping Xu for providing the cloned mitochondrial fragments used during preliminary studies.

DNA Sequencing was performed in the Genotyping and Sequencing facility at University Victor Segalen Bordeaux 2.

They also thank Dr. Ray Cooke for editing the English.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: The authors have no support or funding to report.

References

  • 1.Haugen P, Simon DM, Bhattacharya D. The natural history of group I introns. Trends Genet. 2005;21(2):111–119. doi: 10.1016/j.tig.2004.12.007. [DOI] [PubMed] [Google Scholar]
  • 2.Lambowitz AM, Belfort M. Introns as mobile genetic elements. Annu Rev Biochem. 1993;62:587–622. doi: 10.1146/annurev.bi.62.070193.003103. [DOI] [PubMed] [Google Scholar]
  • 3.Nesbo CL, Doolittle WF. Active self-splicing group I introns in 23S rRNA genes of hyperthermophilic bacteria, derived from introns in eukaryotic organelles. Proc Natl Acad Sci U S A. 2003;100(19):10806–10811. doi: 10.1073/pnas.1434268100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sandegren L, Sjoberg BM. Distribution, sequence homology, and homing of group I introns among T-even-like bacteriophages: evidence for recent transfer of old introns. J Biol Chem. 2004;279(21):22218–22227. doi: 10.1074/jbc.M400929200. [DOI] [PubMed] [Google Scholar]
  • 5.Lang BF, Laforest MJ, Burger G. Mitochondrial introns: a critical view. Trends Genet. 2007;23(3):119–125. doi: 10.1016/j.tig.2007.01.006. [DOI] [PubMed] [Google Scholar]
  • 6.Saldanha R, Mohr G, Belfort M, Lambowitz AM. Group I and group II introns. FASEB J. 1993;7(1):15–24. doi: 10.1096/fasebj.7.1.8422962. [DOI] [PubMed] [Google Scholar]
  • 7.Cummings DJ, Michel F, McNally KL. DNA sequence analysis of the 24.5 kilobase pair cytochrome oxidase subunit I mitochondrial gene from Podospora anserina: a gene with sixteen introns. Curr Genet. 1989;16:381–406. doi: 10.1007/BF00340719. [DOI] [PubMed] [Google Scholar]
  • 8.Oda K, Yamato K, Ohta E, Nakamura Y, Takemura M, et al. Gene organization deduced from the complete sequence of liverwort Marchantia polymorpha mitochondrial DNA. A primitive form of plant mitochondrial genome. J Mol Biol. 1992;223:1–7. doi: 10.1016/0022-2836(92)90708-r. [DOI] [PubMed] [Google Scholar]
  • 9.Lambowitz AM, Perlman PS. Involvement of aminoacyl-tRNA synthetases and other proteins in group I and group II intron splicing. Trends Biochem Sci. 1990;15(11):440–444. doi: 10.1016/0968-0004(90)90283-h. [DOI] [PubMed] [Google Scholar]
  • 10.Lazowska J, Jacq C, Slonimski PP. Sequence of introns and flanking exons in wild-type and box3 mutants of cytochrome b reveals an interlaced splicing protein coded by an intron. Cell. 1980;22(2 Pt 2):333–348. doi: 10.1016/0092-8674(80)90344-x. [DOI] [PubMed] [Google Scholar]
  • 11.Pellenz S, Harington A, Dujon B, Wolf K, Schafer B. Characterization of the I-Spom I endonuclease from fission yeast: insights into the evolution of a group I intron-encoded homing endonuclease. J Mol Evol. 2002;55(3):302–313. doi: 10.1007/s00239-001-2327-4. [DOI] [PubMed] [Google Scholar]
  • 12.Gonzalez P, Barroso G, Labarere J. Molecular analysis of the split cox1 gene from the Basidiomycota Agrocybe aegerita: relationship of its introns with homologous Ascomycota introns and divergence levels from common ancestral copies. Gene. 1998;220(1–2):45–53. doi: 10.1016/s0378-1119(98)00421-1. [DOI] [PubMed] [Google Scholar]
  • 13.Vaughn JC, Mason MT, Sper-Whitis GL, Kuhlman P, Palmer JD. Fungal origin by horizontal transfer of a plant mitochondrial group I intron in the chimeric CoxI gene of Peperomia. J Mol Evol. 1995;41(5):563–572. doi: 10.1007/BF00175814. [DOI] [PubMed] [Google Scholar]
  • 14.Goddard MR, Burt A. Recurrent invasion and extinction of a selfish gene. Proc Natl Acad Sci U S A. 1999;96(24):13880–13885. doi: 10.1073/pnas.96.24.13880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gonzalez P, Barroso G, Labarere J. Molecular gene organisation and secondary structure of the mitochondrial large subunit ribosomal RNA from the cultivated Basidiomycota Agrocybe aegerita: a 13 kb gene possessing six unusual nucleotide extensions and eight introns. Nucleic Acids Res. 1999;27(7):1754–1761. doi: 10.1093/nar/27.7.1754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Cusimano N, Zhang LB, Renner SS. Reevaluation of the cox1 group I intron in Araceae and angiosperms indicates a history dominated by loss rather than horizontal transfer. Mol Biol Evol. 2008;25(2):265–276. doi: 10.1093/molbev/msm241. [DOI] [PubMed] [Google Scholar]
  • 17.Sanchez-Puerta MV, Cho Y, Mower JP, Alverson AJ, Palmer JD. Frequent, phylogenetically local horizontal transfer of the cox1 group I Intron in flowering plant mitochondria. Mol Biol Evol. 2008;25(8):1762–1777. doi: 10.1093/molbev/msn129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hebert PD, Ratnasingham S, deWaard JR. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc Biol Sci. 2003;270(Suppl 1):S96–9. doi: 10.1098/rsbl.2003.0025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Santamaria M, Vicario S, Pappadà G, Scioscia G, Scazzocchio C, et al. Towards barcode markers in Fungi: an intron map of Ascomycota mitochondria. BMC Bioinformatics. 2009;10(Suppl 6):S15. doi: 10.1186/1471-2105-10-S6-S15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Haridas S, Gantt JS. The mitochondrial genome of the wood-degrading basidiomycete Trametes cingulata. FEMS Microbiol Lett. 2010;308:29–34. doi: 10.1111/j.1574-6968.2010.01979.x. [DOI] [PubMed] [Google Scholar]
  • 21.Loizos N, Tillier ER, Belfort M. Evolution of mobile group I introns: recognition of intron sequences by an intron-encoded endonuclease. Proc Natl Acad Sci U S A. 1994;91(25):11983–11987. doi: 10.1073/pnas.91.25.11983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Saguez C, Lecellier G, Koll F. Intronic GIY-YIG endonuclease gene in the mitochondrial genome of Podospora curvicolla: evidence for mobility. Nucleic Acids Res. 2000;28(6):1299–1306. doi: 10.1093/nar/28.6.1299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lang BF, O'Kelly C, Nerad T, Gray MW, Burger G. The closest unicellular relatives of animals. Curr Biol. 2002;12:1773–1778. doi: 10.1016/s0960-9822(02)01187-9. [DOI] [PubMed] [Google Scholar]
  • 24.Wang X, Lavrov DV. Seventeen new complete mtDNA sequences reveal extensive mitochondrial genome evolution within the Demospongiae. PLoS ONE. 2008;3:e2723. doi: 10.1371/journal.pone.0002723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Fukami H, Chen CA, Chiou CY, Knowlton N. Novel group I introns encoding a putative homing endonuclease in the mitochondrial cox1 gene of Scleractinian corals. J Mol Evol. 2007;64(5):591–600. doi: 10.1007/s00239-006-0279-4. [DOI] [PubMed] [Google Scholar]
  • 26.Goddard MR, Leigh J, Roger AJ, Pemberton AJ. Invasion and persistence of a selfish gene in the Cnidaria. PLoS ONE. 2006;1e3 doi: 10.1371/journal.pone.0000003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Rot C, Goldfarb I, Ilan M, Huchon D. Putative cross-kingdom horizontal gene transfer in sponge (Porifera) mitochondria. BMC Evol Biol. 2006;6:71. doi: 10.1186/1471-2148-6-71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Seligman LM, Stephens KM, Savage JH, Monnat RJ., Jr Genetic analysis of the Chlamydomonas reinhardtii I-CreI mobile intron homing system in Escherichia coli. Genetics. 1997;147:1653–1664. doi: 10.1093/genetics/147.4.1653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, et al. Reconstructing the early evolution of Fungi using a six-gene phylogeny. Nature. 2006;443(7113):818–822. doi: 10.1038/nature05110. [DOI] [PubMed] [Google Scholar]
  • 30.Maniatis T, Frisch EF, Hoffman J. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press 1982 [Google Scholar]
  • 31.Raper JR, Hoffman RM. Schizophyllum commune. Handbook of genetics. 1974;1:597–626. [Google Scholar]
  • 32.Fukumasa-Nakai Y, Matsumoto T, Fukuda M. Efficient isolation of mitochondrial DNA from higher Basidiomycetes for restriction endonuclease analysis. Rept Tottori Mycol Inst. 1992;30:60–68. [Google Scholar]
  • 33.Bullock WO, Fernandez JM, Stuart JM. XL1-Blue: a high efficiency plasmid transforming recA Escherichia coli strain with beta-galactosidase selection. Bio.Techniques. 1987;5:376–337. [Google Scholar]
  • 34.Wessels JGH, Mulder GH, Springer J. Expression of dikaryon-specific and non-specific mRNAs of Schizophyllum commune in relation to environmental conditions and fruiting. J Gen Microbiol. 1987;133:2557–2561. [Google Scholar]
  • 35.Altschul SF, Gish W, Miller W, Myers EW, Lipman, DJ Basic local alignment search tool. J Mol Biol. 1990;215(3):403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 36.Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;(2222):4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Michel F, Westhof E. Modelling of the three-dimensional architecture of group I catalytic introns based on comparative sequence analysis. J Mol Biol. 1990;216(3):585–610. doi: 10.1016/0022-2836(90)90386-Z. [DOI] [PubMed] [Google Scholar]
  • 38.Damberger SH, Gutell RR. A comparative database of group I intron structures. Nucleic Acids Res. 1994;22(17):3508–3510. doi: 10.1093/nar/22.17.3508. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Restriction map of the Abi mitochondrial genome region carrying the cox1 gene. The exon sequences are represented by coloured boxes. The cloned BamH1 and EcoRI restriction fragments used to determine the Abi cox1 gene sequence are indicated and named according to the restriction map. The sequenced PCR products and the location of the corresponding primers are indicated (CoxU: ATGAATTGGTTAAATTCTAC; 5'R: TTAAAAATGTAAACTCCTG, CoxR: TTATTAAGATTGCGCAGGT, B17U: TTAGTAGGATCCTCAGAG, E21R: AATATAAAGTACCTAAGGC; B13U: CCTTAAGATTGTAGAGTAG; B6R: ACAACAGATTATTTCTGGC; B6U: AATAAACTAACCCTACCAG; B15R: CTCTTAATATGATAAAGGTG; E19U: ATAAGATACTTAAGTCCCC; E14R: ATAAACTTAGCTACAGCC).

(0.18 MB PPT)

Figure S2

Secondary structures of the A. bisporus introns iAbi1 to iAbi19. Exonic sequences and intronic sequences are in lower-case and upper-case letters, respectively. The base-paired regions P1 to P9 are shown on the secondary structures, according to the standard scheme for group I introns described by Michel and Westhof [37]. For the group II intron iAbi2, the structural domains are indicated by roman numerals.

(0.74 MB PPT)

Figure S3

Alignement (A) and representation of the Total Score (B) obtained when comparing the 21 intact HE of the most widely distributed Pcl K. The Total Scores higher than 200 are in red, those between 80 and 200 in pink. In C are reported the percentages of aa identity (a) and aa similarity (b) between I-AbiVII-P and the 20 others orthologous HE.

(0.07 MB DOC)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES